ID: 907156002

View in Genome Browser
Species Human (GRCh38)
Location 1:52334515-52334537
Sequence GTTGTAAGCATCAGAATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907155999_907156002 -7 Left 907155999 1:52334499-52334521 CCTAGTTCCCAAAGCTGTTGTAA 0: 1
1: 0
2: 3
3: 39
4: 263
Right 907156002 1:52334515-52334537 GTTGTAAGCATCAGAATTGTTGG 0: 1
1: 0
2: 0
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907156002 Original CRISPR GTTGTAAGCATCAGAATTGT TGG Intronic
901126933 1:6936122-6936144 GTGGAAAGCATCAGATTTCTTGG + Intronic
902636366 1:17737373-17737395 GTGGTGAGCATCTGAAATGTGGG - Intergenic
902687081 1:18085188-18085210 GTTTTAAGCATCTAAGTTGTGGG - Intergenic
907156002 1:52334515-52334537 GTTGTAAGCATCAGAATTGTTGG + Intronic
909205499 1:72752015-72752037 GAAGCAAGCACCAGAATTGTAGG + Intergenic
919502503 1:198355157-198355179 GTTGTAAGGATTAGAAAAGTAGG + Intergenic
920656320 1:207878083-207878105 GTTCTAAGCTTCTGAATTTTGGG - Intergenic
921141825 1:212315015-212315037 GTTTTAAGCCACAGAATTTTGGG + Intronic
921739445 1:218667166-218667188 GTTCTTAGAAGCAGAATTGTGGG - Intergenic
923167046 1:231375579-231375601 TTTATAAGCAGCAGAATTTTTGG + Intronic
923533816 1:234832658-234832680 ATTGCAACCATCAGAGTTGTAGG + Intergenic
924200240 1:241650981-241651003 GGTGAATGCATTAGAATTGTAGG + Intronic
924909964 1:248499296-248499318 GTTGTAAGCATCAGCTTCCTAGG + Intergenic
924914140 1:248548759-248548781 GTTGTAAGCATCAGCTTCCTAGG - Intergenic
1066211477 10:33243539-33243561 GTTTAAAGCATTGGAATTGTAGG + Intronic
1068096856 10:52502093-52502115 CTCCAAAGCATCAGAATTGTTGG + Intergenic
1068112292 10:52694300-52694322 GTTTTAAGCTACAGAATTTTTGG - Intergenic
1068617412 10:59134811-59134833 GTTATTTGCATCAGAACTGTGGG - Intergenic
1073745052 10:106458874-106458896 GTTGTCAGCATGAGTATTGTTGG + Intergenic
1076263233 10:129088724-129088746 GTTGTTAGCACCAGAATGGGTGG + Intergenic
1076575538 10:131464331-131464353 ATTCTAAGGAACAGAATTGTTGG + Intergenic
1079985812 11:27199575-27199597 GTTGTAATTATCAGAGATGTTGG + Intergenic
1084025482 11:66445956-66445978 GTTATAAGCAACAGAAAGGTGGG - Intronic
1089364216 11:117911248-117911270 GTTGGAAGCATCAGAGGTTTGGG - Intronic
1089568474 11:119386083-119386105 GTTGGAGGTATCAGATTTGTAGG - Intergenic
1089873571 11:121698259-121698281 GTTGTAAGTATTAGAAGAGTTGG - Intergenic
1089910069 11:122089265-122089287 GTTTTAAGCATGATAATTGTTGG - Intergenic
1093644268 12:21565822-21565844 GTTGTTAACATCAGAAAGGTGGG - Intronic
1099678823 12:85797361-85797383 TCTGTAAGTATCAGAATTTTAGG - Intergenic
1099723708 12:86397990-86398012 GTTTTTAGCATCAGAATATTTGG + Intronic
1100509968 12:95260905-95260927 AATGTTAGAATCAGAATTGTGGG + Intronic
1101054076 12:100894452-100894474 GCTTTGAGCATCAGAATTGGTGG - Intronic
1106447724 13:29850902-29850924 GCTGTGATCATGAGAATTGTTGG + Intergenic
1110355671 13:74564043-74564065 TTTGTCAGCATTAGAATTGAGGG + Intergenic
1112608634 13:100932891-100932913 TTTGCAAGCATCAGGATTTTTGG + Intergenic
1113437249 13:110302738-110302760 ATTGTATGCATAAGAATGGTAGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114285203 14:21235438-21235460 GTATTAAGCATCAGAATGATAGG - Intronic
