ID: 907146877

View in Genome Browser
Species Human (GRCh38)
Location 1:52242691-52242713
Sequence CCATCAGTACATAAGAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907146877_907146880 27 Left 907146877 1:52242691-52242713 CCTAGTTTCTTATGTACTGATGG 0: 1
1: 0
2: 0
3: 5
4: 111
Right 907146880 1:52242741-52242763 AGCTGCTTTAGAATATTACATGG 0: 1
1: 0
2: 1
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907146877 Original CRISPR CCATCAGTACATAAGAAACT AGG (reversed) Intronic
901446665 1:9312590-9312612 CCATCAGCACTCAGGAAACTTGG - Intronic
904683149 1:32242561-32242583 CCTCCCATACATAAGAAACTTGG + Intergenic
906218675 1:44060161-44060183 CCTTCTGTATATAAAAAACTTGG + Intergenic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
908068006 1:60428333-60428355 CCTTCAGCACATAAGCATCTCGG + Intergenic
912004934 1:104886399-104886421 CCTTCAGTCCTTAAGAATCTTGG - Intergenic
918279803 1:182993334-182993356 CCATCAGACCAAAAGAATCTTGG - Intergenic
919270285 1:195333003-195333025 TCCTCATTAAATAAGAAACTGGG + Intergenic
919960288 1:202460628-202460650 CTATCAGTAGAGAAAAAACTTGG - Intronic
924459325 1:244244557-244244579 TCTTCATTACATAAGAAAGTGGG + Intergenic
924548011 1:245048289-245048311 CACTCAGTACTTCAGAAACTTGG - Intronic
1065053053 10:21815514-21815536 CCAGCAGTATCTATGAAACTAGG + Intronic
1068316412 10:55349133-55349155 CCATGACTACAGAAGAAACATGG - Intronic
1074988343 10:118678296-118678318 CTATCAGTAGATAAGTAATTTGG - Exonic
1081695251 11:45105108-45105130 CCATCTGTACATGAGAAAGTGGG - Intronic
1081829731 11:46098061-46098083 CCTTCAGTACCTAGGAAAGTAGG + Intronic
1082935981 11:58657252-58657274 CAATAAGTACATAAAAAAATGGG + Intronic
1085661248 11:78369236-78369258 CAATCATTGCATTAGAAACTTGG + Intronic
1085671674 11:78471347-78471369 CCATCAAAACAAAAGAAAATGGG + Intronic
1086655972 11:89355682-89355704 CCAGCAGTACATAAGAGCTTAGG - Intronic
1089758584 11:120706322-120706344 CCAGGAGTCCAGAAGAAACTGGG - Intronic
1096423019 12:51476650-51476672 CCATCAGTACATCAAAAATGGGG + Intronic
1098798029 12:74918063-74918085 ACATGAGTACATAAGGAACATGG + Intergenic
1105298565 13:19113096-19113118 CCATCACAAGGTAAGAAACTGGG - Intergenic
1106780497 13:33054473-33054495 CCATTTGTAAATGAGAAACTGGG + Intronic
1112839714 13:103561345-103561367 CTATCAGTACATCTGCAACTGGG - Intergenic
1115206863 14:30916728-30916750 CCATCATTAAATTAAAAACTAGG - Intronic
1115663236 14:35518459-35518481 AAATAAGTAAATAAGAAACTAGG - Intergenic
1115716837 14:36114900-36114922 CTATCAGTACATTATAAAGTAGG - Intergenic
1116332036 14:43609460-43609482 CCAAAAGTACTTAAGAATCTGGG + Intergenic
1118988411 14:70776769-70776791 CCATCAGCCCTTAAGACACTAGG + Intronic
1121433899 14:93906298-93906320 CCACAAGTTCCTAAGAAACTGGG - Intergenic
1121864304 14:97348054-97348076 CCATGAATACATAGGAAACAAGG + Intergenic
1124681204 15:31732638-31732660 CCACCTGTACATAGGAAACTTGG - Intronic
