ID: 907158685

View in Genome Browser
Species Human (GRCh38)
Location 1:52356154-52356176
Sequence CCTGGAGCCCCTGTTTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 510}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907158673_907158685 7 Left 907158673 1:52356124-52356146 CCTGGGCTCCCAGCCTCCTGCCC 0: 1
1: 2
2: 14
3: 172
4: 1335
Right 907158685 1:52356154-52356176 CCTGGAGCCCCTGTTTCCCTAGG 0: 1
1: 0
2: 6
3: 36
4: 510
907158675_907158685 -2 Left 907158675 1:52356133-52356155 CCAGCCTCCTGCCCCTCCCTGCC 0: 2
1: 1
2: 36
3: 390
4: 2961
Right 907158685 1:52356154-52356176 CCTGGAGCCCCTGTTTCCCTAGG 0: 1
1: 0
2: 6
3: 36
4: 510
907158678_907158685 -9 Left 907158678 1:52356140-52356162 CCTGCCCCTCCCTGCCTGGAGCC 0: 1
1: 1
2: 25
3: 156
4: 1091
Right 907158685 1:52356154-52356176 CCTGGAGCCCCTGTTTCCCTAGG 0: 1
1: 0
2: 6
3: 36
4: 510
907158674_907158685 -1 Left 907158674 1:52356132-52356154 CCCAGCCTCCTGCCCCTCCCTGC 0: 1
1: 2
2: 20
3: 179
4: 1601
Right 907158685 1:52356154-52356176 CCTGGAGCCCCTGTTTCCCTAGG 0: 1
1: 0
2: 6
3: 36
4: 510
907158677_907158685 -6 Left 907158677 1:52356137-52356159 CCTCCTGCCCCTCCCTGCCTGGA 0: 1
1: 3
2: 19
3: 116
4: 1050
Right 907158685 1:52356154-52356176 CCTGGAGCCCCTGTTTCCCTAGG 0: 1
1: 0
2: 6
3: 36
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907158685 Original CRISPR CCTGGAGCCCCTGTTTCCCT AGG Intronic
900309995 1:2029037-2029059 CCTGCAGCCCCTGAGTCCCATGG + Intronic
900310457 1:2030906-2030928 CCTCGACCCACTGTTTCCCCTGG - Intergenic
900439164 1:2644789-2644811 CCTGGGGCCCCTGAAGCCCTTGG + Intronic
900751402 1:4400233-4400255 CCTGGAGGGCCTGTTTCCCATGG - Intergenic
900808560 1:4784097-4784119 TCTGGGGCCCCTGTTTCCACTGG - Exonic
900829001 1:4950673-4950695 CCTGCAGCCCCTCTCGCCCTGGG - Intergenic
901218832 1:7570711-7570733 CCTGGGACCCCTGCTTCCCCAGG + Intronic
902283168 1:15389055-15389077 CCTGGAGCCCTTGTGCCCCGTGG + Intronic
902548157 1:17203293-17203315 CCCTGAACACCTGTTTCCCTGGG + Intergenic
903287263 1:22285036-22285058 CCAGGAGCTCCTGATTCACTAGG + Intergenic
907158685 1:52356154-52356176 CCTGGAGCCCCTGTTTCCCTAGG + Intronic
907447898 1:54520707-54520729 CCTGGCGCCCATGTTTCCCAAGG - Intergenic
909310358 1:74138764-74138786 CCTGGAGCCCATGTAGTCCTGGG - Intronic
909874444 1:80784393-80784415 CCTCCAGACCCTGTTTGCCTGGG - Intergenic
910441414 1:87256410-87256432 CCTGGTCTCCCTGTTTCACTTGG - Intergenic
910935652 1:92483525-92483547 CCTGGAGCCGCTGTCACCCACGG + Exonic
911079618 1:93915897-93915919 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
911128922 1:94369566-94369588 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
911822944 1:102442942-102442964 CCTCCAGACCCTGTTTGCCTGGG - Intergenic
913063877 1:115232093-115232115 CCTGGGGTCCCTGCTTCGCTGGG - Intergenic
915147030 1:153801401-153801423 TCTGCAGCCCCTGCTGCCCTGGG + Intergenic
915246493 1:154559176-154559198 CCTGGAGCCTCTGCTCCCCGTGG + Intergenic
915360250 1:155282146-155282168 CCTGGAGCGCATATTTTCCTTGG + Intronic
916026131 1:160835147-160835169 CCAGGAGGCAGTGTTTCCCTTGG + Intronic
916614762 1:166428749-166428771 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
917274730 1:173319704-173319726 ACTTCAGACCCTGTTTCCCTGGG - Intergenic
917718341 1:177760261-177760283 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
919796611 1:201324936-201324958 CCGGGAACACCTGGTTCCCTGGG - Exonic
919887600 1:201946259-201946281 GCTGGAGACCCTGTCTCCCGAGG - Exonic
920051473 1:203167234-203167256 CCTGGAGCCCCTGTGTCGGGGGG + Exonic
920229730 1:204462252-204462274 CCTGGAGCCCCTGGGTCCGGAGG - Intronic
920381008 1:205534545-205534567 CCTGGAGCCCTCGGTTTCCTGGG + Intergenic
921981376 1:221262781-221262803 ACTGTAGACCCTGTTTGCCTGGG + Intergenic
922219423 1:223546837-223546859 CCTGGAGATCCTGATTCCATAGG - Intronic
922379926 1:225013260-225013282 ACTTTAGCCCCTGTTTGCCTGGG + Intronic
922562401 1:226578742-226578764 CCTGCAGCGGCTGCTTCCCTGGG + Intronic
922606886 1:226895010-226895032 CCTGGCGGCTCTGATTCCCTTGG + Intronic
922879074 1:228965908-228965930 CCTGGGGCTCCTGTCTCCATGGG - Intergenic
924493899 1:244568135-244568157 ACTCCAGCCCCTGTTTGCCTGGG + Intronic
1063122933 10:3117335-3117357 CCTGGCGTCCCTGCATCCCTGGG + Intronic
1063338092 10:5235630-5235652 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1064916517 10:20464937-20464959 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
1065745958 10:28842382-28842404 CCCAGAGTCCCTTTTTCCCTAGG + Intergenic
1067212045 10:44267425-44267447 CCTCCAGACCCTGTTTTCCTGGG - Intergenic
1067697666 10:48547554-48547576 CCTGGAGCACCTGTCTGCTTTGG - Intronic
1068256301 10:54515874-54515896 CCTCCAGACCCTGTTTGCCTGGG - Intronic
1069530939 10:69218979-69219001 CCTGTAGCCCCAGCTACCCTGGG + Intergenic
1069901025 10:71706772-71706794 CTTGGAGCCCGTGACTCCCTTGG + Intronic
1070277147 10:75018154-75018176 CCAGGAGGCCATGCTTCCCTGGG - Intronic
1070736115 10:78864970-78864992 CCTGGATCCCCTCTCTCCCTGGG - Intergenic
1070850528 10:79558930-79558952 CCTGGAGCCCCTGGTGTCCCTGG - Exonic
1070856687 10:79612365-79612387 CCTGGAGCCCCTGGTATCCCTGG + Exonic
1071900715 10:90118327-90118349 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
