ID: 907173148

View in Genome Browser
Species Human (GRCh38)
Location 1:52490948-52490970
Sequence GCGAAATCTCTTACCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907173144_907173148 6 Left 907173144 1:52490919-52490941 CCACTCTTCTCATTATGAGCACC 0: 1
1: 0
2: 0
3: 7
4: 156
Right 907173148 1:52490948-52490970 GCGAAATCTCTTACCTCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907173148 Original CRISPR GCGAAATCTCTTACCTCTCC TGG Intronic
903352131 1:22723596-22723618 CCGATATCTCCTCCCTCTCCTGG - Intronic
905357957 1:37398025-37398047 GCCAAGTCTCTTCCCTCTCTTGG + Intergenic
905664743 1:39756172-39756194 GGGAAAACTCTGACCTCTCTGGG + Intronic
907173148 1:52490948-52490970 GCGAAATCTCTTACCTCTCCTGG + Intronic
908820205 1:68078174-68078196 GTGAATTCTCTTAGCTTTCCTGG + Intergenic
913047080 1:115083507-115083529 GCTGAATCTCTGACCTCTTCAGG + Intronic
913683381 1:121208007-121208029 GGTAAGTCTCTAACCTCTCCTGG + Intronic
914035223 1:143995631-143995653 GGTAAGTCTCTAACCTCTCCTGG + Intergenic
914154229 1:145072339-145072361 GGTAAGTCTCTAACCTCTCCTGG - Intronic
915074288 1:153296134-153296156 GAGAATTCCCTTCCCTCTCCAGG + Intergenic
916145106 1:161731319-161731341 GAGAATCCTCTTCCCTCTCCAGG + Intergenic
920047735 1:203144676-203144698 AGGAAATCACTTACCTCTGCGGG + Intronic
920470690 1:206226517-206226539 GGTAAGTCTCTAACCTCTCCTGG + Intronic
924517490 1:244778992-244779014 GGGAAGTCACTTACCTCTCTTGG - Intergenic
1069248741 10:66243299-66243321 GAGAATTCTCTTCCCTTTCCAGG + Intronic
1070627197 10:78059761-78059783 GGGACACCTCTTACCACTCCAGG + Intergenic
1074526848 10:114270125-114270147 GCCAATACTCTTTCCTCTCCAGG - Intronic
1074883914 10:117679956-117679978 GCCAAGTCTCTAACCTCTCTGGG - Intergenic
1076428710 10:130386474-130386496 TTGATATCTCCTACCTCTCCTGG + Intergenic
1077422307 11:2458521-2458543 GCGGAATCCCTGACCTCACCAGG - Intronic
1081800932 11:45858865-45858887 GCCCCATCTCTTACCTGTCCAGG - Exonic
1083659309 11:64244916-64244938 AGGAAATCTCTTACCTCTGTGGG + Exonic
1085295257 11:75427910-75427932 GTGAAGTCTCTCTCCTCTCCAGG + Intronic
1093794741 12:23297972-23297994 GAGAACTCTCTTAAATCTCCAGG + Intergenic
1099515870 12:83595995-83596017 TCAAAAAATCTTACCTCTCCTGG - Intergenic
1101019432 12:100538186-100538208 CCGAAATCTCTTTACTGTCCAGG - Intronic
1114515010 14:23293517-23293539 GAGAACCCACTTACCTCTCCTGG + Intronic
1114899714 14:27042201-27042223 GCAAATTATTTTACCTCTCCAGG - Intergenic
1117052343 14:51873965-51873987 GCCAAATCTATTACTACTCCAGG + Intronic
1117521256 14:56553335-56553357 GCTAAATCTGTTTCCTCTTCTGG + Intronic
1121178802 14:91911741-91911763 CCTAAACCTCTTACCTCTGCAGG + Intronic
1121729189 14:96174458-96174480 CCGGAAGCTCTTCCCTCTCCAGG - Intergenic
1126815474 15:52449356-52449378 GTGTCATCTCTCACCTCTCCTGG + Intronic
1130706647 15:86239172-86239194 GTGTAGTCTCTTACCTGTCCCGG + Intronic
1132270003 15:100515910-100515932 GCGAACTCTCCTCCCTCGCCTGG + Intronic
1134276669 16:12782467-12782489 GCAAGTTCTCTTGCCTCTCCGGG - Intronic
1138261701 16:55628148-55628170 GAGAATTCTCTTCCCTTTCCAGG - Intergenic
1140020191 16:71230943-71230965 TGGAAATCTCTTATCTCTACAGG + Intergenic
1145787802 17:27605363-27605385 GCGACGTCTCTTCCTTCTCCTGG - Intronic
1146676524 17:34777133-34777155 AGGAAATGTCTTTCCTCTCCCGG + Intergenic
1155895505 18:31320605-31320627 GTGTAATCTCTTGCCTGTCCAGG - Intronic
1158320440 18:56256346-56256368 GGGCAATCACTTACCTCTCATGG + Intergenic
1158502334 18:58014090-58014112 GAGAAATCTCTTAGCTCTCTAGG - Intergenic
1158827876 18:61243834-61243856 GTGAAATCTCTTACCATTCCTGG - Intergenic
