ID: 907174168

View in Genome Browser
Species Human (GRCh38)
Location 1:52502396-52502418
Sequence ACTTTTAAGCTGTAACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 313}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907174168 Original CRISPR ACTTTTAAGCTGTAACTTGA AGG (reversed) Intronic
900465565 1:2823724-2823746 ACTTTTATGGGTTAACTTGACGG + Intergenic
901177712 1:7316843-7316865 GCTTTTGAGCTGAAACTTGAGGG + Intronic
904199414 1:28810342-28810364 ATATTTAAGCTGAAATTTGAGGG + Intergenic
905011979 1:34753871-34753893 ACATTTAAGCTGGGTCTTGAAGG - Intronic
906127309 1:43434959-43434981 ATTTTTAAGCTGAGACTCGACGG + Intronic
906164297 1:43674485-43674507 ACTTTTAACCTGTGACTAAATGG + Intronic
906509227 1:46401300-46401322 ACATTTCAGCTGTGATTTGAAGG - Intronic
906567268 1:46810143-46810165 ACATTTAAGGTGAAACTTGAAGG - Intronic
907174168 1:52502396-52502418 ACTTTTAAGCTGTAACTTGAAGG - Intronic
907379783 1:54076981-54077003 ACATTTGAGCAGAAACTTGAAGG + Intronic
907661042 1:56392644-56392666 ACATTTGAGCTGAGACTTGAGGG - Intergenic
908986577 1:70031003-70031025 GCCTTTAAGCTGAAACTTGAAGG - Intronic
910115056 1:83722649-83722671 AGTTTTAAGCTGTACTTTGAAGG - Intergenic
910375845 1:86569235-86569257 ACATTTAAGCTCTGATTTGAAGG + Intronic
910825364 1:91401390-91401412 ACATTTGACCTATAACTTGAAGG - Intronic
911234372 1:95395116-95395138 AATTTTAAGCTGAGACCTGAAGG + Intergenic
912739572 1:112181722-112181744 ACATTTAAGCTGCAACCTGAAGG + Intergenic
912911121 1:113759679-113759701 ACTTTTAAGCTGAGGCCTGAAGG - Intergenic
914509918 1:148322530-148322552 CCTTTGAACCTGGAACTTGAAGG + Intergenic
914685527 1:149975587-149975609 ACATTTGAGCTGAATCTTGAAGG + Intronic
915364014 1:155303848-155303870 ATTTTGAAGCTGAAATTTGAAGG + Intergenic
915485107 1:156214822-156214844 GCATTTCAGCTGGAACTTGAAGG + Intronic
916659017 1:166903869-166903891 ATTTTCAAACTGTTACTTGAAGG - Intergenic
917020595 1:170582095-170582117 TCTTTTAAACTGTAACATGGAGG - Intergenic
917078328 1:171229171-171229193 ACATTTAATGTGTCACTTGAAGG + Intergenic
917580776 1:176375879-176375901 ACTGTTAAGCTCTAACTTCATGG - Intergenic
918252338 1:182714134-182714156 ACATTTAAGCTGAAACCTGTAGG - Intergenic
918312995 1:183299741-183299763 ACTGTAAAGCTGTAGCTTGTGGG + Intronic
918366976 1:183818458-183818480 ACATTTGAGCTGCAACTTAAAGG - Intronic
918403575 1:184190033-184190055 ACATTTAAAATGTAAGTTGAAGG - Intergenic
919066396 1:192697003-192697025 ACTTTTAATCTGTGAAATGAGGG - Intergenic
919226012 1:194702475-194702497 GCTTTTAAGCTGCAGCTTGATGG + Intergenic
920237636 1:204518992-204519014 ACATTTAACCTGAGACTTGAAGG + Intronic
920538825 1:206761696-206761718 ACTTTTAAGCTTTTAATTGAAGG + Intergenic
920931543 1:210393574-210393596 GCTTTTGAGCTGTGGCTTGAAGG + Intronic
921836224 1:219781719-219781741 ACATTTGAGCTGAGACTTGAAGG - Intronic
924541101 1:244981569-244981591 CCTTTTGAGCTGAAACTGGAAGG - Intronic
1064166190 10:12988292-12988314 ACTTTTAAACTGAAATCTGAAGG - Intronic
1065417187 10:25501296-25501318 GCATTTAAGCTGAGACTTGAAGG - Intronic
1065603921 10:27396111-27396133 ACTTTTACCCTGGAACTTGTTGG - Intergenic
1067964068 10:50889230-50889252 ACATTTAAGCTGAGACCTGAAGG + Intergenic
1068213952 10:53958388-53958410 AGTTTTAAGTTGTAGATTGAAGG - Intronic
