ID: 907171632

View in Genome Browser
Species Human (GRCh38)
Location 1:52471410-52471432
Sequence GTGTAAACACAATTTTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907171632 Original CRISPR GTGTAAACACAATTTTATCT GGG (reversed) Intronic
901856406 1:12047079-12047101 GTGTACACACAAGTGTGTCTAGG - Intergenic
905096654 1:35477712-35477734 GTATAAAAACCATTTTAACTGGG - Intronic
907098693 1:51806845-51806867 GAGTATTCACAATTTTAACTGGG + Exonic
907171632 1:52471410-52471432 GTGTAAACACAATTTTATCTGGG - Intronic
907222816 1:52919949-52919971 GTGTAAACACAAAATTATCATGG - Intronic
907727478 1:57033153-57033175 GTGTAAACAAAAGTGTATGTTGG - Intronic
907846654 1:58214518-58214540 GTCCAAGCACAATTTTATATAGG - Intronic
909386391 1:75061950-75061972 GTATAAAAGTAATTTTATCTGGG + Intergenic
909452158 1:75810023-75810045 ATTTAAAAACAATTTTATTTTGG + Intronic
911124970 1:94332864-94332886 ATGTAAACATAATTTGATATAGG - Intergenic
911173380 1:94794451-94794473 ATGAAAACACAATTTTATTTTGG + Intergenic
911553456 1:99312982-99313004 ATGCACACACAATTTTAGCTGGG - Intergenic
911586168 1:99693640-99693662 GTGTAAACACCATTTTATTTTGG + Intronic
911774413 1:101789845-101789867 GTGTATACATACTCTTATCTGGG + Intergenic
913233707 1:116762896-116762918 GGGTGGCCACAATTTTATCTTGG - Intronic
914216167 1:145631167-145631189 GTTTAAGCACACTTTTAACTTGG - Intronic
914468737 1:147953825-147953847 GTTTAAGCACACTTTTAACTTGG - Intronic
921262639 1:213397410-213397432 GTGCAAAAAAAATTTTAACTAGG - Intergenic
921369621 1:214408106-214408128 GTGTGATCAAAATTTTATATGGG - Intronic
922657360 1:227397414-227397436 ATGCAAACACCATCTTATCTTGG + Intergenic
924748921 1:246866775-246866797 TTGCAATCACAATTTCATCTTGG + Intronic
924833558 1:247625362-247625384 GGATAAAAACCATTTTATCTGGG + Intergenic
1065622988 10:27602177-27602199 CTGGGAACATAATTTTATCTGGG + Intergenic
1066095817 10:32070915-32070937 GTATAAACACAATTTTTACAAGG + Intergenic
1066315614 10:34243111-34243133 GTGAGAAAACAATTTTATATTGG + Intronic
1067246434 10:44550501-44550523 GTGGAACCACAGTTTTCTCTGGG + Intergenic
1067673199 10:48345480-48345502 GTGTGAACAGAATTAGATCTTGG - Intronic
1068236756 10:54245024-54245046 GTCAAATCACAATTCTATCTAGG + Intronic
1069396262 10:67992642-67992664 GTGTAAAAAGAATTTTCTCAGGG - Exonic
1071122317 10:82293429-82293451 CTGTAAACACAATTTCATGATGG - Intronic
1071122903 10:82300101-82300123 GTGTAAACACATTGTTAGTTTGG + Intronic
1073868554 10:107833860-107833882 TTGAAAACAGAACTTTATCTTGG + Intergenic
1074256544 10:111808119-111808141 TTTTTAAAACAATTTTATCTAGG + Intergenic
1078416111 11:11167145-11167167 GTGTATACAAATTTTTTTCTTGG - Intergenic
1079120192 11:17677652-17677674 GGGTATGCACAAGTTTATCTTGG - Intergenic
1080902069 11:36503939-36503961 GTGTAAACATAACTTTGTATGGG - Intronic
1081283451 11:41239612-41239634 ATGTAAATACAATTTTAAATAGG - Intronic
1084844811 11:71890527-71890549 GTGTACACACACTTTGATATTGG + Intronic
1086402314 11:86470856-86470878 TTCTAAACACAAGTTTATGTCGG + Intronic
1087452951 11:98347843-98347865 TTGTATACATAATTTTATTTTGG - Intergenic
