ID: 907161458

View in Genome Browser
Species Human (GRCh38)
Location 1:52373264-52373286
Sequence CTCCTGTCGCCTCCTGCTTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 189}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907161458_907161466 18 Left 907161458 1:52373264-52373286 CCACAAGCAGGAGGCGACAGGAG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 907161466 1:52373305-52373327 GCCATGGTCTCTGACATGGTGGG 0: 1
1: 0
2: 1
3: 8
4: 155
907161458_907161468 19 Left 907161458 1:52373264-52373286 CCACAAGCAGGAGGCGACAGGAG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 907161468 1:52373306-52373328 CCATGGTCTCTGACATGGTGGGG 0: 1
1: 0
2: 1
3: 40
4: 314
907161458_907161464 14 Left 907161458 1:52373264-52373286 CCACAAGCAGGAGGCGACAGGAG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 907161464 1:52373301-52373323 CACGGCCATGGTCTCTGACATGG 0: 1
1: 0
2: 1
3: 12
4: 119
907161458_907161463 2 Left 907161458 1:52373264-52373286 CCACAAGCAGGAGGCGACAGGAG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 907161463 1:52373289-52373311 CAGGTGAGAACACACGGCCATGG 0: 1
1: 0
2: 2
3: 19
4: 204
907161458_907161469 24 Left 907161458 1:52373264-52373286 CCACAAGCAGGAGGCGACAGGAG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 907161469 1:52373311-52373333 GTCTCTGACATGGTGGGGTACGG 0: 1
1: 0
2: 0
3: 15
4: 154
907161458_907161465 17 Left 907161458 1:52373264-52373286 CCACAAGCAGGAGGCGACAGGAG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 907161465 1:52373304-52373326 GGCCATGGTCTCTGACATGGTGG 0: 1
1: 1
2: 1
3: 18
4: 189
907161458_907161460 -4 Left 907161458 1:52373264-52373286 CCACAAGCAGGAGGCGACAGGAG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 907161460 1:52373283-52373305 GGAGCCCAGGTGAGAACACACGG 0: 1
1: 0
2: 6
3: 39
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907161458 Original CRISPR CTCCTGTCGCCTCCTGCTTG TGG (reversed) Exonic
900124638 1:1064007-1064029 CTCCTGCCGGCTCCTGGGTGGGG + Intergenic
900560296 1:3301871-3301893 CTCCTGACGCCCCCTGTTTGAGG + Intronic
906295056 1:44644619-44644641 CTCCTGTTGCCTCCAGGTAGGGG - Intronic
907161458 1:52373264-52373286 CTCCTGTCGCCTCCTGCTTGTGG - Exonic
908141295 1:61187941-61187963 CTCACTTTGCCTCCTGCTTGAGG + Intronic
909044922 1:70698452-70698474 CTCCTGTGTCCTCTGGCTTGTGG - Intergenic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
913054392 1:115144109-115144131 CTCCTGTGTCCTTTTGCTTGAGG + Intergenic
915224460 1:154402361-154402383 CTCCTGTAGACTTCTGCTTTAGG + Intergenic
917844143 1:179006340-179006362 TCCCTGTCGCCTGCTGCTGGTGG - Intergenic
923048701 1:230374890-230374912 CTCCTGTGGCCTCCTATTTAAGG - Intronic