1070606719 10:77903653-77903675 ACTTTTAAGCTATATGTAGAAGG + Intronic
1070850836 10:79560398-79560420 ACCTTTATGCTCTAACTTGGAGG - Intergenic
1071257643 10:83886724-83886746 ACATTTTAGCTGAGACTTGATGG + Intergenic
1072076250 10:91977000-91977022 AAGTTTAAGCTGAAACCTGAAGG + Intronic
1074976217 10:118583984-118584006 ACATTTAAGCTGAGACCTGAAGG + Intergenic
1075770226 10:124928121-124928143 ACATTTAAGCTGGTCCTTGAAGG + Intergenic
1075841363 10:125507223-125507245 TCTTATAAGTTGTAACTTGGTGG - Intergenic
1078026219 11:7698122-7698144 TCTTTGAAGCTGCAACTGGAAGG - Intronic
1078620032 11:12898876-12898898 GCTTTTCAGCTGTACCTTCATGG + Intronic
1078970151 11:16400343-16400365 ACATTTAAGCAAAAACTTGAAGG + Intronic
1079409107 11:20170308-20170330 GTATTTAAGCTGTAATTTGAAGG - Intergenic
1079427257 11:20355529-20355551 TCTTTTTATCTGTAAGTTGAGGG - Intergenic
1079674767 11:23212766-23212788 ACTTTTAAGCTGTACATTTGAGG + Intergenic
1079681789 11:23306067-23306089 ACTTTTAAGATGTTATTTAAAGG - Intergenic
1079702465 11:23565787-23565809 ACTTTTATTCTGTAATTTTAAGG - Intergenic
1079955697 11:26861903-26861925 ACTTTTAAACTAAACCTTGAAGG - Intergenic
1080993502 11:37571315-37571337 ACTTAAGAGCTGAAACTTGATGG + Intergenic
1081208484 11:40302928-40302950 ACTTTAAGGCTGGAACTTAAGGG + Intronic
1081232189 11:40599124-40599146 ACATTTGAGCTGTAACATGAAGG - Intronic
1083807081 11:65080956-65080978 ACATTCAAGCTACAACTTGAAGG + Intronic
1086299186 11:85406954-85406976 ACGTTTAAGCAGAAACCTGAAGG + Intronic
1087144869 11:94801170-94801192 ACATTTGAGTTGGAACTTGAAGG + Intronic
1088802970 11:113323696-113323718 ATATTTAAGCTGTACCTTTAAGG + Intronic
1089417384 11:118303490-118303512 ACATCTAAGCTGAAATTTGATGG - Intergenic
1089704024 11:120264458-120264480 ACTTTTAAGTTGGGTCTTGAAGG + Intronic
1090218646 11:124995216-124995238 ACATTTAAGCTGAAACCCGAAGG - Intronic
1090738853 11:129638085-129638107 GCTTCTAAGCTGAGACTTGAAGG - Intergenic
1092380214 12:7990001-7990023 ACATTTAAGCTGGACCTTGAAGG - Intergenic
1095288981 12:40453457-40453479 CCTTTAAATCTGTGACTTGAGGG + Intronic
1098210844 12:68163673-68163695 ACTTTTAAAGTATATCTTGATGG - Intergenic
1098289784 12:68947190-68947212 CTGTTTAAGCTGTAACTTGAAGG + Intronic
1098523348 12:71458947-71458969 ACATTTAATCTGAAACTTGGAGG + Intronic
1099241402 12:80143383-80143405 ACATTTAGGCTGTGATTTGAGGG - Intergenic
1100696710 12:97101804-97101826 ACTTTTTAGGTATAACTTAAAGG + Intergenic
1100832914 12:98534464-98534486 ACTTTTATACTGTAATTTGATGG - Exonic
1102550801 12:113690759-113690781 ACATTTAAGCTGAGACCTGAAGG + Intergenic
1103859217 12:123998569-123998591 ACTTTTAAGCTGAAACCCAAAGG - Intronic
1104557549 12:129814874-129814896 ACGTTTAAGCTGAATCATGAAGG - Intronic
1105047465 12:133017124-133017146 AATTATAAGATGTAATTTGATGG + Exonic
1105341057 13:19526418-19526440 ATTTTTAAGCTGGAGCTGGATGG - Intronic
1105878079 13:24577523-24577545 ATTTTTAAGCTGGATCTGGATGG + Intergenic
1106278550 13:28240259-28240281 ATTTTTAATCTGAAACATGAGGG + Intronic
1108368645 13:49744914-49744936 ACATTTAAGCTGAAACCTGAAGG - Intronic
1108461032 13:50667474-50667496 ACTTCTTAGCTGTATCTTTATGG - Intronic
1109074680 13:57819876-57819898 ACATATAAGCTGTATCTTCAAGG + Intergenic