1124812418 15:32954169-32954191 CCCCCACTACATAAAAAACTTGG + Intronic
1125553603 15:40566205-40566227 CCATCAGTAGCCAAGTAACTTGG + Intergenic
1126269387 15:46796213-46796235 AGATCAGAACATAAGAAGCTTGG + Intergenic
1128553713 15:68615725-68615747 CCATCAGTGAATCAGAAAGTGGG + Intronic
1130833497 15:87626871-87626893 ACATCAGTCCATAAGAAATTGGG + Intergenic
1131978583 15:97972166-97972188 CTATCACTAAATATGAAACTGGG + Exonic
1140464535 16:75169629-75169651 ACATCAGAAAATAAAAAACTTGG + Exonic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1148380609 17:47194068-47194090 CCATTTGTAGATGAGAAACTGGG - Intergenic
1156385620 18:36602285-36602307 CCATCAGCACAGAAGAAAAGGGG - Intronic
1156929477 18:42624548-42624570 CAATCAGTACTTAAGCCACTAGG + Intergenic
1157147033 18:45174289-45174311 CCATCAGTAAAGAAGAAAAATGG - Intergenic
1158825172 18:61210168-61210190 CTATCATTACTTATGAAACTGGG - Intergenic
1164980198 19:32607864-32607886 TCATCAGTATTGAAGAAACTGGG + Intronic
927732593 2:25487748-25487770 CCAAAAATACATGAGAAACTGGG + Intronic
929167943 2:38902394-38902416 CCATATGTATATAAGAAATTGGG + Intronic
930723617 2:54661548-54661570 CCCCCAGAACATAAGAAGCTTGG - Intronic
934094363 2:88585425-88585447 CCATTAGTATATAAGAAGATTGG + Intronic
935696535 2:105775849-105775871 TCATCTGTAAATGAGAAACTTGG + Intronic
939731656 2:145792503-145792525 ACTTCAGTATATAAAAAACTTGG - Intergenic
941232804 2:162931894-162931916 GCACCAGTACATAAGAATATAGG - Intergenic
942673685 2:178404230-178404252 CCATATGTACTTAAGTAACTGGG + Intergenic
1170195090 20:13681316-13681338 CCATCAGGACATTAGGAACTAGG - Intergenic
1174976715 20:55344115-55344137 ACATCAGTTTCTAAGAAACTTGG + Intergenic
1181575255 22:23790118-23790140 CCTTCAGAACTTAGGAAACTGGG - Intronic
1182224541 22:28785987-28786009 TCATCAGTCCTTAAGATACTAGG + Intronic
1182845270 22:33425532-33425554 CCTACAGTACAAAAGAAAGTAGG + Intronic
957201409 3:77140731-77140753 CCATCAGTAGATATTAAATTGGG - Intronic
959320087 3:104862088-104862110 CTATCTGTACATAAAACACTAGG - Intergenic
964838510 3:160967848-160967870 CCATCAGTTTATAGGAAAATGGG - Intronic
971617623 4:28812878-28812900 CCCTCAGTAAATTAGCAACTTGG - Intergenic
978264041 4:106800862-106800884 TGACCTGTACATAAGAAACTGGG - Intergenic
980418175 4:132520699-132520721 CCATCAAAACATCATAAACTGGG - Intergenic
982923029 4:161300420-161300442 CCATCAGTGTTTAAGAAACAAGG + Intergenic
984174027 4:176394028-176394050 TCAACAGTATATAAGAAAATGGG + Intergenic
984509781 4:180665587-180665609 ACATCATTCCTTAAGAAACTAGG - Intergenic
985342160 4:188966253-188966275 TCATCAATACGTAAGAAACTAGG - Intergenic
986817068 5:11424485-11424507 ACATCAGTGCATATAAAACTGGG + Intronic
989157111 5:38354742-38354764 CCATAAAAACATAAAAAACTGGG - Intronic
990738040 5:58885657-58885679 CCATCAGAACAAAAGTAAATTGG - Intergenic
992424831 5:76646212-76646234 CCAACAGCACAACAGAAACTAGG - Intronic
992467400 5:77020397-77020419 ACATCTGTCCATAAGTAACTCGG + Intergenic