1066446303 10:35486864-35486886 CTGCTGTCACTTCCTCCTTGAGG + Intronic
1067256656 10:44648453-44648475 CTCCTGTCTCCTTCTGTTTGAGG - Intergenic
1067479115 10:46584041-46584063 CACCTGTCCCATGCTGCTTGGGG - Intronic
1067615624 10:47757760-47757782 CACCTGTCCCATGCTGCTTGGGG + Intergenic
1069624171 10:69857192-69857214 CCCCTGTCGCTTCCAGGTTGGGG - Intronic
1071528540 10:86372390-86372412 CCCCTGTCGTCTCCTGCTTTGGG + Intergenic
1072825225 10:98599242-98599264 CTCCTGTGGCCTCAGGCTTCAGG - Intronic
1076848671 10:133082402-133082424 CTCCTGTTGGCTCCTGCCGGTGG - Intronic
1078356487 11:10635749-10635771 CTCATGTGGCCTTATGCTTGGGG - Intronic
1078893361 11:15577202-15577224 CTCCTGTACCCTCTTCCTTGAGG - Intergenic
1080554877 11:33406898-33406920 CTCCTGTTGCCTGCTGCTGGAGG + Intergenic
1084144294 11:67255962-67255984 CCTCTGCCGCCTCCAGCTTGGGG - Exonic
1089014214 11:115153592-115153614 CTCCTGAGGCCGCCCGCTTGAGG + Intergenic
1089151780 11:116369958-116369980 CTCCTCTGCCCTCCTGCTTAGGG + Intergenic
1094209612 12:27875241-27875263 TTCCTGAAGCCTCCTGCTTCAGG - Intergenic
1097223977 12:57466119-57466141 CTCCTGCCTCTTCCTCCTTGAGG + Intronic
1097940016 12:65293949-65293971 CTCCTGTGGCCTCCAGGTAGAGG + Intronic
1099986392 12:89670209-89670231 CTCCTTTCCCCTCCTGTTTCTGG - Intronic
1100464755 12:94835089-94835111 CACCTATCGCAGCCTGCTTGAGG + Intergenic
1104478809 12:129089867-129089889 CGCCTGTGGCCTCCTGCTCCAGG + Intronic
1104667923 12:130660634-130660656 CTCCTGCAGCCTCCAGCATGGGG - Intronic
1105447865 13:20473222-20473244 CTCCTGCCGGCTCCTGTTCGTGG - Intronic
1106071595 13:26417099-26417121 CTTCTGTCCCCTGCTTCTTGTGG + Intergenic
1108021896 13:46136175-46136197 CTCCTTCTGCCTCCTGCTTCTGG + Intronic
1108346206 13:49549458-49549480 CTCGTGGCGCCTCCTGTCTGTGG - Exonic
1110355334 13:74560668-74560690 CTCCTGTCACTTCCTGCTTCAGG + Intergenic
1112894806 13:104285955-104285977 CTTCTTTCAGCTCCTGCTTGGGG - Intergenic
1114764743 14:25358172-25358194 CCTCTGTGGCCTCCTGCTTCTGG + Intergenic
1118773318 14:68956941-68956963 CTCGTGATGCCTCCAGCTTGTGG - Intronic
1119681957 14:76599235-76599257 CTTATGTCCCCTCCTGCCTGGGG - Intergenic
1121325174 14:93015651-93015673 CTCCTGGCATCCCCTGCTTGGGG - Intronic
1122935523 14:104954314-104954336 CTCCTCTCTCCTGCTGCCTGTGG + Exonic
1123936854 15:25198244-25198266 CCCCTGTGGCCTCCTTCATGTGG - Intergenic
1124346819 15:28928586-28928608 CCCCTCTGGCCTCCTGTTTGGGG - Intronic
1126115501 15:45203787-45203809 CTCCTATCACTTCCAGCTTGAGG + Intergenic
1132618989 16:855538-855560 CTCCTGGCGCCTCCTCCTCCGGG - Intronic
1132683241 16:1152410-1152432 CTCCGGTCCCCTCCCGCGTGGGG - Intergenic
1133281254 16:4666693-4666715 CTCCTTCCGCCACCTGCCTGCGG + Intronic
1136459169 16:30399074-30399096 CTGTTGCTGCCTCCTGCTTGAGG - Exonic