1109373392 13:61455676-61455698 ACTTTATAGCTGTAGATTGAGGG + Intergenic
1110429249 13:75404800-75404822 AATTTTTAACTGTAACTTAAGGG - Intronic
1111386420 13:87534457-87534479 ACTTTTAATATATAACTTCAAGG - Intergenic
1112757737 13:102657770-102657792 ACTTTTAAGATGCAATATGATGG - Intronic
1113156422 13:107327892-107327914 ACTTTTAAGCTGAGATCTGAAGG - Intronic
1114398592 14:22388897-22388919 ACTTATCATCTGTAATTTGAGGG + Intergenic
1114953546 14:27788493-27788515 AAGTTTAAGGTGAAACTTGAAGG + Intergenic
1115431008 14:33318791-33318813 AGATTTAAGTTGTAACTTGAAGG - Intronic
1116256962 14:42569724-42569746 AATTTTATCCTGTAACTTCATGG + Intergenic
1116791148 14:49341726-49341748 CCTTTTAAGTTATAACTGGAAGG + Intergenic
1116849791 14:49896454-49896476 ACATTTAAGATTTAACATGAGGG - Exonic
1117551613 14:56842832-56842854 ACTTCCAAGCTGGCACTTGAAGG - Intergenic
1118512361 14:66489440-66489462 ACATTTAAGCTGAGACCTGAAGG - Intergenic
1118752211 14:68815796-68815818 ATCTTTAAGCTGAACCTTGAAGG + Intergenic
1119313005 14:73666429-73666451 ATTTGTAACCTGTAACCTGAAGG - Intronic
1119535015 14:75395903-75395925 ACATTTAAGCTGAGACATGAAGG + Intergenic
1120342665 14:83242187-83242209 ACATTGAAGCTGTGCCTTGAAGG + Intergenic
1120696167 14:87648038-87648060 ACTTTGAATCTTTAACTTCAGGG - Intergenic
1121383934 14:93499822-93499844 ACATTTAAGCTGATACCTGAAGG + Intronic
1125147671 15:36491127-36491149 ACTTTTCAACTGTCACCTGAAGG + Intergenic
1125383534 15:39112888-39112910 ACATTTCAGCTGAAACTTGTAGG + Intergenic
1125697456 15:41651460-41651482 ACTTTTCAGCTGACTCTTGAAGG - Intronic
1128105567 15:65042189-65042211 ACATTTAAGCTGAGGCTTGAAGG + Intergenic
1128369645 15:67031138-67031160 ACATCTAAGCTGAAACTTGAAGG + Intergenic
1129099237 15:73243317-73243339 AATTTTAATCTGCAATTTGAAGG + Intronic
1129143295 15:73622776-73622798 TCTTTTAAGTTCTAACTGGAAGG + Intronic
1129481365 15:75829206-75829228 ACATTTAAGCTGAGACTTGAAGG + Intergenic
1129542111 15:76358893-76358915 ACTCTTGAGCTGTAGCTTCATGG - Intronic
1130645081 15:85718209-85718231 ATTTTTAAGCAGTAATTTGTTGG + Intronic
1131048594 15:89332117-89332139 ACTTAGAATATGTAACTTGATGG - Intronic
1133465828 16:6026062-6026084 GCTTTTGAGTTGTAACCTGAAGG - Intronic
1133638819 16:7697240-7697262 ATCTTTAAGCTGTATTTTGATGG + Intronic
1133901496 16:9979475-9979497 ACGTTTAAGCTGAAATCTGAAGG - Intronic
1134251182 16:12575204-12575226 ACTTTTAAGCTGAGACCTAAAGG + Intergenic
1135429147 16:22367373-22367395 ACCTTTTAGCTGAAGCTTGAAGG + Intronic
1135532162 16:23264108-23264130 ACATTTGAGCTGAATCTTGAAGG + Intergenic
1135756459 16:25102757-25102779 ACTTTTAATATCTAACTTTAAGG + Intergenic
1136098598 16:27976805-27976827 ACATTTGAGCTGGATCTTGAAGG - Intronic
1141120512 16:81351623-81351645 ACTTATAAGATTGAACTTGAAGG + Exonic
1142267216 16:89070255-89070277 AGATTTAAGCTGTACCTTGAAGG + Intergenic
1142419140 16:89959808-89959830 ACTTTTAAGCAAAAACTTGAAGG + Intronic
1143098135 17:4489403-4489425 TCTTTTACCTTGTAACTTGAAGG - Intergenic
1143746089 17:8995282-8995304 ACATTTAAGTTGAAACATGAGGG - Intergenic
1144293679 17:13853031-13853053 ACATTTGAGCAGAAACTTGAAGG + Intergenic
1144786640 17:17835981-17836003 ACTTCTAAGCTGAGACCTGAGGG - Intronic
1146095075 17:29922062-29922084 ACATTTAAGCTGAGACCTGAAGG + Intronic