928172775 2:29014089-29014111 AGGAAATGTCTTACATCTCCTGG + Intronic
929603816 2:43221471-43221493 GCTAAATCTCTTACCTACCTTGG + Intergenic
930285480 2:49422649-49422671 GAGAATTCTCTTCCCTTTCCAGG + Intergenic
932599735 2:73115195-73115217 GCCAACTCTCTAACCTCTCTTGG + Intronic
937282631 2:120730833-120730855 GCAAAACCTCTTTCCTCTTCAGG - Intergenic
940956718 2:159737028-159737050 GCCAAATCTGTTACCTGTCTGGG + Intronic
944355900 2:198787623-198787645 CCCCTATCTCTTACCTCTCCAGG + Intergenic
944757468 2:202778390-202778412 GCAAAATCTGTTACCCCTACAGG - Exonic
944899977 2:204204235-204204257 TCAAAATCTCTGTCCTCTCCTGG - Intergenic
946594599 2:221292769-221292791 GAAAAATCTCTTGCCTCTCATGG + Intergenic
947536585 2:230943550-230943572 GGGATAGCTCTTAGCTCTCCAGG - Intronic
1169100877 20:2947727-2947749 CTGAAATCTCTTATCTTTCCAGG - Intronic
1169128364 20:3147593-3147615 GCGAAATCAATTAACTCTACTGG + Exonic
1171064863 20:22005084-22005106 TCAAAATTTCTTATCTCTCCTGG + Intergenic
1173686326 20:44925969-44925991 GCAACATTTCTCACCTCTCCAGG + Intronic
1173737141 20:45370328-45370350 GGCATATCTCTTAACTCTCCAGG + Intronic
1182561232 22:31160734-31160756 GCCAAATCTCTTCCCTGTGCTGG + Intronic
1184339382 22:43877798-43877820 GGGAAATTCCTCACCTCTCCAGG - Intergenic
958932057 3:100217691-100217713 GGCAAATCTGTTGCCTCTCCAGG + Intergenic
962272746 3:133990096-133990118 TCTAAATCTGTTGCCTCTCCGGG + Intronic
963640020 3:147848907-147848929 TCCAATTCTCTTACCTCTACAGG + Intergenic
965008744 3:163058354-163058376 GCCAAATTTCTTCCCTTTCCCGG - Intergenic
972041717 4:34609221-34609243 GCATAATCTCTTATCTCTACGGG - Intergenic
977955548 4:103021215-103021237 CCTAAAGCACTTACCTCTCCAGG - Intronic
988452161 5:31354197-31354219 CCGATATCTCTTAGGTCTCCTGG - Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
990652315 5:57915507-57915529 GCCAAACCTCTTTCCTCTCGAGG - Intergenic
1004240674 6:13918266-13918288 GGGAAATCTGATACATCTCCAGG + Intergenic
1004580141 6:16942713-16942735 GCGATTTCTTTTACCTGTCCTGG + Intergenic
1006704987 6:36012067-36012089 GCCAGATTTCTAACCTCTCCAGG - Intronic
1011736915 6:90320275-90320297 GGGAAATATCTTACCTTTCCTGG + Intergenic
1012864733 6:104604789-104604811 GCGAAATTTCTTTTCTGTCCTGG - Intergenic
1013854981 6:114561355-114561377 GGGAAATCTCTTACCTGTCTAGG + Intergenic
1015710027 6:136129459-136129481 AGGAAATCTCTGCCCTCTCCTGG - Intronic
1016435493 6:144032905-144032927 TCTTAATCTCTTACCTCTCAGGG - Intronic
1019363151 7:616277-616299 TGGAGATCTCTGACCTCTCCAGG - Intronic
1027744026 7:82050610-82050632 GAGAAATCTCTTTACTATCCTGG + Intronic
1033642869 7:143279083-143279105 GTCAAATATGTTACCTCTCCTGG + Intergenic
1033966016 7:146975934-146975956 GCTAAATTTCTTACCTTTCATGG + Intronic
1037138244 8:15489484-15489506 GAGAAACCTCTTCCCTTTCCAGG - Intronic
1046232583 8:111376283-111376305 ACAAAATCTCCTACCTCTCAAGG - Intergenic
1047204186 8:122790250-122790272 GCCAATTATCTTACCTTTCCGGG - Intronic
1050843810 9:10189056-10189078 GCCAACTCTCTTACCTGTCCAGG + Intronic
1056132501 9:83600178-83600200 TGGAAATCTCTTACCTCTCTCGG - Intergenic
1057686529 9:97239577-97239599 GCGAATTCTCTTGCTTCTTCAGG - Intergenic
1060470358 9:123943177-123943199 GCCAAGTGTCTTACCTCTCCTGG - Intergenic
1061933539 9:133845473-133845495 GCGAGATCTCTCTCCTCTCTAGG + Intronic
1187670063 X:21658257-21658279 GCGAGGACTCTGACCTCTCCGGG + Exonic
1192140233 X:68640680-68640702 GCAAGATTTCTTACCTCTCTGGG + Intergenic
1193391128 X:80930452-80930474 GCTAAATATGTTACCCCTCCAGG + Intergenic
1194283544 X:91982528-91982550 GCTAAATATGTTACCCCTCCAGG - Intronic
1200601119 Y:5207091-5207113 GCTAAATATGTTACCCCTCCAGG - Intronic