1137602214 16:49764009-49764031 TTCCTGTCTCCTCCTGCCCGTGG - Intronic
1138040540 16:53660012-53660034 CTACTCTACCCTCCTGCTTGTGG - Intronic
1138318357 16:56089822-56089844 CACCTGTGTCTTCCTGCTTGAGG + Intergenic
1139255381 16:65536112-65536134 CTCCTGTCTTCACCTGCTAGAGG + Intergenic
1140230279 16:73112261-73112283 CCTCTGTAGGCTCCTGCTTGGGG - Intergenic
1141194797 16:81852346-81852368 CTGCTGTCGCCTTCAGCTTGTGG + Intronic
1141441113 16:84030214-84030236 TTCCTGTCTCTTCCTGCTTCTGG - Intronic
1141575371 16:84959958-84959980 CTCCTGGCCCCTCCAGCTTCCGG - Intergenic
1141871128 16:86786866-86786888 CTCCTGGCACCTTCTGCTGGAGG + Intergenic
1142114410 16:88348794-88348816 GACCTGTCGTCTCCTTCTTGAGG + Intergenic
1142523308 17:519930-519952 CTCCTGTCTCCTCCCGCTGTAGG - Exonic
1143677493 17:8446334-8446356 CTACTGTAGCCACATGCTTGAGG + Intronic
1145289581 17:21532812-21532834 CTCCTGGCACATCCTGCCTGGGG + Exonic
1146269080 17:31472701-31472723 CTCACGTCACCTCCTGCATGAGG - Intronic
1146309117 17:31753565-31753587 CTCCTGTTTCCTCCTGTATGAGG + Intergenic
1146759861 17:35467689-35467711 CTGCTGTGGCCTCCTGATGGGGG - Intronic
1147591132 17:41684025-41684047 CTCCTGTCCCCTGCTGCTCTCGG + Intergenic
1148876442 17:50690155-50690177 CTCCTGTACCCTCCTGCCTTGGG - Intronic
1148885113 17:50766820-50766842 CCCCTGTCCCATCCTCCTTGAGG + Intergenic
1148994461 17:51697465-51697487 CTCATGTCCCCTCCTCCATGAGG + Intronic
1151549413 17:74813455-74813477 CTCCTGTCTCCCCTTTCTTGTGG + Intronic
1152921353 17:83068136-83068158 CCGCTGTCGCCTCCTGCAGGTGG - Intergenic
1153043129 18:832667-832689 GTCCTGTTTCCTCCTGCTTGGGG - Intergenic
1153343485 18:4001826-4001848 GTCCTGCCGCCTCCAACTTGTGG - Intronic
1155345526 18:24853240-24853262 CTGCTGTCGCCAGCTGCTTGGGG + Intergenic
1155615056 18:27712564-27712586 CTGCTGTTGCATCCTGCTTACGG + Intergenic
1157488663 18:48107358-48107380 CTCCTCTCCCCTCCTCCTTCTGG - Intronic
1157560142 18:48639916-48639938 CTCCTGTTGCCCCCTACTGGAGG + Intronic
1160085929 18:75777774-75777796 CTCCAGTCACCTCCTACTTCGGG + Intergenic
1160483774 18:79269146-79269168 CACCTGTCGCGTCCTGCTCTGGG + Intronic
1161310894 19:3593330-3593352 CTCCTGTCCCTTCCAGCCTGGGG + Exonic
1162971517 19:14183745-14183767 CTCCCCTCTCCTCCTGCTGGTGG + Intronic
1164742230 19:30584259-30584281 CTCCTCTCCCCTGCTCCTTGTGG + Intronic
1164993574 19:32702496-32702518 CTCCTGTCTCCACCTGTGTGAGG - Intronic
1165064935 19:33223568-33223590 CTCCTATCACCTTCTGGTTGAGG + Intronic
1165272764 19:34724733-34724755 CACCTATTGCCTCCTGATTGCGG + Intergenic
1166523399 19:43495979-43496001 CTCCTTTCCCCACCTGCTTCTGG - Intronic
1167668001 19:50833792-50833814 CTCCTGTCCCCTCCCCCTTGAGG - Intronic
926194950 2:10757730-10757752 CTCCTGTCTCTTTCTGCATGTGG + Intronic