1146481515 17:33208540-33208562 ACTTTGAAGCTGAAACCTAAAGG - Intronic
1146587630 17:34096225-34096247 ATTTCTAAGCCGTAACTTGAAGG + Intronic
1148012538 17:44495006-44495028 GCATTTAAGCTGGATCTTGAAGG - Intronic
1149727616 17:58912359-58912381 ACATTTAAGCAGAGACTTGAAGG + Intronic
1150318432 17:64189346-64189368 ACATCTACGCTGTATCTTGAGGG + Intronic
1155376381 18:25162828-25162850 ATTTTTAAGCTGTATCTTACAGG + Intronic
1156887005 18:42146800-42146822 AGTTTTATGCTATAGCTTGAAGG - Intergenic
1158155679 18:54423050-54423072 AATTTTAAGCTTTAATTTGCCGG - Intergenic
1159821132 18:73145925-73145947 ACTTTGAATATGAAACTTGAAGG - Intergenic
1160661921 19:305304-305326 ATATTTAAGCTGAAACATGAAGG - Intergenic
1160741102 19:686297-686319 ACCTTTGAGCTGAGACTTGAAGG - Intronic
1161875416 19:6904863-6904885 ACATTTAAGCAGAAACCTGAAGG + Intronic
1163280185 19:16311549-16311571 CCTTTTAAGCAGAAACTTGAAGG - Intergenic
1165970504 19:39624765-39624787 GCTTTTAAGCTTTAAGTTCAGGG - Intergenic
1166563702 19:43750374-43750396 ACTTTTTAGCAGAGACTTGAAGG - Intronic
1167707899 19:51092523-51092545 ACCTTTAAGCTGAAATCTGAAGG - Intergenic
926513398 2:13810450-13810472 GCTTTTATGCTGTAGTTTGAAGG + Intergenic
928016972 2:27666453-27666475 GATTTTGAGCTGGAACTTGAAGG + Intronic
931450189 2:62362128-62362150 CATTTTAAGCTGTAAGTTGGTGG + Intergenic
931481015 2:62639908-62639930 TCTTGTTAGCTGTAAATTGAGGG + Intergenic
931659967 2:64550562-64550584 ACTATTAAGAGGTAACATGAGGG + Intronic
931851912 2:66260196-66260218 ATTTTTAAGGAGTAACTTGTGGG + Intergenic
931977517 2:67658853-67658875 ACATTTGAGCTGAAACCTGAGGG - Intergenic
932039913 2:68288311-68288333 ACATTTAAGCTGGCACTTGAAGG + Intronic
932615842 2:73230982-73231004 ACATTTAAGGTGTGACCTGAAGG - Intronic
932939126 2:76141068-76141090 ATTATTAAGTTTTAACTTGAGGG + Intergenic
934625967 2:95852418-95852440 ACTTTTGTGCTGTAACTGCAGGG + Intronic
936988434 2:118334766-118334788 ATTTTTTAGCTATATCTTGAAGG - Intergenic
937684444 2:124680177-124680199 ACATTTATGCTGAACCTTGAGGG - Intronic
938197893 2:129347480-129347502 AATTTTATGCTGTAGCTTGAAGG - Intergenic
942877669 2:180821081-180821103 AGTTTTAAGATGTATCTTTATGG - Intergenic
943398695 2:187375719-187375741 ACTTTAAAGATGTAACCTGTAGG - Intronic
943614742 2:190080466-190080488 ACATTTGAGCTGGATCTTGAAGG + Intronic
944110736 2:196129129-196129151 ACTGCAAAGTTGTAACTTGAGGG + Intergenic
944904628 2:204250408-204250430 GCTTTTAAGATGTATCTTGGAGG - Intergenic
946119557 2:217497846-217497868 ACTTTCAATCTTTAACTTGAAGG - Intronic
1168748586 20:266096-266118 ACTTTAAAAATGTAACTCGAGGG + Intergenic
1169306372 20:4494439-4494461 ACTTTTAAGGTGTTACTCCAAGG + Intergenic
1170154260 20:13255193-13255215 ACATTTAAGCTGAGACTTGAAGG + Intronic
1170396048 20:15926644-15926666 ACATTTAAGCAGTAACTTGAAGG + Intronic
1170510533 20:17071940-17071962 ACTTTTTAGCTGTCAATTCAGGG - Intergenic
1170855640 20:20051831-20051853 ACCTTTAAGCTGAGACTTGAAGG - Intronic
1170899608 20:20448899-20448921 CCTGTTAAGTCGTAACTTGAAGG - Intronic
1171981149 20:31630147-31630169 ACATTTAAGCTGCAATTTGAAGG + Intergenic
1172341951 20:34165352-34165374 ACTTTGAAACTGAAACCTGAAGG + Intergenic
1172416700 20:34775002-34775024 AGATTTAAGCTGATACTTGAAGG + Intronic