1072122141 10:92413899-92413921 CAGGGAGCCTCTTTTTCCCTAGG - Intergenic
1073745955 10:106468080-106468102 ACTGTAGACCCTGTTTGCCTGGG - Intergenic
1074000577 10:109368099-109368121 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1075711096 10:124530844-124530866 CCTGCAGCCCTGGATTCCCTGGG + Intronic
1076156412 10:128209232-128209254 TCTGGTCCTCCTGTTTCCCTAGG - Intergenic
1076169422 10:128307225-128307247 CCAGGAGCCCCTGGTACCCAAGG - Intergenic
1077303862 11:1859150-1859172 CCTGGGTTCCCAGTTTCCCTGGG + Intronic
1077435099 11:2535151-2535173 CCGAGAGCCTCTGTCTCCCTGGG - Intronic
1077534988 11:3119739-3119761 CCTGGTGGCCCTGTGGCCCTGGG - Intronic
1077725719 11:4672995-4673017 CCTGGAGACCCTGTTTCACTGGG + Intergenic
1078901852 11:15649939-15649961 CCTCGTGCCCCTGTGTCCCCAGG + Intergenic
1079518025 11:21290691-21290713 ACTCCAGACCCTGTTTCCCTGGG - Intronic
1079837472 11:25351550-25351572 CCTGGGGGCTTTGTTTCCCTGGG - Intergenic
1081241348 11:40710486-40710508 ACTCCAGCCCCTGTTTGCCTGGG + Intronic
1081251246 11:40837394-40837416 GCTGGAGCCCCTTCTTCCATAGG + Intronic
1081324282 11:41727010-41727032 ACTGCAGACCCTGTTTTCCTGGG + Intergenic
1081537017 11:44003857-44003879 CCAGGGGCCCCTGTTACCCAGGG + Intergenic
1081644505 11:44780334-44780356 CCTGGAGCCCCTGCTGGGCTTGG - Intronic
1082107433 11:48235932-48235954 ACTCCAGACCCTGTTTCCCTGGG + Intergenic
1082160735 11:48885374-48885396 CCTGGGGTCCCTGTTTCTGTGGG + Intergenic
1082161631 11:48895032-48895054 CCTGGGGTCCCTGTTTCTGTGGG - Intergenic
1082236365 11:49823238-49823260 CCTGGGGTCCCTGTTTCTGTGGG + Intergenic
1082239815 11:49857746-49857768 CCTGGGGTCCCTGTTTCTGTAGG + Intergenic
1082242336 11:49886605-49886627 CCTGGGGTCCCTGTTTCTGTGGG - Intergenic
1082273633 11:50199026-50199048 ACTGCAGACCCTGTTTGCCTAGG + Intergenic
1082834275 11:57640195-57640217 CCTCCAGCCTCTGTTTCTCTGGG + Intergenic
1083272141 11:61577967-61577989 CCTGAAGTCCCTGTTTCTCTCGG - Intronic
1083447064 11:62715203-62715225 CCGACAGCCCCTGTTTTCCTTGG + Exonic
1083510316 11:63203004-63203026 ACTCCAGACCCTGTTTCCCTGGG - Intronic
1083594805 11:63914112-63914134 CCTGGACCTCCTTTTTCCCAGGG + Exonic
1085054292 11:73394920-73394942 CATGGAGCCCTTGCATCCCTAGG + Intronic
1085743002 11:79092862-79092884 CCTGGATCCCTTGTTTCCTGAGG + Intronic
1086075677 11:82848940-82848962 TCTGGAGCCCCTTTGTCACTGGG + Intronic
1086440975 11:86829752-86829774 ACTGCAGACCCTGTTTGCCTGGG + Intronic
1086506220 11:87507525-87507547 GCTGGAGACCCTGTTTGCCTGGG + Intergenic
1086882925 11:92170273-92170295 CCTCCAGACCCTGTTTGCCTGGG - Intergenic
1086967418 11:93043778-93043800 ACTTGAGACCCTGTTTGCCTGGG - Intergenic
1088197789 11:107294564-107294586 GCCGGAGACCCTGTTTGCCTGGG - Intergenic
1089462646 11:118662028-118662050 CCTGTAGCCTCTGCTTCCGTGGG - Intronic
1089566538 11:119374731-119374753 CCAAGAGCCCCTGATGCCCTCGG - Intronic
1090079650 11:123603419-123603441 CCTGAAGCCTCTGTGTCCCAAGG + Exonic
1090165010 11:124537444-124537466 GCTGGAGCCACTGTTTCCCTTGG + Intergenic
1090322370 11:125858212-125858234 ACTTGAGACCCTGTTTGCCTAGG - Intergenic
1091089922 11:132762103-132762125 ACTCCAGACCCTGTTTCCCTGGG + Intronic
1091630730 12:2158828-2158850 CCGGGATCCTATGTTTCCCTTGG - Intronic
1091702942 12:2676141-2676163 CCTGGAGTCCTAGGTTCCCTGGG - Intronic
1091704897 12:2687176-2687198 CCTGGGGCTCCTGGGTCCCTGGG - Intronic
1092006540 12:5074967-5074989 CCTGGAGGTCCTATGTCCCTCGG - Intergenic
1093609506 12:21137095-21137117 ACTGCAGACCCTGTTTGCCTGGG + Intronic
1094843331 12:34351000-34351022 CCTGGGACCCCAGGTTCCCTGGG + Intergenic
1095089708 12:38092194-38092216 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1095778975 12:46037703-46037725 CCTCCAGACCCTGTTTGCCTGGG - Intergenic
1095981563 12:47977372-47977394 CCTGGAGCCCCTGGGCCCCCTGG - Exonic
1095981887 12:47978730-47978752 CCTGGACCCCCTGGTCCCCCTGG - Exonic
1096113299 12:49041196-49041218 CCTGGAGCCCCGCTTCCCCACGG - Exonic
1096175872 12:49518306-49518328 ACTGTAGCCCCTGTCTCTCTGGG + Intronic
1096950176 12:55460139-55460161 ACTCCAGACCCTGTTTCCCTAGG - Intergenic
1096957882 12:55545644-55545666 CCTCCAGACCCTGTTTTCCTGGG + Intergenic
1097730480 12:63123197-63123219 ACTTGAGGCCCTGTGTCCCTAGG - Intergenic
1098642553 12:72856695-72856717 CCTCCAGACCCTGTTTGCCTGGG + Intergenic
1099053368 12:77808467-77808489 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
1099697384 12:86040018-86040040 ACTGCAGACCCTGTTTGCCTGGG + Intronic
1099797705 12:87420443-87420465 GCTGTAGACCCTGTTTGCCTGGG + Intergenic
1102254922 12:111409865-111409887 CCAGGAGGACCTGTTCCCCTGGG - Intronic
1102281634 12:111623197-111623219 CCTGCAGCCTCTGTTTCCCAGGG + Intergenic
1103566397 12:121817936-121817958 CCCGGAGTCCCTCTTTCCCCGGG + Intronic
1103623132 12:122200838-122200860 CCTGGAGCCCCTGCTCGCCGGGG + Exonic
1105043890 12:132986110-132986132 CCTGGACGCCCAGTTTCCCAGGG - Intergenic
1105242381 13:18619956-18619978 CGTGGAGCCCCTCCTTCCCCAGG - Intergenic
1106118595 13:26838551-26838573 GCTGGTCCCTCTGTTTCCCTTGG - Intergenic
1106783780 13:33087153-33087175 CCTGTGGCCTCTGTTTCCCCAGG + Intergenic