1088421379 11:109651569-109651591 ATGTAAACACAAGTCAATCTTGG + Intergenic
1088971899 11:114781158-114781180 ATGTAAACACACTTTAATGTGGG + Intergenic
1090786589 11:130054240-130054262 GTATGACCACAATTTTCTCTAGG + Intergenic
1090810590 11:130238039-130238061 TTTTAAACACACTTTTATTTGGG + Intronic
1091158343 11:133395052-133395074 GTGTAAAAGCCATTTTAACTGGG + Intronic
1092959397 12:13581612-13581634 GTGAAAAGACAATTTTAGCCAGG + Intronic
1098680172 12:73344287-73344309 GGATATACAAAATTTTATCTAGG - Intergenic
1098930200 12:76403255-76403277 GTGTAAACACCAATATTTCTAGG + Intronic
1100310446 12:93390213-93390235 GTGTAACAAGAATTTCATCTAGG + Intronic
1106311456 13:28558063-28558085 TGGTATACACAATTTTCTCTTGG + Intergenic
1108712012 13:53042788-53042810 GAGTAAACACAAGTTTATAGGGG + Intronic
1109068294 13:57729824-57729846 AAGTAAACACATATTTATCTTGG + Intergenic
1109158153 13:58937119-58937141 ATGAAAAGACTATTTTATCTAGG + Intergenic
1109245540 13:59950205-59950227 ATGTAAACACAACTCTTTCTAGG + Intronic
1109616035 13:64835162-64835184 GTGATAGCAGAATTTTATCTGGG - Intergenic
1109917463 13:69009824-69009846 TTGTAAATATAATTTTATATTGG - Intergenic
1110128290 13:71975856-71975878 AGGTAAAGACAATTTTATCTGGG - Intergenic
1111051747 13:82891778-82891800 GTTTAAACACATTTTTATTTTGG - Intergenic
1111439564 13:88262410-88262432 TTTCAAACACAATTATATCTGGG + Intergenic
1114803212 14:25802889-25802911 ATGTAAAAACAAGTTTAGCTGGG + Intergenic
1114860653 14:26516558-26516580 ATGTAAACAAATTTGTATCTTGG - Intronic
1115808367 14:37078090-37078112 ATTCAAACACAATTTTATCCAGG + Intronic
1116229329 14:42195964-42195986 GTAGAAACATAATTTTCTCTGGG - Intergenic
1116922242 14:50591091-50591113 GTGAAAACTCAATTTTATTTAGG - Intronic
1120294039 14:82616278-82616300 GTATCGACACAATTTTATGTAGG - Intergenic
1125100392 15:35905713-35905735 ATATAAACACATTTTTTTCTAGG - Intergenic
1126829138 15:52581888-52581910 GTGTAAACACTAATCTAACTGGG + Exonic
1133617307 16:7489859-7489881 GTGGAAATAAAATGTTATCTTGG - Intronic
1135090449 16:19510217-19510239 ATTTAAGCAAAATTTTATCTAGG + Intronic
1135476467 16:22780479-22780501 ATGTAAATACATTTTTTTCTGGG + Intergenic
1135873418 16:26173733-26173755 TTGTATACAAAATTTTATCCTGG + Intergenic
1135885652 16:26304343-26304365 ATATAAACAGAATTTGATCTCGG - Intergenic
1136152641 16:28361421-28361443 TTGTTAAAATAATTTTATCTTGG + Intronic
1136194110 16:28639752-28639774 TTGTTAAAATAATTTTATCTTGG - Intronic
1136210441 16:28753860-28753882 TTGTTAAAATAATTTTATCTTGG - Intronic
1136310161 16:29402401-29402423 TTGTTAAAATAATTTTATCTTGG + Intronic
1136648732 16:31646890-31646912 ATGTAAACTCTTTTTTATCTCGG - Intergenic
1137880413 16:52040061-52040083 GTGTGGACATAATTTTCTCTTGG + Intronic
1139251312 16:65499174-65499196 GTGAAAACGCAATTTTATTGGGG - Intergenic
1139857845 16:69994805-69994827 TTGTTAAAATAATTTTATCTTGG + Intergenic
1140541192 16:75757758-75757780 GTGTTCACATAATTTTGTCTGGG + Intronic
1140625737 16:76792459-76792481 TTGTAAACAGAATCTTCTCTTGG + Intergenic
1146243389 17:31252539-31252561 GTGTCTACATAATTTTTTCTTGG - Intronic
1148956005 17:51354085-51354107 GTTGAAACCCAATTTTCTCTGGG - Intergenic