1172427389 20:34864220-34864242 ACTTTTAAGCTGAAAACTAAGGG + Intronic
1173077895 20:39837900-39837922 ACATTTAAGCAGCAATTTGAAGG + Intergenic
1173287478 20:41686412-41686434 ACTATGAAGCTGTAACTCTAGGG + Intergenic
1173316989 20:41953938-41953960 ACATTTAAGCTGAGATTTGACGG - Intergenic
1173432765 20:43005450-43005472 ATCTTTAGGCTGAAACTTGAAGG - Intronic
1174510841 20:51051200-51051222 ACTATTAAGCTCAACCTTGAAGG - Intergenic
1174951796 20:55050447-55050469 ATATTTAAGCTGAGACTTGAGGG - Intergenic
1175405838 20:58726743-58726765 ACTTTTAATCTATCAATTGAGGG - Intergenic
1177130851 21:17253249-17253271 ACATTTAAGTTGAAATTTGAAGG - Intergenic
1177913795 21:27062605-27062627 CCTTTTCAGCTGTAATGTGATGG + Intergenic
1178378426 21:32087915-32087937 ACTTTAGAACTGTTACTTGAGGG + Intergenic
1179137627 21:38694411-38694433 ACTTTTAAGTTGGATCTTGAAGG - Intergenic
1182411678 22:30192331-30192353 AATTTTGAGCTGGATCTTGAGGG + Intergenic
949202968 3:1402560-1402582 ACATTTAAGCCATAACTGGAAGG - Intronic
950997592 3:17519439-17519461 ACTTTTGAGCTGTATCTTAAGGG - Intronic
951010042 3:17666572-17666594 ACTTTTCAAGTCTAACTTGAAGG - Intronic
951082720 3:18470540-18470562 GTTTTTAATCTCTAACTTGATGG + Intergenic
951170413 3:19535242-19535264 ACTTCTGAGCTATAACTTGTGGG + Exonic
952158674 3:30671407-30671429 ACATTTAAGCTGAAGTTTGAAGG + Intronic
953419230 3:42741772-42741794 ACTTTTGGCCTGTATCTTGAAGG - Intronic
953972025 3:47355428-47355450 ACTTTTGAGCTGTGCCTTGAAGG + Intergenic
955054078 3:55440688-55440710 ACTTTTCATCTGTAGCATGAAGG + Intergenic
955139411 3:56254347-56254369 ACTTTGAAAATGTAAGTTGATGG + Intronic
955927299 3:64020527-64020549 ACTTTTAAGCTGTATGTTTGTGG - Intronic
956599628 3:71006426-71006448 ACTTTTTAGCTGTCTCTTTAGGG - Intronic
956634215 3:71347261-71347283 TGTTTTGAGCTGTAATTTGACGG - Intronic
958708149 3:97682904-97682926 ACATTTCAGCTGTAACTAGATGG - Intronic
958809641 3:98845871-98845893 ACTTTTAAGCTGAGAAGTGAAGG - Intronic
959110277 3:102114935-102114957 ACATTTAAGCTGTGACCTGAAGG - Intronic
959462000 3:106638461-106638483 ACTTTTAAGTTCTAGCTTCATGG + Intergenic
959852216 3:111101967-111101989 ACATTTAAGCTATACCTTGAAGG - Intronic
960317643 3:116197916-116197938 ACATTTAAGCTGGAACATAAAGG + Intronic
960333105 3:116386847-116386869 ACATTTAAACTGGATCTTGAAGG + Intronic
961179191 3:124862901-124862923 ACATTAAAGCTGCAACTTGCAGG + Intronic
961762305 3:129180493-129180515 AATTTTAAGTTGTAATTAGAAGG - Intronic
961821166 3:129576344-129576366 GCTTTTAAGCTGGATCCTGAAGG - Intronic
964498585 3:157323145-157323167 ACTTCTAAACTTTAACTTGGAGG - Intronic
964719885 3:159761029-159761051 ACATTTAAGCTGAGACTTGAAGG + Intronic
965246846 3:166283172-166283194 AATTTTCAGTTGTAACTTGTTGG + Intergenic
966240571 3:177751575-177751597 ACATTTAAGCTGAGACCTGAAGG + Intergenic
967257046 3:187603923-187603945 AATTTTCAGTTATAACTTGAAGG + Intergenic
969063575 4:4459585-4459607 ACATTTAAGCTGAGACTTGAAGG + Intronic
969152256 4:5179634-5179656 CCTTTTAACTTGTAGCTTGAAGG - Intronic
970331267 4:14986727-14986749 ACATTTGAGCTGTACATTGAAGG - Intergenic
970568517 4:17356170-17356192 ACTTTTAAGCAGTAATGGGAAGG - Intergenic
971129243 4:23787866-23787888 ACTTTTAAGCTTTAATTTTGTGG - Intronic