1108217785 13:48201704-48201726 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1108765782 13:53627716-53627738 CCTGCACCCTCTGCTTCCCTAGG - Intergenic
1109163342 13:59003560-59003582 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
1111322660 13:86650872-86650894 ACTCCAGCCCCTGTTTGCCTGGG + Intergenic
1113423263 13:110186393-110186415 CCTGGAGGCCCTGGATCCCCAGG - Exonic
1113460750 13:110480243-110480265 CCAGGAGCGCCTGTGTCCCCAGG - Exonic
1113674186 13:112196548-112196570 CCTGGTTCCCCTGGTTCCCCTGG + Intergenic
1114245738 14:20911454-20911476 CCTCCAGACCCTGTTTTCCTGGG - Intergenic
1115339183 14:32273540-32273562 ACTCCAGCCCCTGTTTGCCTGGG - Intergenic
1115512464 14:34150942-34150964 ACTGCAGACCCTGTTTGCCTGGG - Intronic
1117635709 14:57740957-57740979 ACTCGAGACCCTGTTTGCCTGGG - Intronic
1117859463 14:60074309-60074331 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1122022342 14:98848560-98848582 TCTGGAACCCCTGTTTCTATGGG + Intergenic
1122327354 14:100890646-100890668 CCTGGGGCCCCTGGCTCTCTGGG + Intergenic
1122505048 14:102226885-102226907 CCTGGAGGCCCAGCTGCCCTGGG + Intronic
1122540126 14:102493428-102493450 CCTGGAGCCCCTGCATCCCCTGG + Intronic
1122640472 14:103156432-103156454 CCTGGATGCCCTATTTCCTTGGG - Intergenic
1122810855 14:104287244-104287266 CCTGGGGCCCCTGACACCCTGGG - Intergenic
1122872974 14:104650001-104650023 CGTGTAGCCCCTGTTTCCATGGG + Intergenic
1122886475 14:104712650-104712672 CCTGGGGCCCGAGTTTCCCCAGG + Intronic
1122946415 14:105012629-105012651 CCAGGAGACCCTGTGTCCCTTGG - Intronic
1123488919 15:20764636-20764658 CGTGGAGCCCCTCCTTCCCCAGG + Intergenic
1123545418 15:21333723-21333745 CGTGGAGCCCCTCCTTCCCCAGG + Intergenic
1124953368 15:34343440-34343462 CCTGGAGCCCTTGTTTCTTCAGG - Exonic
1125257129 15:37777953-37777975 CCTCCAGACCCTGTTTACCTAGG - Intergenic
1125513396 15:40304687-40304709 CCTGGAGTCCATGAGTCCCTGGG - Intronic
1125745550 15:41995050-41995072 CCTGGTGTTACTGTTTCCCTGGG - Intronic
1126996393 15:54450037-54450059 ACTGCAGACCCTGTTTGCCTGGG + Intronic
1127313027 15:57769236-57769258 ACTGGAGCTCTTCTTTCCCTGGG + Intronic
1128895773 15:71372543-71372565 ACTGCAGACCCTGTTTGCCTGGG + Intronic
1129035741 15:72647455-72647477 CATGGAGCCCAGGGTTCCCTAGG - Intergenic
1129214143 15:74089761-74089783 CATGGAGCCCAGGGTTCCCTAGG + Intergenic
1129391279 15:75222170-75222192 CATGGAGCCCAGGGTTCCCTAGG - Intergenic
1129399866 15:75275608-75275630 CATGGAGCCCAGGGTTCCCTAGG - Intronic
1129473028 15:75765696-75765718 CATGGAGCCCAGGGTTCCCTAGG + Intergenic
1129731278 15:77934104-77934126 CATGGAGCCCAGGGTTCCCTAGG + Intergenic
1130851821 15:87802458-87802480 CCTGGAGTCCCCGTGGCCCTTGG + Intergenic
1131116659 15:89800097-89800119 CCTGCAGCCCCTGGGGCCCTTGG + Intronic
1131441900 15:92465816-92465838 CCTCGAGCCCAGATTTCCCTGGG - Exonic
1131466285 15:92656963-92656985 ACTGGAGCCTCAGTTTCCTTGGG + Intronic
1132139655 15:99381795-99381817 ACTGCAGACCCTGTTTGCCTGGG + Intronic
1132218383 15:100084720-100084742 ACTGCAGACCCTGTTTGCCTGGG - Intronic
1132287867 15:100678859-100678881 ACTCTAGACCCTGTTTCCCTGGG + Intergenic
1202953763 15_KI270727v1_random:60994-61016 CGTGGAGCCCCTCCTTCCCCAGG + Intergenic
1132554938 16:568257-568279 CCAGGTGACCCTGTTTCCCCGGG + Exonic
1132785561 16:1655447-1655469 CCTGGAGCCCCTTATTCCCTGGG + Intronic
1133152275 16:3843746-3843768 CCTGAAGCCTTTTTTTCCCTAGG - Intronic
1135281608 16:21158069-21158091 GCAGGAGCCCCTGTTTCCCCTGG - Intronic
1135929927 16:26727850-26727872 CCTGGAAGCCCTGGTTCCCTTGG + Intergenic
1137335639 16:47546380-47546402 ACTCCAGACCCTGTTTCCCTGGG + Intronic
1137471148 16:48759561-48759583 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
1138446151 16:57065418-57065440 CCAGGAGCTCCTGCTACCCTGGG - Intronic
1139649625 16:68355842-68355864 CCTGCAGCCCCTGTGTGCCGAGG + Exonic
1139966761 16:70750030-70750052 CCTGGAGACCCTGCAACCCTTGG + Intronic
1140436405 16:74950642-74950664 CCTTGATCCACTCTTTCCCTGGG - Intronic
1140539173 16:75740092-75740114 ACTGCAGTCCCTGTTTGCCTGGG + Intronic
1140847947 16:78907802-78907824 CCTGGTAGTCCTGTTTCCCTAGG - Intronic
1140855433 16:78973834-78973856 CCGAGAGCCCCTGCTTCCCTTGG + Intronic
1141576380 16:84966588-84966610 CCTCCAGCCCCTCCTTCCCTGGG - Intergenic
1141920277 16:87131056-87131078 CCTGGAGCCCCCTGTGCCCTGGG + Intronic
1142302288 16:89265715-89265737 CCTGGAGACCCTGCTGCCCGGGG - Intergenic
1142325005 16:89409079-89409101 CCTGGGCCCCCAGCTTCCCTTGG - Intronic
1142744357 17:1948291-1948313 CCTGTAGCCCCTGCTTTCCAGGG + Intronic
1144641305 17:16938806-16938828 GCTCAAGCCCCTGGTTCCCTGGG + Intronic
1144653717 17:17022305-17022327 CTTGGAGCCCATCTTTCCATGGG + Intergenic
1144837759 17:18166076-18166098 TCAGGAGCCCCTCTTTCCCCAGG + Intronic
1145737628 17:27244200-27244222 CCTGCAGCCTCTCTTCCCCTTGG - Intergenic
1146298452 17:31670187-31670209 ACTGCAGACCCTGTTTGCCTAGG + Intergenic
1146746231 17:35333212-35333234 ACTCTAGACCCTGTTTCCCTGGG + Intergenic
1146951943 17:36912901-36912923 CCTGCAGACCCCTTTTCCCTGGG + Intergenic
1147147113 17:38491723-38491745 CCTGGAATCCCTGCTGCCCTGGG + Intronic
1147588214 17:41665262-41665284 CCTGGACTCCCTGCTGCCCTTGG + Intergenic