1149163373 17:53721564-53721586 TTGTCAACATAATTTTTTCTGGG - Intergenic
1150024602 17:61659762-61659784 GAGTAAGCATAATTTTATTTTGG - Intergenic
1153948877 18:10040535-10040557 GTGTAAACAGACTTTTCTCCAGG + Intergenic
1154119292 18:11638058-11638080 TTGTTAAAATAATTTTATCTTGG + Intergenic
1158357015 18:56632596-56632618 GTGTTAACACAGTTTAATCTTGG - Intronic
1163110616 19:15158977-15158999 GTGTAAACAGAACCTTGTCTTGG + Intergenic
1163224160 19:15943938-15943960 CTGTAAACACAATTGTATTGAGG + Intergenic
1164698381 19:30263636-30263658 GTGTAAACAAATTTTTGACTTGG - Intronic
1167618884 19:50550574-50550596 ATGCACACACATTTTTATCTGGG - Intronic
925664028 2:6233947-6233969 GTATAAAAAGAATTTTATTTTGG + Intergenic
925850495 2:8076806-8076828 GTGTAGACATACTTTGATCTGGG - Intergenic
928038064 2:27844695-27844717 GTGTAATCAAAAATTTATCTTGG - Intronic
929318046 2:40504769-40504791 GTGTAAAAGCCATTTTACCTGGG - Intronic
930821892 2:55654346-55654368 GTGTACACACAATTTTAGGAAGG - Intronic
930874911 2:56204468-56204490 GTGTTAACTCAGTTTTATTTAGG + Intronic
933139708 2:78778673-78778695 GTGTAAATGCCATTTCATCTGGG + Intergenic
936694994 2:114935521-114935543 ATGGAAACACAATTTTATGAAGG - Intronic
939283821 2:140102024-140102046 GTGTAATGACAATTTTATATGGG - Intergenic
943779566 2:191807445-191807467 GTCAAAACATTATTTTATCTTGG - Intergenic
943873313 2:193029988-193030010 GTATAAAAACCATTTTAACTGGG - Intergenic
943900604 2:193430443-193430465 GTGTAAACAGAATCTTTTCAAGG + Intergenic
944629425 2:201608353-201608375 GTGTATACACATTATTATCATGG - Intronic
944688095 2:202135601-202135623 ATGTAAACACATTTTTAGATAGG - Intronic
945134686 2:206614734-206614756 GAGTAAACACCATTTTTTGTGGG + Intronic
947058022 2:226129655-226129677 ATGTAAAAACAATTCTATCGTGG - Intergenic
1170332015 20:15223524-15223546 TTGTAAACACAATCTAATTTGGG - Intronic
1174040044 20:47693087-47693109 GAGTAAAAACAATTTTATAAGGG + Intronic
1176951821 21:15056733-15056755 GTGTAAACATAATATTTTCTAGG - Intronic
1177276593 21:18920032-18920054 TTTCACACACAATTTTATCTTGG - Intergenic
1177919076 21:27127617-27127639 TTGTATATACAATTTTATTTTGG + Intergenic
1182528683 22:30938490-30938512 GTGCAAAGACAATTATATGTTGG + Intronic
949586838 3:5449073-5449095 GTGTAAATATAATTTTCCCTAGG - Intergenic
950460751 3:13120936-13120958 GTGTAAACGCCATTGAATCTGGG - Intergenic
951364674 3:21766813-21766835 CAGTAAATACAATTTTAACTAGG - Intronic
951531161 3:23699314-23699336 GTGAAAACACAAATGTACCTGGG - Intergenic
952071617 3:29643829-29643851 CTGTAATCACAATTTTAACATGG + Intronic
952862459 3:37824943-37824965 TTGTAAATAAAATTATATCTGGG + Intergenic
954657031 3:52200435-52200457 TTTTAAAAACAAATTTATCTTGG + Intronic
955200696 3:56849766-56849788 CTGAAAACACATTTTCATCTAGG + Intronic
957254595 3:77820405-77820427 GTGTAGACACATGTTCATCTAGG + Intergenic
957890715 3:86353484-86353506 ATGTAAAGTCTATTTTATCTGGG - Intergenic
962184142 3:133240592-133240614 GAGTAAACCCAATTTTCTATAGG + Intronic
962991260 3:140579455-140579477 GTGTTATCACAATCATATCTGGG + Intergenic
963098337 3:141570702-141570724 CTATAAACACATTTTTATCCAGG - Intronic