971538058 4:27779692-27779714 AGTCTTCAGCTGTAGCTTGAGGG + Intergenic
971740463 4:30513663-30513685 ACACTTAAGTTGTAAATTGAAGG + Intergenic
971767342 4:30850282-30850304 GCTTTTAAGCTGCAACTTGATGG + Intronic
972329681 4:38053537-38053559 ACGTCTAATCTGTAAGTTGAGGG + Intronic
972915065 4:43866763-43866785 CCTTTTAATCTGTGGCTTGATGG + Intergenic
973554398 4:52067607-52067629 ACATTTAAGCTGAGACTTGGAGG - Intronic
973998722 4:56487622-56487644 TTTTTTGGGCTGTAACTTGAAGG - Intronic
974075666 4:57166094-57166116 ACTTTTGAGCTGGACCTTGAAGG + Intergenic
974356220 4:60816069-60816091 ACATTTGAGCTGAGACTTGAAGG - Intergenic
974910489 4:68112331-68112353 ACATTTAAGCTGGATCTTGAAGG - Intronic
975528493 4:75376690-75376712 ACCTTTGAGCTGAATCTTGAAGG - Intergenic
976426200 4:84905885-84905907 ACCTTGAAGCTGAAAATTGAAGG - Intronic
977018368 4:91724825-91724847 ACTTTTAAGCTGGGAATGGAAGG - Intergenic
978698990 4:111619504-111619526 ACATTTAAGCTGAGGCTTGAAGG - Intergenic
979762462 4:124423524-124423546 ACTTTTGAGCTGGAATCTGAAGG + Intergenic
979911185 4:126367665-126367687 ACTTTTAATTATTAACTTGAAGG + Intergenic
980327793 4:131370978-131371000 ACATTTGAGCTGAGACTTGAAGG + Intergenic
980904739 4:138937254-138937276 ACTTTTAAGATACAAATTGAAGG - Intergenic
981952727 4:150429682-150429704 ATTTTTAAGCTGTATCTTAAGGG - Intronic
982067497 4:151667286-151667308 TGTTTTAAGCTGTTACTTGATGG - Intergenic
982660241 4:158198023-158198045 ACTGTTAAGCTGTATCTTACTGG + Intergenic
982798887 4:159677544-159677566 ACTTTAATGCTTTTACTTGATGG - Intergenic
984766214 4:183402439-183402461 GCTTTTCAGCTGGACCTTGATGG - Intergenic
985333827 4:188870334-188870356 AGTTTGAAGCTGCAACATGAAGG - Intergenic
988396505 5:30702598-30702620 ACATTTAAGCAAAAACTTGAAGG + Intergenic
989063986 5:37441129-37441151 ACTTTTAAATTGTAACAGGAGGG + Intronic
989616168 5:43338937-43338959 ACACTTAAGCTGAGACTTGAAGG + Intergenic
990667866 5:58094052-58094074 ATTTCTCAGCTGTAACTTAAGGG + Intergenic
990703148 5:58497251-58497273 CCATTTAAGCTGAGACTTGAAGG + Intergenic
991340988 5:65608871-65608893 ATATTTAAGCTGGACCTTGAAGG + Intronic
991940238 5:71844025-71844047 ACCTTCTAGCTGTAACATGAGGG + Intergenic
991959204 5:72026222-72026244 ATTTTTAAGCTGTAAATCAATGG + Intergenic
992770171 5:80040176-80040198 ACTTTTAGTCTGCAGCTTGAAGG - Exonic
993108675 5:83629058-83629080 GCTATCAAGCTGCAACTTGATGG + Intergenic
993300104 5:86198183-86198205 ACAATTATGCTGAAACTTGAAGG + Intergenic
993376128 5:87150878-87150900 ACTTTGAAACTGGATCTTGAAGG - Intergenic
994417796 5:99496959-99496981 ACTTTTAAATTGTAACAGGAGGG + Intergenic
994462169 5:100078197-100078219 ACTTTTAAATTGTAACAGGAGGG - Intergenic
994783113 5:104117955-104117977 TCTATTAAACTGTAAATTGAAGG + Intergenic
994991638 5:107004271-107004293 ACATTTAAGCAGTATCTTGTGGG - Intergenic
995333632 5:110974440-110974462 ACTTTTAAACTGTCTCTTGAGGG + Intergenic
996630198 5:125622345-125622367 ACTGAAAAGCTTTAACTTGAAGG + Intergenic
998193474 5:140045974-140045996 ACATTTAAGCTGAGACTAGAAGG + Intergenic
998665276 5:144289622-144289644 TCTTTTTATCTGTAATTTGAAGG + Intronic
998695988 5:144640199-144640221 ACTTTTAAGCAGAGATTTGAAGG + Intergenic
998700244 5:144690104-144690126 AACTTTGAGCTGTAATTTGAAGG - Intergenic