1147760477 17:42794876-42794898 CCTGGAACCCCCATTTCCCCAGG + Exonic
1148573503 17:48690117-48690139 CCTGGAACTCCTGTTCCTCTAGG - Intergenic
1149212280 17:54317207-54317229 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1149659671 17:58327711-58327733 CCTGGAGCTCCCGTCTCCTTTGG + Exonic
1150025923 17:61673878-61673900 CCTCCAGACCCTGTTTGCCTGGG - Intergenic
1150587482 17:66531894-66531916 TCTGGAGCCCATGTTTCCAGGGG + Intronic
1151009070 17:70472785-70472807 GCTGGACCACCTATTTCCCTAGG - Intergenic
1151239905 17:72749645-72749667 TCTGCAGCCCCGGTTTCCCAAGG - Intronic
1151558982 17:74860898-74860920 CCCAGTGCCCCAGTTTCCCTAGG - Intronic
1152110137 17:78353259-78353281 CCTGGGGCTCCTGTCACCCTCGG + Intergenic
1152243218 17:79170856-79170878 CCTGGAGCACCTGGTACCCGGGG - Intronic
1152460328 17:80438997-80439019 CCTGGAGCTCATGCTGCCCTTGG - Intergenic
1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG + Intronic
1152678623 17:81654272-81654294 CCTGCAGCCACTGTGTCCTTAGG + Intronic
1152874746 17:82780178-82780200 CCTGGCTCTCCTGCTTCCCTGGG + Intronic
1153048137 18:875352-875374 CCAGGAGCCCCAATTTACCTTGG - Intergenic
1153090416 18:1336046-1336068 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1154446568 18:14439922-14439944 CGTGGAGCCCCTCCTTCCCCAGG + Intergenic
1155054174 18:22170457-22170479 CCTGGCGTCCCACTTTCCCTGGG + Intronic
1157123349 18:44933216-44933238 CCTCCAGACCCTGTTTGCCTGGG + Intronic
1157823409 18:50790385-50790407 CCTAGAGCACCTGTCTCCCAAGG + Intergenic
1158101336 18:53833629-53833651 GCTGGAGACGCTGTTTGCCTGGG + Intergenic
1158104707 18:53872458-53872480 CCGGGAGTCCCTGTCTCCGTGGG + Intergenic
1158866197 18:61639743-61639765 CCTTGAGACTGTGTTTCCCTAGG - Intergenic
1160014126 18:75127722-75127744 CCAGGAGCCCCAGCCTCCCTGGG + Intergenic
1160805519 19:990776-990798 CCTGGTGCCCCTGTTCCCATGGG + Intronic
1161056208 19:2191726-2191748 CCTGCATCCCCAGTCTCCCTCGG + Intronic
1161588750 19:5119260-5119282 CCATGAGCTGCTGTTTCCCTCGG + Intronic
1162682402 19:12355922-12355944 TCTGCAGCCTCTGCTTCCCTGGG - Intronic
1163005246 19:14393410-14393432 CCTGGAGTCCCAGTTTCTCCCGG - Intronic
1163530009 19:17843379-17843401 CCTGGAGCACCTCTTTGCCCAGG - Exonic
1163633392 19:18427995-18428017 CCTGGAGCCCCTGAGTCCCTGGG - Intronic
1164351419 19:27348122-27348144 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
1164420615 19:28088512-28088534 CCTCCAGACCCTGTTTGCCTGGG - Intergenic
1164695083 19:30237399-30237421 GATGGAGCCCTTGTTTCTCTAGG + Intronic
1166099269 19:40561357-40561379 CCAGGTGTCCCTGATTCCCTAGG - Intronic
1166338024 19:42120986-42121008 CCTGTACGCCCTGTTTCTCTGGG - Intronic
1166496097 19:43304388-43304410 CCAGGAGCCCCATTTTCCCCAGG + Intergenic
1166504139 19:43361079-43361101 TCTGGAGCCCCTGCTGCCCTGGG + Intronic
1166506318 19:43373679-43373701 TCTGGAGCCCCTGCTGCCCTGGG - Intergenic
1166824415 19:45600312-45600334 CCTGGAGCCCACCGTTCCCTCGG - Intronic
1167008138 19:46788457-46788479 CCTGGGTCCCCTGTTTCCGGAGG - Exonic
1167705000 19:51076771-51076793 CCTGGAGCCCCTGTGGTCCAGGG - Intergenic
1168280597 19:55303485-55303507 CCTGCAGCCCCTTCTTTCCTTGG - Intronic
925044718 2:764051-764073 TCTGGAGTCCCTCCTTCCCTGGG + Intergenic
925116955 2:1387974-1387996 CCTCCAGACCCTGTTTGCCTGGG + Intronic
925172832 2:1760782-1760804 CCTCCAGACCCTGTTTGCCTGGG - Intergenic
927076338 2:19581451-19581473 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
927230833 2:20822918-20822940 CGCAGAGCCCCTGTTGCCCTGGG - Intronic
927693060 2:25221957-25221979 CCTGAAACCCCTTTTTCCCTAGG - Intergenic
927884979 2:26712809-26712831 CCTGGAGTCCCTCTCTTCCTGGG + Intronic
927992544 2:27458264-27458286 CCTTGAAGCCCTGCTTCCCTGGG - Intronic
929062811 2:37941187-37941209 ACTGTAGACCCTGTTTGCCTGGG + Intronic
930088202 2:47513370-47513392 CTTGAAACCCTTGTTTCCCTTGG + Intronic
930868097 2:56142401-56142423 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
931305244 2:61021873-61021895 ACTGCAGACCCTGTTTGCCTGGG - Intronic
931694913 2:64864584-64864606 GCTGGTGCCCCAGTGTCCCTGGG + Intergenic
931971317 2:67589758-67589780 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
932328077 2:70876734-70876756 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
932523332 2:72437190-72437212 CCTCCAGACCCTGTTTGCCTGGG + Intronic
932669278 2:73722273-73722295 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
933614121 2:84466098-84466120 CCAGGAGCCCCAGGTTACCTTGG - Intergenic
933618571 2:84510838-84510860 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
934571358 2:95375016-95375038 CTTGGAGTCCCTGTTTCCCACGG - Intronic
934693450 2:96379840-96379862 CCTCCAGACCCTGTTTGCCTGGG - Intergenic
934885975 2:98025305-98025327 CCTGTAGTCCCAGCTTCCCTGGG - Intergenic
935196537 2:100819915-100819937 CCTAGACCCCCGGCTTCCCTGGG - Intergenic
935256740 2:101316215-101316237 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
936269415 2:111037377-111037399 CCTGAAGACTCTGTTGCCCTGGG + Intronic
936376375 2:111944638-111944660 ACAGAAGCCCCTCTTTCCCTGGG + Intronic
936535969 2:113311543-113311565 CCTAGAGTCCCTGGTACCCTTGG - Intergenic
936857927 2:116982382-116982404 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