963401950 3:144809112-144809134 ATGTAAACAAAATATTTTCTTGG + Intergenic
964412633 3:156415086-156415108 GTCTAAGCACAAATTTATCTAGG + Intronic
966304706 3:178518318-178518340 GTGTAAATTCACTTTTTTCTTGG - Intronic
966589776 3:181669431-181669453 GTTAAAACATATTTTTATCTCGG + Intergenic
966607908 3:181840192-181840214 GTGTATACACAATTACATATAGG - Intergenic
966675627 3:182584853-182584875 GTATAAAGAAAATTTTATATGGG + Intergenic
968895545 4:3400085-3400107 GTGTAAAGACAATATTAAGTTGG - Intronic
970405822 4:15762342-15762364 GTAAAAACATAATTTTCTCTAGG + Intergenic
972010242 4:34170231-34170253 GTTTAAAAACATTTTTTTCTTGG + Intergenic
973311862 4:48718145-48718167 GAATAAACACAATTTACTCTAGG - Intronic
974070962 4:57123214-57123236 TTGAAAGCACAATTTTCTCTGGG - Intergenic
974074144 4:57153551-57153573 GTGTAAGTTCAGTTTTATCTTGG + Intergenic
974335236 4:60535294-60535316 GTGTAAAAATAAAATTATCTGGG - Intergenic
977351399 4:95893197-95893219 GTGTAAACAGGAATTAATCTAGG + Intergenic
977397114 4:96484649-96484671 GACTAAAGAGAATTTTATCTTGG - Intergenic
977407549 4:96619288-96619310 GTTTAAACAAAATTTTATGATGG - Intergenic
978396766 4:108289052-108289074 GTGTAAAAACATCTTTAACTGGG + Intergenic
979572904 4:122251480-122251502 GTTTAATCACAGTTTTATTTTGG + Intronic
979759989 4:124390887-124390909 GTGAAAACACAATTTTGACAAGG - Intergenic
981551516 4:145946391-145946413 GTGTCAACACAGTTCTATCTAGG + Intergenic
982551572 4:156807803-156807825 GTTTAATCACATTTTTTTCTAGG - Intronic
982855003 4:160370732-160370754 AAGTAGACATAATTTTATCTAGG + Intergenic
983266934 4:165517204-165517226 GTGTAAAAACTCTTTTATCCTGG - Intergenic
983786463 4:171736823-171736845 GTATAATCAAAATTTTATCATGG + Intergenic
986169093 5:5301439-5301461 GTGTAAACATATTTTTAACATGG - Intronic
986682293 5:10245123-10245145 GTTTAAACACAATTCAAGCTGGG + Intronic
986718769 5:10543824-10543846 TTGTAGACACAGTTTTATCTAGG + Intergenic
987496109 5:18646826-18646848 GGGTAAAAGCAATTTTAACTGGG + Intergenic
987942505 5:24559348-24559370 GTGTAAACAAATGTATATCTGGG + Intronic
988096407 5:26617211-26617233 TTTTAAAGACATTTTTATCTTGG + Intergenic
988246593 5:28691116-28691138 CTTTAAACACCATTTTATCACGG - Intergenic
989718581 5:44495842-44495864 GTGTAAAAACACTTGTATCTGGG - Intergenic
992702723 5:79357210-79357232 GTGTAAAAAAAATTTTTTTTTGG + Intergenic
994912506 5:105930428-105930450 GTGTTGGCACAATTTTATTTAGG + Intergenic
997169856 5:131706348-131706370 CCTTAAACACAATTTTATATGGG - Intronic
998924733 5:147109834-147109856 ATATAAATACAATTTTAGCTGGG + Intergenic
999915551 5:156255267-156255289 ATATAAACCCAATTTTATCATGG + Intronic
1001723963 5:173880981-173881003 GTGGAAACACAAGTTTTTCAGGG + Intergenic
1003683707 6:8280381-8280403 CTGTACACCCAATTTTAACTGGG - Intergenic
1006037664 6:31226312-31226334 GTGTACATACAATTTTATACTGG + Intergenic
1006099379 6:31676688-31676710 GTTTACACACAAATTTATTTGGG + Intronic
1006236664 6:32639306-32639328 GTATAAAGACAATATAATCTAGG - Intronic
1006333559 6:33409315-33409337 GTGTTATTACTATTTTATCTCGG + Intronic
1007907775 6:45480252-45480274 TTGTAAAAACAGTTTTATTTTGG + Intronic