998801632 5:145874943-145874965 ACATTTGAGGTGTGACTTGAAGG - Intergenic
999035189 5:148341236-148341258 ACTTATAAGCAGAAACCTGAAGG + Intergenic
999443702 5:151622034-151622056 ACTTTTGAGCTGAAATCTGAAGG - Intergenic
1000342785 5:160290226-160290248 ACTTTTAAGCTGAGATCTGAAGG - Intronic
1000858958 5:166433516-166433538 ACATTTAAGCTGAGACCTGAGGG - Intergenic
1004166544 6:13261795-13261817 AGCTTTAAGCTGTAACGTTAGGG + Intronic
1005466959 6:26124975-26124997 ACTTTAAAAATGTAAATTGAAGG + Intronic
1006364361 6:33606656-33606678 ACATTTAAGCTGAGCCTTGAGGG + Intergenic
1007835317 6:44669525-44669547 AGTTTTGAGCTGAACCTTGAAGG + Intergenic
1007895229 6:45348830-45348852 TCATTTAAGCTGAAACATGAAGG - Intronic
1009025233 6:57991664-57991686 ACATTTAAACTGAAACCTGAGGG - Intergenic
1010243285 6:73637737-73637759 ACTTTTAAGCTAAAATCTGAAGG - Intronic
1010774185 6:79866119-79866141 ATTTTTAAGCAGCATCTTGAGGG - Intergenic
1011429096 6:87266084-87266106 ACATTTAAGCTGTGAACTGACGG - Intergenic
1012075710 6:94682326-94682348 AATTTTTATCTCTAACTTGATGG - Intergenic
1013329069 6:109080604-109080626 AGTTTTAAGTTTTACCTTGAAGG + Intronic
1013732382 6:113184074-113184096 ATGTTTAAGCTGAGACTTGAAGG + Intergenic
1013943314 6:115692153-115692175 ACTTTCAAGATGAGACTTGATGG + Intergenic
1017003377 6:150012209-150012231 ACTGTTTAGCTGTAACTGGCAGG + Intergenic
1017012980 6:150076243-150076265 ACTGTTTAGCTGTAACTGGCAGG + Intergenic
1018515471 6:164574728-164574750 ATTTTTAAAATGTAACTTTATGG + Intergenic
1019843509 7:3473999-3474021 ACCTTTAACCTGTAAAATGAGGG + Intronic
1020478705 7:8630779-8630801 ACTTTTAACCTTTAAGTTCAGGG + Intronic
1021839277 7:24709350-24709372 AATTTTCAGCTGCCACTTGAAGG - Intronic
1022541137 7:31136298-31136320 ACTTCCAAGCTGAAACTTTAAGG + Intergenic
1023111296 7:36813533-36813555 ACCTTTAAGCAAAAACTTGAAGG - Intergenic
1026941045 7:74288305-74288327 ACATTTAAGCTGTGCTTTGAAGG + Intergenic
1027670884 7:81096787-81096809 CCTTTTAAGATGTCACTTGAAGG + Intergenic
1027846905 7:83391192-83391214 ACTTTTGAGCTTAATCTTGAAGG - Intronic
1027922436 7:84411828-84411850 ACCTGTAAACTGTATCTTGATGG + Intronic
1031140575 7:117938352-117938374 ACTTTTGAGCTGAGCCTTGAGGG + Intergenic
1031369048 7:120941687-120941709 ACTTATAAGCTATACCTGGATGG + Intergenic
1031503585 7:122553070-122553092 ACTTTTGAGATAAAACTTGAAGG - Intronic
1031560508 7:123232365-123232387 ATATTTAGGCTGAAACTTGAAGG - Intergenic
1032675184 7:134123599-134123621 AATATTAATCTGTAACTTGTAGG + Intergenic
1033457440 7:141515600-141515622 ACATTTAAGCTAGAACCTGAAGG - Intergenic
1035926479 8:3733545-3733567 ACTCTTAAGTTGTAAGTTGCGGG + Intronic
1035984032 8:4405826-4405848 ACTTCTAAGCTGTGTCTTGGAGG - Intronic
1036812777 8:11879032-11879054 ATTTTTAAGATGAAACTTTAGGG - Intergenic
1037586341 8:20279111-20279133 ACATTTGAGCTGGACCTTGAAGG - Intronic
1038869905 8:31482342-31482364 ACATTTGAGCTGAAACTTGAAGG + Intergenic
1039865792 8:41500314-41500336 ACATTTAAGCTGTTGCATGAAGG + Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1043118729 8:76293759-76293781 TCTTTTAGGCTGTAAGTTTAAGG - Intergenic
1043247513 8:78023757-78023779 ACATTTAAACTGAGACTTGAGGG + Intergenic
1043360176 8:79462807-79462829 ACTTTTTTGCTGAAACCTGATGG - Intergenic