937822095 2:126322052-126322074 TCTGGTACCCCTGTTTCCTTGGG - Intergenic
938766479 2:134463341-134463363 CATGGAGCCCTTCTTTCCTTAGG - Intronic
939453359 2:142400892-142400914 CATGGTGTCTCTGTTTCCCTGGG - Intergenic
941546219 2:166854572-166854594 ACTGCAGACCCTGTTTTCCTGGG - Intergenic
942873658 2:180765945-180765967 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
944196869 2:197063180-197063202 ACTCCAGCCCCTGTTTGCCTGGG - Intronic
944291254 2:198007972-198007994 ACTGGAGTCCCTTTTTGCCTTGG - Intronic
944374837 2:199029309-199029331 ACTCGAGACCCTGTTTGCCTGGG - Intergenic
944908243 2:204284258-204284280 TCTGAAGTCCCTGTTTGCCTGGG - Intergenic
946168530 2:217879841-217879863 CCTGGGGCCCCTGGGTCCCATGG - Intronic
946219536 2:218214996-218215018 ACTGAAGCCCCGATTTCCCTGGG - Intergenic
947379211 2:229528856-229528878 CCTAGAGCCTCTGTTCCCATTGG + Intronic
947605723 2:231484001-231484023 CCCGGAGCCCCTCTGCCCCTGGG + Intergenic
947791699 2:232872501-232872523 CCACCAGCCCCTGCTTCCCTGGG + Intronic
948007767 2:234624420-234624442 CCTGGGGCCCCCGTATCCTTGGG + Intergenic
948149217 2:235731749-235731771 TCTGGTGCCTCTGTTTCCCTAGG - Intronic
948419593 2:237848720-237848742 CCTCCAGGCCCTGTTTGCCTGGG + Intergenic
949000436 2:241610130-241610152 CCTGGTGCCCCTGTTCCACTGGG - Intronic
1168833523 20:860752-860774 CCTGGGGACCCTGTTCACCTGGG - Intergenic
1168960402 20:1865348-1865370 CCAGGAGCTCCTGGTTCCCGAGG - Intergenic
1169279364 20:4253998-4254020 CCTGGAGACCCTGTTGGTCTGGG + Intergenic
1170740733 20:19053862-19053884 CCTGGAGTTCCTGATTCCTTAGG - Intergenic
1171342793 20:24443780-24443802 CCTGGATCCTTTGTTTCCTTGGG - Intergenic
1171949235 20:31406077-31406099 TCTGGAGATCCTGTTTACCTGGG + Exonic
1172868304 20:38117706-38117728 CATGGAGGACCTGTTTCCCGGGG + Intronic
1173503232 20:43568229-43568251 CGTGGAGCCTGTGTTTCCCAGGG - Intronic
1174277518 20:49414618-49414640 CCTCTGGCGCCTGTTTCCCTTGG + Intronic
1174445900 20:50590889-50590911 CCTGCAGCCTCTGCTTCCCATGG + Intronic
1175050458 20:56150963-56150985 CCTGGACCCCACGTTCCCCTTGG + Intergenic
1175257206 20:57654719-57654741 CATGGAGGCCCTGGTTCCATAGG - Intronic
1175426257 20:58869157-58869179 CCTGGTGCCCCGGTTCTCCTGGG + Intronic
1175609032 20:60334738-60334760 TCTGAAGCCCCCGTTTCCATCGG - Intergenic
1178710410 21:34911739-34911761 CTGGGAGCACCTGTCTCCCTCGG + Intronic
1178965205 21:37109938-37109960 ACTCGAGACCCTGTTTGCCTGGG - Intronic
1179283686 21:39956836-39956858 CCAGGTGCCGCTGATTCCCTCGG - Intergenic
1179423920 21:41257767-41257789 CAAGGAGCCCCTGTTTCTCGTGG + Intronic
1180145691 21:45917410-45917432 CCTGGGGCTCCTGGTGCCCTGGG + Intronic
1180180789 21:46117889-46117911 CCTGGACTCCCTGCTTCCCCCGG - Exonic
1180523916 22:16235913-16235935 ACTGCAGTCCCTGTTTGCCTGGG - Intergenic
1180601835 22:17024974-17024996 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1181056215 22:20261648-20261670 CCTGGTGCCCTTCTGTCCCTGGG - Intronic
1181115752 22:20631817-20631839 CCTGGAGCCCCTTCACCCCTGGG + Intergenic
1181459968 22:23080028-23080050 CCTGGCTCCCCAGTTTCCCCAGG - Intronic
1181743379 22:24939083-24939105 CCCGGAGCCCCTGTCTCTGTAGG - Intronic
1182477360 22:30583389-30583411 CCTGGAGCCCCTGATAATCTGGG + Intronic
1182764475 22:32748827-32748849 CCTGTGGCCTCTGTCTCCCTCGG + Intronic
1182774375 22:32819999-32820021 CCTCAAGGCCCTGATTCCCTTGG - Intronic
1183190572 22:36319757-36319779 CCTGGCGCCCCTGTGGCCCCAGG - Intronic
1183373553 22:37449273-37449295 CCTGCAGCCCCTTTGTACCTTGG - Intergenic
1183587477 22:38761191-38761213 CCCAGTGCCTCTGTTTCCCTGGG + Intronic
1183618911 22:38961502-38961524 CCTGGAGCCCCTGCTTCTCCTGG + Exonic
1183624114 22:38991447-38991469 CCTGGAGCCCCTGCTTCTCCTGG + Exonic
1184073942 22:42164173-42164195 CCAAGAGCCCTTTTTTCCCTGGG + Intronic
1184129457 22:42509142-42509164 CCTGGCGCCCATGTCTCCTTGGG - Intergenic
1184276522 22:43412083-43412105 CCGGGAGCCCCTGCCTCCCTCGG + Intronic
1184427856 22:44423665-44423687 CCTGGAGCTCCTGGAACCCTTGG - Intergenic
1184650478 22:45917324-45917346 GCTGGAGTCCCTGGTTCCCGTGG + Intergenic
1184680419 22:46070077-46070099 CCGGGAGGCCTTGTTTCTCTCGG + Intronic
1185393247 22:50573799-50573821 CCTGCAGACCCTGTTTTGCTCGG + Intronic
949536567 3:5000674-5000696 CTCTGAGCCTCTGTTTCCCTGGG - Intergenic
949632499 3:5943847-5943869 CCTCCAGACCCTGTTTGCCTGGG + Intergenic
949666194 3:6341681-6341703 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
950578021 3:13844734-13844756 CCAGGTGCACCTGTGTCCCTAGG - Intronic
950597355 3:13996574-13996596 ACTGCAGACCCTGTTTGCCTGGG + Intronic
950897388 3:16465785-16465807 CCTGGAGCTCCATTTTCCCAGGG + Intronic
951237617 3:20253976-20253998 ACTGTAGACCCTGTTTGCCTGGG + Intergenic
951415913 3:22420917-22420939 CCTGGATCCCCTAGTGCCCTTGG - Intergenic
953580844 3:44154871-44154893 CCTGGAGCCCTTCTGTGCCTTGG + Intergenic
953607453 3:44420938-44420960 CCTGCAGGCCCAGTGTCCCTGGG - Intergenic
953703489 3:45214186-45214208 CCTGAATCTCCTGTTTCTCTGGG + Intergenic
953742590 3:45550250-45550272 CATGGAGCACCACTTTCCCTGGG - Intergenic
953876175 3:46668047-46668069 TATGAAGCCCCTGTTCCCCTAGG - Intergenic
953914361 3:46909110-46909132 GCTGGAGCTCCTTTCTCCCTGGG - Intergenic