1116911351 14:50468847-50468869 GTTATAATCACCAGACTTGTTGG + Intronic
1117643211 14:57822743-57822765 GTTTTAAGCCACAGAATTTTAGG - Intronic
1122259980 14:100511134-100511156 GTTGAAAGAAACAAAATTGTTGG - Intronic
1124395073 15:29293975-29293997 GCAGGGAGCATCAGAATTGTAGG - Intronic
1127522775 15:59759587-59759609 GCTGTTAGCATCACAATTCTTGG + Intergenic
1128759297 15:70204562-70204584 GTCCTAAGCCTGAGAATTGTGGG - Intergenic
1129633717 15:77291489-77291511 GTTGTCAGCATCATATTGGTGGG - Intronic
1131681344 15:94726778-94726800 TTTGAAAGCATCAGAATTATAGG - Intergenic
1134608431 16:15589332-15589354 CTTTTCAGCATCAGAATGGTGGG - Intronic
1135146581 16:19967836-19967858 GTTGTAAGCCACTGAAATGTTGG + Intergenic
1153733775 18:8043615-8043637 CATGGAAGCATCAGGATTGTAGG - Intronic
1155757081 18:29512946-29512968 GTTGGAAGCAGGAGGATTGTAGG - Intergenic
1156321314 18:36026462-36026484 CATGTAAGCATTAGAATTGGCGG + Intronic
1158268676 18:55688488-55688510 TCTGAAAGCATCAGAATTGGTGG - Intergenic
1158787234 18:60729518-60729540 TTTAAAAGCATTAGAATTGTAGG + Intergenic
1159013574 18:63082652-63082674 ATTGTAACCATCAAAAATGTAGG - Intergenic
1164955523 19:32379929-32379951 CTTGTGAACACCAGAATTGTGGG + Intronic
927540151 2:23902450-23902472 ATTGTTAGCATCAGGTTTGTAGG - Intronic
928220520 2:29399421-29399443 GCTGTAAGAATCAGATTAGTTGG - Intronic
928229808 2:29488330-29488352 GTTGTATGCAGCAGAATGGTGGG + Intronic
929087495 2:38182932-38182954 GGTGGATGCATCAGAACTGTGGG - Intergenic
929540194 2:42813276-42813298 GTTCTAACCATAAGAGTTGTTGG - Intergenic
930381508 2:50635548-50635570 TTTGTATGCATCAGACTTGCTGG - Intronic
935819250 2:106877778-106877800 GTTGTAGGGAACAGAATTGTAGG - Intronic
937564451 2:123266978-123267000 GTTTTAAGCAGAAGAATTGTGGG - Intergenic
942209562 2:173657107-173657129 GTTGAAAGCAACAGAATTAGTGG - Intergenic
942549774 2:177103156-177103178 TTTTTAAACATCAGCATTGTAGG - Intergenic
945049391 2:205808739-205808761 GTTGTAAGCATCAGCAGTGATGG - Intergenic
945806204 2:214492803-214492825 GTTGTAAGCCTCTGACATGTGGG - Intronic
947516579 2:230810643-230810665 TTTGTATGCAGCAGAAATGTGGG - Intronic
947936451 2:234008983-234009005 GTTGTAAGCAGCTGAAATGAGGG + Intronic
1170678289 20:18502325-18502347 GTTTTAAGCAAGAGAATAGTAGG + Intergenic
1172566682 20:35936081-35936103 GTTGGAAGGATGAAAATTGTAGG + Intronic
1174332256 20:49829736-49829758 CTTGTCATCAGCAGAATTGTGGG - Intronic
1174544636 20:51316286-51316308 GTAATAAGCATTAGAATTGCAGG + Intergenic
1175520493 20:59599625-59599647 GTTGTCAGTATCAGATTTGCTGG + Intronic
1176348713 21:5773110-5773132 GTTGTAACCATAAGTATTGATGG + Intergenic
1176355527 21:5893694-5893716 GTTGTAACCATAAGTATTGATGG + Intergenic
1176496114 21:7551345-7551367 GTTGTAACCATAAGTATTGATGG - Intergenic
1176543034 21:8171180-8171202 GTTGTAACCATAAGTATTGATGG + Intergenic
1176561985 21:8354225-8354247 GTTGTAACCATAAGTATTGATGG + Intergenic
1177078670 21:16611273-16611295 TTTCAAAGCATCAGAATTTTGGG + Intergenic
1177964423 21:27710015-27710037 CTTGTAGGCATCAGATTTATGGG + Intergenic
1181339026 22:22163987-22164009 GTTAAAAGCATCAGACTTGCTGG - Intergenic