1043737408 8:83765901-83765923 ACTTTTGAACTATAACTTGATGG + Intergenic
1045930856 8:107624706-107624728 ATGTTTAAGCTGAAACTGGAAGG - Intergenic
1046950460 8:120015279-120015301 ACATTTAATCTGAGACTTGAAGG - Intronic
1048433841 8:134396697-134396719 ATTTTTAAGATGTAAATTGTTGG - Intergenic
1048721034 8:137325305-137325327 GCTTTTAAACTGTAAATAGATGG - Intergenic
1049121052 8:140738221-140738243 ACATTTAAGGTGGACCTTGAGGG + Intronic
1050319310 9:4434768-4434790 ATTTTTAAGTTTTAACTTAATGG - Intergenic
1050614201 9:7384592-7384614 ACTTTTAGACCCTAACTTGATGG + Intergenic
1052136296 9:24915147-24915169 AGTTTGAAGCGGTAACTGGAAGG - Intergenic
1052836117 9:33251408-33251430 ACCTTTAAGTTGTGCCTTGAAGG + Intronic
1054947176 9:70807894-70807916 ATTTTTAATCTGAGACTTGAAGG + Intronic
1054986419 9:71267183-71267205 ACATTTAAGCTGAGCCTTGAAGG - Intronic
1054993101 9:71353137-71353159 AAATTTAAGCAGTAACCTGAAGG - Intronic
1055367020 9:75555534-75555556 ACATTTAAGCTGAATCTTAAAGG + Intergenic
1057029183 9:91760731-91760753 ACTTTTAAAATGGAACTTGCTGG - Intronic
1057990518 9:99764712-99764734 ATTTTTAAGAGGAAACTTGATGG - Intergenic
1059620443 9:115998843-115998865 ACTTTTAAGCCTTAATTTCAAGG - Intergenic
1059643654 9:116242253-116242275 ACATGTAAGCTGAGACTTGAAGG + Intronic
1059647334 9:116280373-116280395 ACATTTAAGCTGAGACTTGAGGG + Intronic
1059726401 9:117012665-117012687 GCCTTTAAGCTATACCTTGAAGG + Intronic
1060205377 9:121679804-121679826 GCTTTTGAGCTGCATCTTGAAGG + Intronic
1060388060 9:123251677-123251699 ACTTTTACACTGTAACTGTAAGG - Intronic
1062508068 9:136888169-136888191 ACTTTAAAACTGTAATTTCATGG - Intronic
1186102560 X:6172579-6172601 ATTTCTAATCTGTAACTTGTAGG - Intronic
1186532923 X:10315502-10315524 ACTCCTTATCTGTAACTTGAGGG - Intergenic
1186849293 X:13564727-13564749 ACTTTTAAGGTGTATCTAAACGG + Intergenic
1187239604 X:17500652-17500674 AGCTTTAAGCGGTAACTTGATGG + Intronic
1187692604 X:21885334-21885356 ATTCTTAAGCTTTAACTTGAAGG + Exonic
1188542465 X:31265981-31266003 AGTTTGAAGCTTTAAATTGAAGG - Intronic
1188649296 X:32611846-32611868 ACATTTAAACTGTGACTGGAAGG + Intronic
1192370526 X:70509028-70509050 ACATTTGAGCTGGAGCTTGAAGG - Intergenic
1194423585 X:93708172-93708194 ACATTTAAGCTGAAACCTGAAGG + Intronic
1194936198 X:99951875-99951897 ACATTTAAGCTAAAACCTGAAGG + Intergenic
1195338010 X:103876392-103876414 ACTGTAAAGTTTTAACTTGAGGG + Intergenic
1195624904 X:106997823-106997845 ACATTTAAGCTGAGATTTGAAGG - Intronic
1195814748 X:108872819-108872841 ACATTTAAGCTGAAAATTGAAGG + Intergenic
1196715643 X:118808362-118808384 ACATTTAAGCTGAAATTTTAAGG + Intergenic
1197048314 X:122027417-122027439 ACATTTAAGCTGAGACCTGAAGG - Intergenic
1197673677 X:129307318-129307340 ACATATAAGCTGAGACTTGAAGG + Intergenic
1198143545 X:133831119-133831141 ACTGTTAAGGGGTAACATGAGGG + Intronic
1198868386 X:141149866-141149888 ACATTTAAGTTGTGACGTGAAGG - Intergenic
1199419349 X:147626113-147626135 ACTTTTCATCTGTAGCTTAATGG - Intergenic
1199600422 X:149538438-149538460 ACTTTAAAGTTGTGCCTTGAAGG + Intergenic
1199650166 X:149941503-149941525 ACTTTAAAGTTGTGCCTTGAAGG - Intergenic
1201694604 Y:16811162-16811184 ACTATTAAGATGAAACTGGAAGG - Intergenic
1202591109 Y:26484171-26484193 ATTTTTAAGCTGGAGCTGGATGG + Intergenic