954255772 3:49404812-49404834 CCTGTAGTCCCAGTTTACCTGGG + Intronic
954682328 3:52352460-52352482 CCTGGGACCTCTGGTTCCCTGGG + Intronic
957352864 3:79048743-79048765 CCTCCAGACCCTGTTTGCCTGGG - Intronic
957780731 3:84815033-84815055 CCTCCAGACCCTGTTTGCCTAGG + Intergenic
959494231 3:107030676-107030698 GCTGCATCCCCTCTTTCCCTAGG - Intergenic
960389440 3:117058644-117058666 CCTCAAGCTCCTGTTTCTCTGGG - Intronic
960492658 3:118335215-118335237 CCTGGTGGCTCAGTTTCCCTTGG + Intergenic
960784341 3:121355983-121356005 ACTCGAGACCCTGTTTGCCTGGG + Intronic
961336053 3:126180379-126180401 CCTGGAGCCCCTGGAGCCCCCGG + Intronic
961359003 3:126356065-126356087 CCTGCAGCCGCTGTGTCCCCGGG - Intronic
961645963 3:128392929-128392951 CCTGTGGCCCTGGTTTCCCTTGG + Intronic
961674622 3:128557035-128557057 CCAGGAGCACCTGTTTCCTGAGG - Intergenic
961992987 3:131212260-131212282 ACTCCAGACCCTGTTTCCCTGGG + Intronic
962177970 3:133174554-133174576 ACTCCAGACCCTGTTTCCCTGGG - Intronic
962384675 3:134923267-134923289 GTTTGAGCCCCTGTTTCGCTGGG + Intronic
963224514 3:142848309-142848331 CCTGGAGCCCTTGTGTCCAGTGG - Exonic
963306930 3:143663160-143663182 ACTGCAGACCCTGTTTGCCTGGG - Intronic
963620403 3:147599105-147599127 ACTGCAGACCCTGTTTTCCTGGG + Intergenic
964214436 3:154263425-154263447 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
964588048 3:158329501-158329523 ACTCCAGCCCCTGTTTGCCTGGG + Intronic
964730613 3:159860822-159860844 ACTGGATCCCCTGATTCCCTAGG + Intronic
966494198 3:180560780-180560802 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
966547501 3:181166925-181166947 CCTGGCTCCCCAGTTTACCTAGG - Intergenic
968582047 4:1399710-1399732 GCTGGAGCCTCAGTTTCCATTGG + Intergenic
968808453 4:2789471-2789493 CCTGGACCCCTCGCTTCCCTTGG - Intergenic
968812032 4:2804514-2804536 GCTGGAGCCCCTGCTTCCCCAGG + Intronic
969154825 4:5201308-5201330 CCTGCAGCCCCATTTGCCCTGGG + Intronic
969297201 4:6277175-6277197 CCTGGAGTCCCTGCCTCACTGGG - Intronic
969369140 4:6720297-6720319 GCTGGAACCCTTGCTTCCCTTGG - Intergenic
970551190 4:17182855-17182877 CTTGGAGCCCCAGATTGCCTTGG - Intergenic
971227735 4:24770427-24770449 CCTGGAGCCACTTTTAACCTGGG - Intergenic
971746353 4:30586530-30586552 ACTGCAGCCCCTGTTCACCTGGG + Intergenic
971955162 4:33407961-33407983 CCTTGAGCCTGTGTTTCCCTGGG + Intergenic
972279722 4:37590402-37590424 CCAGGAGCCCCTGTCATCCTGGG - Exonic
972373391 4:38448056-38448078 ACTGCAGACCCTGTTTTCCTGGG + Intergenic
972984666 4:44749256-44749278 ACTCCAGACCCTGTTTCCCTCGG + Intergenic
973715127 4:53669109-53669131 ACTGCAGACCCTGTTTGCCTGGG + Intronic
973883621 4:55297980-55298002 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
975305108 4:72840789-72840811 CCTCCAGACCCTGTTTGCCTGGG + Intergenic
975364897 4:73518125-73518147 ACTGCAGACCCTGTTTTCCTGGG + Intergenic
975729776 4:77326885-77326907 CCTCCAGACCCTGTTTGCCTGGG + Intronic
975753518 4:77549630-77549652 ACTTGAGCCCCTGTTTGCCTGGG + Intronic
976760765 4:88546633-88546655 CCTGTAGTCCCAGCTTCCCTGGG - Intronic
976820701 4:89203483-89203505 CCTGGAGCCACAGTCGCCCTGGG - Intergenic
977906060 4:102478736-102478758 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
977994559 4:103485609-103485631 CCTCCAGACCCTGTTTTCCTGGG - Intergenic
978004755 4:103602653-103602675 ACTGCAGACCCTGTTTGCCTGGG + Intronic
979998607 4:127463443-127463465 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
981150973 4:141378645-141378667 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
982310785 4:153983340-153983362 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
982579752 4:157162600-157162622 ACTCCAGCCCCTGTTTGCCTGGG + Intronic
983167615 4:164497031-164497053 CCTCCAGACCCTGTTTACCTGGG + Intergenic
983181097 4:164649921-164649943 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
984015142 4:174417158-174417180 ACTCGAGACCCTGTTTGCCTGGG + Intergenic
984933573 4:184869910-184869932 CCTGGAGCCCCGGTACCCATAGG + Intergenic
985733503 5:1564458-1564480 CCAGTAGCCACTGTCTCCCTGGG - Intergenic
986680678 5:10230743-10230765 CCAGGAACCCCGGTTTCACTGGG + Intronic
988465046 5:31482061-31482083 GCAGAAGCCCCTGTCTCCCTTGG - Intronic
989337609 5:40336739-40336761 CCTCCAGACCCTGTTTCCCTGGG - Intergenic
989396176 5:40959482-40959504 CTTGGAGCCCCTGTGTCCAAGGG + Exonic
989407529 5:41078545-41078567 ACTCGAGACCCTGTTTGCCTGGG + Intergenic
989569577 5:42932593-42932615 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
990239264 5:53800200-53800222 CCTCCAGACCCTGTTTGCCTGGG - Intergenic
990307728 5:54509526-54509548 CCTGGAGCAGCTGTGTCTCTTGG - Intergenic
990677377 5:58202844-58202866 CCTCGAGCTCTGGTTTCCCTGGG - Intergenic
990860303 5:60319747-60319769 ACTCCAGACCCTGTTTCCCTGGG + Intronic
991908665 5:71538303-71538325 CCTGGAGAGCATTTTTCCCTAGG - Intronic
993448344 5:88042770-88042792 CCTGGGACCCCTGGTTCCTTAGG - Intergenic
993627111 5:90239130-90239152 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
994299972 5:98135714-98135736 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
994586464 5:101715563-101715585 ACTACAGCCCCTGTTTGCCTGGG + Intergenic