926691129 2:15734572-15734594 GAGTTGTCGCCTCCTGCTTGTGG - Intronic
928945372 2:36767252-36767274 CTCCTGTGGCCCACTGATTGTGG - Exonic
933385031 2:81599375-81599397 CTCCTCATGCCTTCTGCTTGCGG + Intergenic
934103971 2:88679468-88679490 TTCCTCTCACCTCCTCCTTGAGG + Intergenic
934553313 2:95275149-95275171 GTCCTGTCCCTTGCTGCTTGAGG + Intronic
935719621 2:105968496-105968518 CCCCTGTCCCGTCCTCCTTGGGG - Intergenic
937480251 2:122250985-122251007 CGCCTGTCCCTTGCTGCTTGTGG + Intergenic
938071437 2:128310453-128310475 CACCTGTCCCCACCAGCTTGTGG - Intronic
938392505 2:130916527-130916549 GTCCTGTCGCCTGCAGCCTGCGG - Intronic
940245834 2:151614778-151614800 CTCATGCTGCCACCTGCTTGTGG - Intronic
940400191 2:153240438-153240460 CTCTTGTGGCTACCTGCTTGTGG + Intergenic
942465414 2:176202735-176202757 TTGCTGTTGCCTCCTGCGTGTGG + Intergenic
944281034 2:197897851-197897873 CTCCTGTCACATGCTTCTTGAGG - Intronic
945205415 2:207326405-207326427 TTCATGTCTCCTCCTGCATGTGG - Intergenic
946014899 2:216595886-216595908 CTCCTGTTGCCTCCTGCACAGGG - Intergenic
947532603 2:230922282-230922304 CTCCTGGCTCCCTCTGCTTGGGG + Intronic
948387467 2:237590585-237590607 CTCCTGTCCTGTCCTGCCTGTGG - Exonic
948989944 2:241548605-241548627 CCCCTGAGGTCTCCTGCTTGGGG - Intergenic
1170430952 20:16276065-16276087 CTCCTGTGGGCTCCGGCTTCAGG + Intronic
1170500670 20:16972897-16972919 GTCCTGTGGCCTCCTTCCTGTGG + Intergenic
1171248652 20:23632811-23632833 GGACTGTAGCCTCCTGCTTGTGG + Intronic
1171445133 20:25197320-25197342 CTCCTGCCTCCACCTGCTGGAGG + Intronic
1173207361 20:41005598-41005620 CTCCTGGCGGCTCCTTCCTGGGG - Intergenic
1173888688 20:46485165-46485187 CTCCTGTCACCTCCTGGTGGGGG - Intergenic
1174060101 20:47826535-47826557 ACCCTGCCACCTCCTGCTTGGGG - Intergenic
1175750559 20:61494089-61494111 CTCCTGTCTCCACCTGCTCCTGG - Intronic
1180052466 21:45337651-45337673 TTCATGTGGCCTCCTCCTTGTGG - Intergenic
1181036333 22:20171540-20171562 CTCCTGTGGGCTCCTGGCTGGGG + Intergenic
1183415771 22:37681046-37681068 CTCCCGCAGCCTCCTCCTTGGGG + Intergenic
1184479296 22:44737614-44737636 CACCTGTCTCCTCCTGCCTGGGG + Exonic
1184616199 22:45640216-45640238 CTCCTTTCTCCTCCTCCTGGTGG + Intergenic
952731910 3:36646421-36646443 ATCCTCTCACCTCCTTCTTGTGG - Intergenic
955542159 3:59988842-59988864 CCCCTGTTTCCTCCTGCTCGAGG - Intronic
956453067 3:69392952-69392974 CTGCCATCTCCTCCTGCTTGAGG - Intronic
961384976 3:126518155-126518177 CTCCTGCTACCTCCTGCTGGGGG + Intergenic
961670180 3:128523315-128523337 TTCCTGTCTCTTCCTGCATGAGG + Intergenic
963410929 3:144926763-144926785 CTCCTGTCGCTTCCTGGGTGAGG + Intergenic
963868569 3:150388696-150388718 TTCCTGTGGCTTCCTGCCTGAGG + Intergenic
