ID: 907154088

View in Genome Browser
Species Human (GRCh38)
Location 1:52316327-52316349
Sequence CACAAAAATTAGCTGGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4755
Summary {0: 4, 1: 58, 2: 675, 3: 1374, 4: 2644}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907154083_907154088 -7 Left 907154083 1:52316311-52316333 CCCCGTCTCTAGTAAACACAAAA 0: 1
1: 29
2: 670
3: 11467
4: 140768
Right 907154088 1:52316327-52316349 CACAAAAATTAGCTGGGCTTTGG 0: 4
1: 58
2: 675
3: 1374
4: 2644
907154081_907154088 12 Left 907154081 1:52316292-52316314 CCTGGCCAACATGGTGAAACCCC 0: 64910
1: 151465
2: 197443
3: 160987
4: 104258
Right 907154088 1:52316327-52316349 CACAAAAATTAGCTGGGCTTTGG 0: 4
1: 58
2: 675
3: 1374
4: 2644
907154085_907154088 -9 Left 907154085 1:52316313-52316335 CCGTCTCTAGTAAACACAAAAAT 0: 1
1: 21
2: 297
3: 2510
4: 25276
Right 907154088 1:52316327-52316349 CACAAAAATTAGCTGGGCTTTGG 0: 4
1: 58
2: 675
3: 1374
4: 2644
907154082_907154088 7 Left 907154082 1:52316297-52316319 CCAACATGGTGAAACCCCGTCTC 0: 34182
1: 124688
2: 145165
3: 98748
4: 47715
Right 907154088 1:52316327-52316349 CACAAAAATTAGCTGGGCTTTGG 0: 4
1: 58
2: 675
3: 1374
4: 2644
907154080_907154088 16 Left 907154080 1:52316288-52316310 CCAGCCTGGCCAACATGGTGAAA 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
Right 907154088 1:52316327-52316349 CACAAAAATTAGCTGGGCTTTGG 0: 4
1: 58
2: 675
3: 1374
4: 2644
907154084_907154088 -8 Left 907154084 1:52316312-52316334 CCCGTCTCTAGTAAACACAAAAA 0: 1
1: 44
2: 1122
3: 18769
4: 220386
Right 907154088 1:52316327-52316349 CACAAAAATTAGCTGGGCTTTGG 0: 4
1: 58
2: 675
3: 1374
4: 2644

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907154088 Original CRISPR CACAAAAATTAGCTGGGCTT TGG Intronic
Too many off-targets to display for this crispr