995858615 5:116618957-116618979 ACAGGAGGACCTGTTTCCCTGGG - Intergenic
997352977 5:133244169-133244191 CCTGTAGCCCCTGTCTCCTGGGG - Intronic
997647210 5:135489424-135489446 CCTTGCGCGCCTGTTCCCCTGGG + Intergenic
997885923 5:137630002-137630024 CCAGGAGCCCCTGTGGCTCTAGG - Intronic
998369885 5:141654123-141654145 CCTGGAGCAGCTGTTCCTCTAGG + Exonic
999282586 5:150375041-150375063 GCTGCAGGCCCTGTTTTCCTAGG - Exonic
1000332057 5:160213381-160213403 CCTGCAGCCACCATTTCCCTGGG - Intronic
1000397791 5:160794290-160794312 CCTGCATCCCCTGTTTCCTCTGG + Intronic
1001961322 5:175881855-175881877 CCTGAAGCCCTTGTTCCCATTGG + Exonic
1003114269 6:3273027-3273049 CCTGGAGCCCCGGGTTCCGCAGG + Exonic
1004339192 6:14793312-14793334 CCTGGAGCACCTCAATCCCTAGG - Intergenic
1004717236 6:18229112-18229134 ACTGCAGACCCTGTTTGCCTGGG - Intronic
1005447768 6:25942235-25942257 CCTGGACCCCCTCCTTCTCTTGG + Intergenic
1006459943 6:34152448-34152470 CCTGTAGCTCATGTTTCCCCAGG - Intronic
1007397502 6:41586049-41586071 CCTGGAGGCCCTTCTCCCCTGGG + Intronic
1008163205 6:48103330-48103352 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1009290195 6:61870721-61870743 ACTCCAGACCCTGTTTCCCTGGG - Intronic
1009613091 6:65971869-65971891 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
1009718164 6:67427744-67427766 ACTCGAGACCCTGTTTGCCTAGG + Intergenic
1010281648 6:74029938-74029960 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
1010446912 6:75959172-75959194 ACTGTAGACCCTGTTTTCCTGGG + Intronic
1010459556 6:76098394-76098416 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1010671824 6:78695185-78695207 CCTCCAGACCCTGTTTGCCTGGG - Intergenic
1011137313 6:84114867-84114889 ACTGCAGACCCTGTTTTCCTGGG + Intergenic
1011340207 6:86306183-86306205 ACTGCAGACCCTGTTTTCCTGGG + Intergenic
1011769918 6:90664053-90664075 TCTGGAGCCCATGACTCCCTAGG - Intergenic
1012901390 6:105011264-105011286 ACTGCAGCCTCTGTCTCCCTGGG + Intronic
1014871260 6:126599087-126599109 CCTCCAGACCCTGTTTGCCTGGG + Intergenic
1016220826 6:141668307-141668329 CTTGGGGCACATGTTTCCCTGGG + Intergenic
1017302956 6:152883492-152883514 ACTGTAGACCCTGTTTGCCTGGG - Intergenic
1017714183 6:157196654-157196676 CCTGGAGCTCCTGGATGCCTGGG + Intronic
1017819985 6:158042327-158042349 ATTAGAGCCACTGTTTCCCTGGG - Intronic
1019057654 6:169234876-169234898 GCTGGAGCCCCTGGTCCCCGTGG - Exonic
1019756509 7:2774573-2774595 CCTGGACCCCCCCTTTGCCTCGG - Intronic
1020092708 7:5350288-5350310 CCCGGGGCCCATGTTCCCCTGGG - Intronic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1021742046 7:23696795-23696817 TCTGGAGTCCCTCTGTCCCTAGG - Intronic
1023065982 7:36378371-36378393 ACTGCAGACCCTGTTTGCCTGGG + Intronic
1023509325 7:40934231-40934253 ACTGCAGACCCTGTTTTCCTGGG + Intergenic
1024602386 7:50995227-50995249 CCTGTAGCCCATGTTCACCTGGG + Intergenic
1024784076 7:52886292-52886314 CCTGGATCCCGCGTTTCCCTTGG - Intergenic
1029789685 7:102829205-102829227 CCTGGAGGGCCTGTTTCCCAAGG - Intronic
1030801428 7:113857117-113857139 ACTAGAGACCCTGTTTGCCTGGG - Intergenic
1031027758 7:116699117-116699139 CCTCGTGCTCCTGTTTACCTTGG + Exonic
1032513406 7:132489834-132489856 CCTGGAGCCCCTGCTCATCTGGG - Intronic
1033234993 7:139630991-139631013 TCAGAAGCCCCTCTTTCCCTTGG - Intronic
1034227384 7:149494554-149494576 CATTGAGCCCCTCTCTCCCTAGG + Intronic
1034248658 7:149670520-149670542 TCTGCAGCCACTGTTTCTCTGGG - Intergenic
1034750318 7:153562195-153562217 CCTGCAGCCCCTGCTTACCGAGG + Intergenic
1034819255 7:154201689-154201711 CTTGGAGTCCCTGTTTCCTATGG - Intronic
1035315154 7:157992981-157993003 CCTGGAGCCCCCGTCTTACTGGG + Intronic
1035871946 8:3144843-3144865 CCAGGGGCTCCTGTGTCCCTTGG + Intronic
1036619840 8:10417352-10417374 CCTGGAGCTCCTGTTGCTCCGGG + Intronic
1036796122 8:11757911-11757933 CCTGGTGCCCCTGGTTCTGTGGG - Intronic
1038391550 8:27206808-27206830 TCTGGAGCCACTGTTCTCCTAGG + Intergenic
1039059726 8:33564154-33564176 CCTGGAGCCCCTCTTTCCTGGGG - Intronic
1039676695 8:39675920-39675942 ACTCCAGACCCTGTTTCCCTGGG + Intronic
1040340474 8:46437981-46438003 CCTGCAGCCCCGTTTTCACTTGG + Intergenic
1040828893 8:51655540-51655562 CCTAGAGCCCCTCTTTCAGTTGG + Intronic
1041021824 8:53645613-53645635 CCTGTAGCCCCTGCTTCTTTAGG + Intergenic
1043087037 8:75848608-75848630 CCTGGATCCCATGTCTCCCAGGG + Intergenic
1044402507 8:91788661-91788683 ACTGCAGACCCTGTTTCCCTGGG - Intergenic
1044992788 8:97811293-97811315 TATGAAGCACCTGTTTCCCTAGG - Intronic
1045385261 8:101666514-101666536 CCTGGAGCTCCCCTTGCCCTGGG + Intronic
1045647098 8:104309415-104309437 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1048896120 8:138993843-138993865 CCTGGAAGCTCTCTTTCCCTTGG - Intergenic
1049221584 8:141431125-141431147 CCTGGAGCCCCTGCTGGGCTGGG - Exonic
1049364158 8:142228611-142228633 CCTGAAGCCTCTCTTTTCCTAGG - Intronic
1050065044 9:1750404-1750426 ACTCCAGTCCCTGTTTCCCTGGG - Intergenic
1050847489 9:10240386-10240408 CCTGGACCTTCTGTTTCTCTAGG - Intronic
1053521103 9:38780250-38780272 ACTCCAGCCCCTGTTTGCCTGGG - Intergenic
1053700012 9:40680942-40680964 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