964525371 3:157611262-157611284 CTCCTAACCCCTCATGCTTGGGG - Intronic
964548219 3:157858544-157858566 CTGCTGCTGCCTTCTGCTTGAGG - Intergenic
968500983 4:950002-950024 CTCCTGTCCCCTCCCACATGCGG + Intronic
968734237 4:2287063-2287085 CTCCTGCCGCTTCCAGCTTCTGG - Intronic
968904829 4:3446359-3446381 CGCCTGTCCCCACCCGCTTGCGG + Intronic
968949845 4:3684767-3684789 CTGCTCTCACCTCCTGCCTGTGG + Intergenic
972375278 4:38463938-38463960 TTCCTGGACCCTCCTGCTTGAGG + Intergenic
973958572 4:56087460-56087482 CTTCTGTCTGCTCCTTCTTGCGG + Intergenic
976073025 4:81263466-81263488 CTTCTGTCCCATTCTGCTTGTGG - Intergenic
976600439 4:86933761-86933783 CTCCTGTCCCATCCTGCTCAGGG + Intronic
977525664 4:98143039-98143061 TACCTGTCGCCTGCTGCTTCAGG + Exonic
985103771 4:186482625-186482647 TTGCTGTAGCCTCCTGCCTGGGG - Intronic
987188891 5:15452930-15452952 CTCCAGTCTCCTGCTGTTTGAGG + Intergenic
987634669 5:20524955-20524977 CTTCTGTAGTCTCTTGCTTGGGG + Intronic
988790837 5:34606127-34606149 CAACTGTAGCCTCCTGCTTTGGG + Intergenic
988835618 5:35029554-35029576 ATCCTGTCTCCACCCGCTTGGGG - Intronic
990529616 5:56660366-56660388 CTCCAGGCGCCTCCTGGATGAGG + Intergenic
993125143 5:83825281-83825303 ATCCTGTCTCCTACTGCTTAGGG + Intergenic
995224609 5:109689433-109689455 CCGCTGTCTCCTCCTGCTCGTGG + Exonic
995863177 5:116662614-116662636 CTCATCTCCCCTCCTGCCTGTGG - Intergenic
997402066 5:133611423-133611445 CGCCTGTCGCCTCGAGTTTGGGG - Intronic
997593819 5:135092844-135092866 CTCCTCTCTCCTCCTCCCTGGGG + Intronic
998523187 5:142818809-142818831 CTCCTGTTTGCTCCTTCTTGTGG + Intronic
999306191 5:150521176-150521198 CTCGTGTCTCCTCCTGTGTGGGG + Exonic
1000028087 5:157377345-157377367 CTACTGTGGCCTCTTGCTTTGGG + Intronic
1000204793 5:159048467-159048489 CACCTGTCCCCTCTTGGTTGAGG - Intronic
1001649806 5:173308007-173308029 CTCCTGTCCCCACCTCCTGGTGG + Intergenic
1002297151 5:178238098-178238120 CTCCTGAGGCCTCCTGAATGTGG + Exonic
1002533461 5:179863236-179863258 CTCCTGGCGCCGGCTGCTTCTGG - Exonic
1004479489 6:16005150-16005172 CTCCTATCGCCTCCTGAGTCAGG - Intergenic
1007599495 6:43072992-43073014 CTCCTGCCCACTCCTGCTGGTGG + Intronic
1007756647 6:44103833-44103855 CTCCTGTCACCTGCTGCAGGAGG + Intergenic
1011986027 6:93447081-93447103 CAACTGTCGCCTGCTGCATGTGG + Intergenic
1015219265 6:130785374-130785396 TTCCTGTCTCTTCCAGCTTGTGG - Intergenic
1015938939 6:138430453-138430475 CGGCTGGCTCCTCCTGCTTGGGG + Exonic
1017064366 6:150515915-150515937 CTTCTGTCTCCTGGTGCTTGGGG + Intergenic
1018456840 6:163960894-163960916 CTGCTGTGGCCTCATTCTTGGGG + Intergenic
1018891836 6:167988312-167988334 CTCCTGCCTCCTCCTGCCTCTGG - Intergenic
1019373488 7:676355-676377 CTGCTGTCACCTCCTGCCTCAGG + Intronic
1019470037 7:1214659-1214681 CTCCCGACGCCTCCCCCTTGGGG + Intergenic