993372409 5:87108941-87108963 CCACCACTACATGAGAAACATGG - Intergenic
996797702 5:127367801-127367823 CCATCAGTACCTAAGACAAGTGG + Intronic
998773495 5:145572685-145572707 CCTTCCCTACATATGAAACTGGG - Intronic
998881347 5:146648279-146648301 CAATCAGTAATTCAGAAACTCGG - Intronic
1000534984 5:162468870-162468892 CCATAAGCACATAAGCAACATGG - Intergenic
1003117781 6:3294894-3294916 CCATCAGTACATCCTAACCTTGG - Intronic
1005246638 6:23893230-23893252 CCATCCCAACATAAGAATCTAGG - Intergenic
1010021385 6:71163710-71163732 ACATGAGTACACAAAAAACTGGG - Intergenic
1018405523 6:163477811-163477833 CCATCAGGGCTTAAGAAGCTGGG - Intronic
1019262214 7:87984-88006 CCATCAGCACGAAAGCAACTAGG - Intergenic
1019641973 7:2108136-2108158 CCATCAGAAGAGAACAAACTTGG + Intronic
1020268375 7:6577083-6577105 ACATAAGTAAATAAGAAAATAGG + Intergenic
1020478066 7:8622444-8622466 CAAAAAGTACATATGAAACTTGG + Intronic
1021477146 7:21075002-21075024 CCATTATTACAAAAAAAACTGGG - Intergenic
1022042766 7:26596071-26596093 CCATCATTAGATAAGGCACTGGG - Intergenic
1024371929 7:48595658-48595680 CCATTAGTCCAATAGAAACTGGG - Intronic
1029167882 7:98607725-98607747 CAATCAGCACATAAGCAACGTGG + Intergenic
1029644793 7:101847318-101847340 CCCTCAGTGGATAAGAACCTGGG + Intronic
1031089444 7:117336724-117336746 CCACAAGTACATTAGAAATTAGG + Intergenic
1033653063 7:143356456-143356478 CCAGCAGTACAGCTGAAACTGGG - Exonic
1033668317 7:143464878-143464900 CCACCATTACAAAAGTAACTGGG - Intergenic
1034530763 7:151695053-151695075 CCAACAGCACATCGGAAACTTGG - Intronic
1037274629 8:17164796-17164818 TTATCTGTACATAAGAAAATAGG - Intronic
1037560488 8:20069698-20069720 CAATGAGAACATAAGATACTTGG - Intergenic
1038873923 8:31527345-31527367 CAATCAGTAGATATGAAATTAGG - Intergenic
1039075369 8:33686048-33686070 CCATCTTCACAAAAGAAACTTGG - Intergenic
1039122414 8:34162015-34162037 CAAACATTAAATAAGAAACTAGG - Intergenic
1039316641 8:36381120-36381142 ACATCAGTCCATAATAAAATGGG + Intergenic
1039752780 8:40493531-40493553 CCATCAGCACATGAGAAGTTTGG + Intergenic
1041960029 8:63603039-63603061 CCATCTATAAATAAGAAAGTAGG + Intergenic
1047551759 8:125881294-125881316 GTATCAGTAGATAAGATACTAGG - Intergenic
1050557733 9:6804283-6804305 ACATCACTACATAAGCAGCTGGG - Intronic
1053032601 9:34794077-34794099 CCATGAGTATATAAACAACTTGG - Intergenic
1057114986 9:92512583-92512605 CCATCTCTGCATAAGAAGCTTGG + Intronic
1058038167 9:100275654-100275676 CCATCCTAACATAATAAACTGGG - Intronic
1060672200 9:125479700-125479722 CCATCAGAAGACAAGCAACTGGG + Intronic
1195006712 X:100692351-100692373 ACATCAGTAAATAAGATACGTGG - Intronic
1196709341 X:118746283-118746305 CCATCTGTACAAAAAAAAATTGG - Intronic
1200797723 Y:7356958-7356980 CCACCAGCTCATAAGAAAATAGG - Intergenic
1202196358 Y:22302010-22302032 ACATCAGAACATTAGACACTGGG + Intergenic
1202575428 Y:26319313-26319335 CTATCAGTAGAGAAAAAACTTGG + Intergenic