1183459153 22:37939431-37939453 GTTGTAAGTAACAGAGCTGTGGG + Intronic
1184589063 22:45468969-45468991 GTGGTAAGCTTCAGTATTGCGGG + Intergenic
1203247905 22_KI270733v1_random:87418-87440 GTTGTAACCATAAGTATTGATGG + Intergenic
949329243 3:2903192-2903214 ATTGTAAGCATCAGAAGAGGCGG - Intronic
951089245 3:18552969-18552991 GTAGGAAGCACCAGAATTATGGG - Intergenic
951831593 3:26934920-26934942 GTTGTAAGCAGCAGAAGAGATGG - Intergenic
952622459 3:35362025-35362047 GTAGTATGCATCAGAATCCTGGG + Intergenic
953842033 3:46396821-46396843 GTTGTATGCAGCAGACTTGTGGG - Intergenic
955094061 3:55779815-55779837 GTGGTACACATCAGAATCGTGGG + Intronic
955537356 3:59938434-59938456 ATAGTAAGCAGCAGATTTGTAGG + Intronic
956836038 3:73096859-73096881 GTTGTGGGCATCAGAATCCTGGG - Intergenic
957169175 3:76715385-76715407 GTTTTATACTTCAGAATTGTGGG + Intronic
958504089 3:94951113-94951135 AGTGTAAGCATCAGAATGGAGGG - Intergenic
959804024 3:110529396-110529418 GTAGTAAGCTTCCAAATTGTGGG + Intergenic
960024231 3:112989996-112990018 GTTGTATACATCAGAAATTTGGG - Intergenic
960148982 3:114232165-114232187 GGTTTGAGCATCAGAACTGTTGG + Intergenic
960470653 3:118061099-118061121 GTTGTAAGAATCACATTTATGGG - Intergenic
960504211 3:118473193-118473215 GTGGTCAGAATTAGAATTGTTGG - Intergenic
968140846 3:196255281-196255303 ATTGTAAGCATTAGAATAGAAGG - Intronic
971994605 4:33949157-33949179 GTTGAAAGCATCTGAATTGCTGG - Intergenic
972789598 4:42358214-42358236 GGTGGAAGCTTCAGAAATGTGGG - Intergenic
973321327 4:48813277-48813299 CTTGTAAGAATCAGTATTGTGGG + Intronic
974410448 4:61534732-61534754 GTTCTCAGCTTGAGAATTGTTGG + Intronic
974869199 4:67618365-67618387 GTTGATAGCATCAGTGTTGTAGG - Exonic
975654803 4:76630976-76630998 GTTGCAGGCATGGGAATTGTAGG + Intronic
976660308 4:87533892-87533914 GTTGTAAGCATCTGATATTTGGG - Intergenic
976813272 4:89119903-89119925 GTAGTTAGTGTCAGAATTGTAGG - Intergenic
978095377 4:104769835-104769857 GTAGTAAGCCTCTGAATTTTAGG + Intergenic
978545050 4:109862204-109862226 TTTATATGCATCAGAATAGTTGG - Intronic
983331010 4:166329314-166329336 CTTGTAAGCCTCAGAAGAGTGGG - Intergenic
985285281 4:188330776-188330798 TTTCTAAGTATCAGAAGTGTGGG - Intergenic
986130421 5:4924765-4924787 GATGTAAGCATCATTACTGTGGG + Intergenic
987908470 5:24109817-24109839 GTTTTAAGTATCAAAATTGAAGG - Intronic
989185859 5:38625411-38625433 TTTCCAACCATCAGAATTGTGGG - Intergenic
989610716 5:43287924-43287946 GATCTACGCATCAGAAATGTTGG - Intergenic
989759151 5:44991170-44991192 TTTGTAAGCATCATAAATTTTGG + Intergenic
990298254 5:54424994-54425016 GTGGTAAGCTTCAGATTTGGAGG + Intergenic
991973601 5:72164390-72164412 ATTTTTAGCATCAGAATTTTGGG + Intronic
992285565 5:75231961-75231983 GTTCTCAGCATCAGAAAAGTTGG + Intronic
992519840 5:77539203-77539225 GGTTTCAGCATCAGAATTTTGGG + Intronic
993539303 5:89128752-89128774 GTTGTAAGGAACGGAAATGTTGG - Intergenic
994631365 5:102292167-102292189 GTAGCAAGCATCAGTCTTGTTGG - Intronic
995430683 5:112072265-112072287 ATTTTAAGCATAAGGATTGTGGG + Intergenic
996196544 5:120613618-120613640 GTTTTAAGCATTTGTATTGTAGG + Intronic
996960072 5:129236503-129236525 GTTGAAGCCATCAGCATTGTAGG - Intergenic