1054193262 9:62004243-62004265 ACTCCAGCCCCTGTTTGCCTGGG - Intergenic
1054311303 9:63480340-63480362 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
1054410085 9:64804493-64804515 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
1054645145 9:67584448-67584470 ACTCCAGCCCCTGTTTGCCTGGG + Intergenic
1054818819 9:69501383-69501405 CCTGGAGCCCATGTTGTCCTGGG - Intronic
1055504406 9:76933036-76933058 CCTGGAGCCCCTGATAAGCTTGG - Intergenic
1055537780 9:77267459-77267481 ACTGCAGACCCTGTTTCCCTGGG + Intronic
1056138267 9:83649706-83649728 CCTTGAGCCCATGTTTTTCTGGG - Intergenic
1056931411 9:90880938-90880960 CCTTGGGCCCATGCTTCCCTTGG + Intronic
1057528717 9:95825312-95825334 GCTGGAACTCCTGCTTCCCTGGG + Intergenic
1057838567 9:98466869-98466891 CCTGGATCCCTTATTACCCTGGG - Intronic
1057849772 9:98556332-98556354 TCTCGAGCCCCGGTGTCCCTGGG - Intronic
1060334524 9:122709463-122709485 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
1060599707 9:124869604-124869626 CCTTGAGTCCCAGTCTCCCTGGG + Intronic
1060735541 9:126064482-126064504 CCAGGGGCCCCTGCTTACCTGGG + Intergenic
1060972791 9:127748383-127748405 CCTTGAGGCTCTGTCTCCCTGGG - Intronic
1061201386 9:129140463-129140485 CCTGGAGCTCCAGTGGCCCTGGG - Intronic
1061762263 9:132858940-132858962 CCTGGTGCTCCAGTTTCCCTGGG + Intronic
1061849449 9:133405813-133405835 CCATGGGCCACTGTTTCCCTTGG + Exonic
1062096052 9:134704193-134704215 CCTGGCTCCACTGTTTCCCAGGG + Intronic
1062221651 9:135419296-135419318 CCTGGAGACTCTGGTGCCCTTGG + Intergenic
1062375683 9:136260813-136260835 CCTGGAAACCCTGTATCCCAAGG + Intergenic
1187477744 X:19626867-19626889 CCTGGGTCCCCTCTTTCTCTAGG + Intronic
1187595876 X:20772011-20772033 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
1187624017 X:21090044-21090066 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1188193316 X:27197834-27197856 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1189062539 X:37769472-37769494 CCTCCAGACCCTGTTTGCCTGGG - Intronic
1190268663 X:48845429-48845451 CCTGGGGACCCTGTTTCCCTCGG + Intergenic
1190310489 X:49113900-49113922 GCTGGAGACCCTGGTTCCCAAGG - Exonic
1190603073 X:52111988-52112010 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1191050113 X:56182734-56182756 CCTCCAGACCCTGTTTGCCTGGG + Intergenic
1191119829 X:56891468-56891490 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1191158022 X:57296329-57296351 ACTGCAGACCCTGTTTGCCTGGG - Intronic
1191160789 X:57328103-57328125 CCTGCAGACCCTGTTTGCCTGGG + Intronic
1191683480 X:63865599-63865621 ACTGCAGACCCTGTTTGCCTCGG + Intergenic
1191799834 X:65066434-65066456 ACTCCAGACCCTGTTTCCCTGGG + Intergenic
1192066301 X:67889224-67889246 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
1192721407 X:73702280-73702302 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
1192884018 X:75318780-75318802 CCTCCAGACCCTGTTTGCCTGGG + Intergenic
1192912269 X:75617263-75617285 ACTCCAGACCCTGTTTCCCTTGG - Intergenic
1192915959 X:75651762-75651784 CCTTCAGACCCTGTTTGCCTGGG + Intergenic
1192993495 X:76487809-76487831 ACTGAAGACCCTGTTTGCCTGGG + Intergenic
1193017904 X:76756438-76756460 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
1193510111 X:82388925-82388947 ACTCCAGTCCCTGTTTCCCTGGG - Intergenic
1193735152 X:85147700-85147722 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
1194417187 X:93628196-93628218 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
1194441632 X:93940611-93940633 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
1195797454 X:108666510-108666532 CCTGGAGGCCCTGGTTGCCCAGG - Exonic
1195856128 X:109335085-109335107 ACTCCAGACCCTGTTTCCCTGGG + Intergenic
1197811922 X:130452771-130452793 ACTCGAGACCCTGTTTGCCTGGG + Intergenic
1197917691 X:131553554-131553576 CCTCCAGACCCTGTTTGCCTGGG - Intergenic
1198519098 X:137434216-137434238 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
1198704768 X:139436557-139436579 ACTGCAGACCCTGTTTGCCTGGG - Intergenic
1198757128 X:139994272-139994294 ACTCCAGACCCTGTTTCCCTGGG + Intergenic
1199695270 X:150339426-150339448 CCTGGAGCCTCTACTTCCCTGGG - Intergenic
1200405849 Y:2810912-2810934 ACTCCAGACCCTGTTTCCCTGGG + Intergenic
1200843081 Y:7803641-7803663 CCTGGAGCCCCTTTTTCCCAGGG + Intergenic
1201314365 Y:12629370-12629392 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
1201545535 Y:15158165-15158187 CCTCCAGACCCTGTTTGCCTGGG + Intergenic
1201583048 Y:15531530-15531552 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
1201800050 Y:17945041-17945063 ACTCCAGACCCTGTTTCCCTAGG - Intergenic
1201801503 Y:17960915-17960937 ACTCCAGACCCTGTTTCCCTAGG + Intergenic
1202034662 Y:20620103-20620125 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
1202040284 Y:20675336-20675358 TCTCCAGACCCTGTTTCCCTGGG - Intergenic
1202059080 Y:20867419-20867441 ACTGCAGACCCTGTTTGCCTGGG + Intergenic
1202361438 Y:24114852-24114874 ACTCCAGACCCTGTTTCCCTGGG + Intergenic
1202363635 Y:24138248-24138270 ACTCCAGACCCTGTTTCCCTGGG - Intergenic
1202507145 Y:25531869-25531891 ACTCCAGACCCTGTTTCCCTGGG + Intergenic
1202509340 Y:25555267-25555289 ACTCCAGACCCTGTTTCCCTGGG - Intergenic