1019736179 7:2650824-2650846 CCCCTGCTGTCTCCTGCTTGAGG - Intronic
1019769579 7:2875279-2875301 GTCCTGTCTCTTCCTGCTTCTGG + Intergenic
1022031466 7:26495043-26495065 CTCCTGTTTCCTCTTCCTTGGGG + Intergenic
1022286275 7:28958010-28958032 CGCCTTGCGCCTCCTGCTCGTGG - Exonic
1022334079 7:29406386-29406408 CTCCTGTCCCCTCTTGGTTGAGG + Intronic
1023934905 7:44732790-44732812 CTCCTGCCTCCTCCTGCATCTGG - Intergenic
1025030810 7:55555225-55555247 CTCCTGTCGCTTCCCCCTTCAGG - Intronic
1026490050 7:70855505-70855527 CTCTTCTGGGCTCCTGCTTGTGG + Intergenic
1026966567 7:74443913-74443935 CTCCTGGCCCCTCCTGCTTCTGG + Intergenic
1029278165 7:99419879-99419901 CTGGTGTCACCTCCTGCCTGGGG - Exonic
1030699046 7:112618860-112618882 CTCCAGGCTCATCCTGCTTGAGG - Intergenic
1034776009 7:153827698-153827720 CTCCAGTCGACTTCTCCTTGTGG - Intergenic
1035481918 7:159193706-159193728 CTCCTTTCACCTGCAGCTTGTGG - Intergenic
1038010717 8:23473914-23473936 GTCCTTTCGCCTCCTTTTTGGGG - Intergenic
1038106083 8:24436053-24436075 GTCCTGTCCTCTCCTCCTTGTGG - Intergenic
1038481515 8:27905016-27905038 CTCATGCCTCCTCCTTCTTGGGG - Intronic
1042872385 8:73410664-73410686 CTCCTGCCTCCTCCTTCTTTGGG - Intergenic
1047691443 8:127358838-127358860 GTCCTGTGGCCCCCTCCTTGAGG + Intergenic
1047717222 8:127606720-127606742 CCCCTGGCTCCTCCTCCTTGGGG + Intergenic
1049092849 8:140529766-140529788 CTGCTGCCACCTCCTGCGTGCGG - Intergenic
1049432774 8:142573032-142573054 CTTCTGTGGCCTCTTGCATGGGG + Intergenic
1050462157 9:5886170-5886192 CTCTTGACTCATCCTGCTTGGGG - Intronic
1050476929 9:6049958-6049980 CTCCTGCCCCCTACTGGTTGGGG + Intergenic
1051744392 9:20280896-20280918 CCCTTGTCTCCTCCTGCTTCTGG - Intergenic
1056661257 9:88545312-88545334 CCCCTGTGGCCTCTTGCTGGCGG + Intronic
1057050641 9:91921113-91921135 CTCCTGTCCGCTACTTCTTGTGG - Intronic
1057279516 9:93699783-93699805 CTCCTGTCAGCTGCTGGTTGAGG + Intergenic
1058739929 9:107932803-107932825 CTCCCACCGCCTCCTGCATGTGG + Intergenic
1058933758 9:109748406-109748428 CTCCTATCGCCTCATGTTTAAGG - Intronic
1061924277 9:133798313-133798335 CTGCTGTTGTCCCCTGCTTGTGG - Intronic
1062446335 9:136596920-136596942 CTGCTGCCGCCTCCTCCTGGGGG - Intergenic
1186716390 X:12256291-12256313 CTACTGTCTTCTCCTGTTTGTGG - Intronic
1189287320 X:39860932-39860954 ATCCTGTCCCCTCCTGGCTGTGG - Intergenic
1195664571 X:107417096-107417118 TTCCTGTCTCCTCCAGCTTCTGG - Intergenic
1198279341 X:135126497-135126519 CTCCTGTTGCCTCCTCCTGTTGG + Intergenic
1198291616 X:135246023-135246045 CTCCTGTTGCCTCCTCCTGTTGG - Intergenic
1198523607 X:137476569-137476591 CTCCTGTGGTCTCCTGCTTTAGG + Intergenic
1199856767 X:151765427-151765449 CTACTGTCACCTACTGCCTGTGG + Intergenic