1004362063 6:14979902-14979924 GTTATAAGAATGTGAATTGTGGG - Intergenic
1009786535 6:68347451-68347473 TTTCTAGCCATCAGAATTGTGGG + Intergenic
1009901739 6:69815652-69815674 GTTGTAATCATCAGAAATGATGG - Intergenic
1010252183 6:73719119-73719141 GTTGTAAGTCTCAGAAATATGGG + Intronic
1014732287 6:125046767-125046789 GTTATAAGCTACAGTATTGTAGG + Intronic
1015993164 6:138969597-138969619 ATTTTAAGCATCAAAATGGTTGG + Intronic
1016480190 6:144472515-144472537 ATTATAAGGATCAGAATAGTTGG + Intronic
1021349293 7:19570078-19570100 ATTGCAATAATCAGAATTGTAGG - Intergenic
1021530551 7:21640078-21640100 GCTGTTAGTAACAGAATTGTTGG + Intronic
1022055679 7:26731683-26731705 GTTGTTGGCATCACAAGTGTTGG - Intronic
1023059463 7:36314257-36314279 GTTGTAAGCCTCTCAATTGATGG + Intergenic
1025045585 7:55689423-55689445 GGTGTGAGCTTCAGAATAGTGGG - Intergenic
1026164978 7:67901505-67901527 GTTGTAAGCATGAGACCTCTTGG - Intergenic
1027474443 7:78611780-78611802 CTTTCAAGCATAAGAATTGTTGG - Intronic
1028240885 7:88419008-88419030 GTTTGAAGCCTGAGAATTGTTGG + Intergenic
1031089283 7:117334425-117334447 GTTTTAAGCATCTAAATTTTGGG - Intergenic
1031568032 7:123323422-123323444 GTGGTAACCATCAGATTTATAGG - Intergenic
1031765437 7:125771290-125771312 GTTGGCAGCCTCAGAATTTTTGG - Intergenic
1031806353 7:126311904-126311926 GGTGTAAGAACCAGAAATGTTGG - Intergenic
1038209504 8:25502895-25502917 GTTGTAAGCATCTAAATCGAGGG - Intronic
1038860097 8:31377473-31377495 GTTGTAATCATCAGAAGGGATGG + Intergenic
1039935019 8:42035238-42035260 ATTTTAAGCATCAGAATCGATGG + Intronic
1039935464 8:42040428-42040450 GTTGTAAGCATAAGAAAAATTGG + Intronic
1040891535 8:52322242-52322264 GTGGTAAAAATGAGAATTGTAGG - Intronic
1040958102 8:53000840-53000862 TTTGAAGGCATCAGAATTGCTGG + Intergenic
1043424543 8:80135502-80135524 GTAGTAATTATCAGAAATGTTGG - Intronic
1048390711 8:133961334-133961356 TTTGTAATCATGAGAATTTTAGG + Intergenic
1048534219 8:135277425-135277447 GTTTTAAGCCACAGGATTGTGGG + Intergenic
1049939964 9:536027-536049 GTTTTAAGCATGAAATTTGTGGG - Intronic
1051441309 9:17086227-17086249 GTTTTCAGAATCCGAATTGTAGG + Intergenic
1052487548 9:29121097-29121119 GTTGTAAGCCTCTGAATTTCTGG - Intergenic
1055389627 9:75806054-75806076 CTTGTGAGCTTCAGAATTGTAGG + Intergenic
1056888750 9:90469619-90469641 GTGGTGAGCAGCAGAAATGTCGG + Intergenic
1058637018 9:107047203-107047225 GGGGTTAGCATCAGAAATGTTGG - Intergenic
1060592042 9:124823412-124823434 GTTGTAATCCTCAGTATTGGAGG - Intergenic
1061892594 9:133630598-133630620 GTTTTAAGCCTCAGAGTTTTTGG - Intergenic
1203464304 Un_GL000220v1:70649-70671 GTTGTAACCATAAGTATTGATGG + Intergenic
1186039738 X:5462727-5462749 ATTGTAAGCTTCAGCATTGGAGG + Intergenic
1186535384 X:10341816-10341838 TTTGTCAGCTTCAGAAATGTTGG + Intergenic
1187015581 X:15324849-15324871 GTTGTAAGTACCAGAGTTGGTGG - Exonic
1188414203 X:29912750-29912772 GTTTTTAGCATCTGAATTTTGGG - Intronic
1188462013 X:30438933-30438955 CTTGTTAGCATCTGAATTGAAGG - Intergenic
1190466745 X:50732096-50732118 GTTGTAAACAACAGAATAATTGG + Intronic
1193828667 X:86260326-86260348 CTTGAGAGTATCAGAATTGTAGG - Intronic
1195332235 X:103812560-103812582 GTTGTTAAAATCAGAGTTGTTGG - Intergenic