1008009369 6:46447559-46447581 GTGTACACATAATATTCTCTAGG + Intronic
1009965707 6:70575800-70575822 ATGTAAACACAATTCTAAATAGG + Intronic
1010527450 6:76921113-76921135 TTGTTAACATAATTTTATATAGG + Intergenic
1013450077 6:110271894-110271916 GTATAAACAAAATTTGAACTGGG - Intronic
1015005345 6:128273479-128273501 TTGTAAACTCAATTTTACATAGG - Intronic
1015615052 6:135065754-135065776 GTGTATGCACAATTTCTTCTAGG + Intronic
1016508311 6:144810309-144810331 GTGTAAACATCCTTTTCTCTTGG + Intronic
1020145762 7:5641610-5641632 GTGAAAACACAACTTTCTCATGG + Intronic
1021477914 7:21083745-21083767 TTGTTAAGAAAATTTTATCTTGG - Intergenic
1025579128 7:62688574-62688596 GTGTAAAAACACTGTTTTCTTGG + Intergenic
1027742470 7:82028046-82028068 ATTTGAAGACAATTTTATCTAGG + Intronic
1027833244 7:83207529-83207551 CTGTAAACAAAATTATATTTTGG + Intergenic
1030046935 7:105505721-105505743 GTTTAAAAACATTTTTATTTGGG - Intronic
1030055262 7:105578754-105578776 GAGTGGACACAATTTTAACTTGG - Intronic
1030419109 7:109285154-109285176 TTTTAAACATAATCTTATCTTGG + Intergenic
1030450933 7:109710131-109710153 GTGTGAATAATATTTTATCTAGG + Intergenic
1030778018 7:113560897-113560919 GTGAAAAAACAAATTTATATTGG + Intergenic
1031645163 7:124216924-124216946 TTGAAAACACAATTTTTTCAAGG + Intergenic
1033628095 7:143130684-143130706 GTGTAAAGACAATTTAATTGTGG + Intergenic
1033892670 7:146034374-146034396 GTTTAGACAAAATGTTATCTTGG + Intergenic
1036015190 8:4775124-4775146 GTGTAAACAGAATTTTCCCCAGG + Intronic
1037222476 8:16541408-16541430 GAGTAAACACAATTCTCTCTGGG + Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1039642171 8:39235622-39235644 GTGTAAAAACAAATTTTACTGGG + Intronic
1042889237 8:73588829-73588851 GTGGTAACCAAATTTTATCTTGG - Intronic
1043196833 8:77304406-77304428 GTGTAATAATAATTTAATCTTGG - Intergenic
1043785858 8:84399072-84399094 TCATAAACATAATTTTATCTAGG - Intronic
1044770746 8:95629336-95629358 GTGTGAACACATTTTTATTTTGG + Intergenic
1045304103 8:100942047-100942069 CTGTAAGCACATTTTTATTTGGG + Intronic
1045587677 8:103557457-103557479 GAGTAAACATAGTTTTATATTGG + Intronic
1058970276 9:110075272-110075294 CTGTAAACAGGATTTTATCTAGG + Intronic
1061790723 9:133057550-133057572 GTGAACACACCATTTTCTCTGGG - Intronic
1187451058 X:19396718-19396740 GTGTAAACACCCATGTATCTGGG - Intronic
1188084913 X:25892472-25892494 GTGTAAATGAAATTTTATCCAGG + Intergenic
1188161943 X:26814983-26815005 GAGTAAAGAAAACTTTATCTTGG - Intergenic
1188734631 X:33697009-33697031 CTGTAAACACGCTTGTATCTAGG + Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1192067943 X:67905835-67905857 GGATATAAACAATTTTATCTGGG - Intergenic
1194858850 X:98969365-98969387 ATGTAAATACAATTTCACCTGGG + Intergenic
1196777025 X:119347818-119347840 GAGTAAACATACTTCTATCTTGG - Intergenic
1197187487 X:123604321-123604343 GTGTGAACGCCATTTTATATTGG + Intronic
1198273454 X:135078068-135078090 GTATAAACAAAATTTTAGATGGG + Intergenic
1199353880 X:146837530-146837552 GTGAAACAAAAATTTTATCTTGG - Intergenic
1200915039 Y:8564147-8564169 GTGAGAACACTACTTTATCTTGG + Intergenic