ID: 907178812

View in Genome Browser
Species Human (GRCh38)
Location 1:52552738-52552760
Sequence AACGGGCTTCGGGTGTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907178812_907178822 9 Left 907178812 1:52552738-52552760 CCCTGGGACACCCGAAGCCCGTT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 907178822 1:52552770-52552792 AAAGAAGTGTCAGGCCCCCAGGG 0: 1
1: 0
2: 2
3: 11
4: 154
907178812_907178823 10 Left 907178812 1:52552738-52552760 CCCTGGGACACCCGAAGCCCGTT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 907178823 1:52552771-52552793 AAGAAGTGTCAGGCCCCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 165
907178812_907178820 0 Left 907178812 1:52552738-52552760 CCCTGGGACACCCGAAGCCCGTT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 907178820 1:52552761-52552783 CCAGGAAAGAAAGAAGTGTCAGG 0: 1
1: 1
2: 4
3: 46
4: 445
907178812_907178825 14 Left 907178812 1:52552738-52552760 CCCTGGGACACCCGAAGCCCGTT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 907178825 1:52552775-52552797 AGTGTCAGGCCCCCAGGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 257
907178812_907178830 30 Left 907178812 1:52552738-52552760 CCCTGGGACACCCGAAGCCCGTT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 907178830 1:52552791-52552813 GGGGCGGCTGAGACGCTCTCAGG 0: 1
1: 0
2: 1
3: 8
4: 130
907178812_907178821 8 Left 907178812 1:52552738-52552760 CCCTGGGACACCCGAAGCCCGTT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 907178821 1:52552769-52552791 GAAAGAAGTGTCAGGCCCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 150
907178812_907178824 11 Left 907178812 1:52552738-52552760 CCCTGGGACACCCGAAGCCCGTT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 907178824 1:52552772-52552794 AGAAGTGTCAGGCCCCCAGGGGG 0: 1
1: 0
2: 1
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907178812 Original CRISPR AACGGGCTTCGGGTGTCCCA GGG (reversed) Intronic
900381377 1:2385693-2385715 AACAGGCCCGGGGTGTCCCATGG + Intronic
901319374 1:8330258-8330280 AACGGGCTTCGGGAGGGCCCTGG + Exonic
901636212 1:10671472-10671494 AAGGGGCTTCGGGTGAGCCTAGG + Intronic
901940291 1:12656710-12656732 AAGGGGCTTCTGTTTTCCCAAGG - Intronic
903446170 1:23424215-23424237 AAAGGACTTTGGGAGTCCCAGGG - Intronic
904114497 1:28151565-28151587 AAAGGGCTCCGGGTTGCCCAGGG + Intronic
907178812 1:52552738-52552760 AACGGGCTTCGGGTGTCCCAGGG - Intronic
1077483132 11:2825915-2825937 AAGGGGCTCCGGGTGGCCCTGGG - Intronic
1083936312 11:65871857-65871879 AACGGGCTGCTGGGCTCCCACGG + Intronic
1084847277 11:71910565-71910587 CACGGCATTCGGGTGTGCCAAGG + Intronic
1096981510 12:55730185-55730207 AATGGGCTTGGTGTGTCCCGCGG - Intergenic
1103936505 12:124480250-124480272 AAGGAGCTTAGGGTGCCCCAGGG + Intronic
1104292750 12:127484467-127484489 CACGGCATTCGGGTGTGCCAAGG + Intergenic
1121479654 14:94254627-94254649 AATGGGATTCAGGTGTCTCAAGG + Intronic
1121570091 14:94940809-94940831 AAAGGGGTTGGGGTGTCCCCAGG + Intergenic
1137614447 16:49838549-49838571 ATCGGGGTTCCGGTGCCCCAGGG + Intronic
1139850546 16:69949557-69949579 AACGGGCTTAGTGTGTCTAAGGG - Intergenic
1139879530 16:70172469-70172491 AACGGGCTTAGTGTGTCTAAGGG - Intergenic
1140372994 16:74423079-74423101 AACGGGCTTAGTGTGTCTAAGGG + Intergenic
1145370479 17:22302946-22302968 AAGGGGCTGCGGGGGTCCCAGGG - Intergenic
1145378986 17:22376800-22376822 AGGGGGCCACGGGTGTCCCAGGG - Intergenic
1145379464 17:22379170-22379192 AGGGGGCCACGGGTGTCCCAGGG - Intergenic
1145379943 17:22381540-22381562 AGGGGGCCACGGGTGTCCCAGGG - Intergenic
1145380423 17:22383915-22383937 AGGGGGCCACGGGTGTCCCAGGG - Intergenic
1145380901 17:22386262-22386284 AGGGGGCCACGGGTGTCCCAGGG - Intergenic
1145381381 17:22388637-22388659 AGGGGGCCACGGGTGTCCCAGGG - Intergenic
1145382114 17:22392411-22392433 AGGGGGCCACGGGTGTCCCAGGG - Intergenic
1145382589 17:22394776-22394798 AGGGGGCCACGGGTGTCCCAGGG - Intergenic
1145382869 17:22396139-22396161 AGGGGGCCACGGGTGTCCCAGGG - Intergenic
1145383442 17:22398962-22398984 AGGGGGCCACGGGTGTCCCAGGG - Intergenic
1145383956 17:22401430-22401452 AGGGGGCCACGGGTGTCCCAGGG - Intergenic
1145384394 17:22403632-22403654 AGGGGGCCACGGGTGTCCCAGGG - Intergenic
1145384713 17:22405094-22405116 AGGGGGCCACGGGTGTCCCAGGG - Intergenic
1145385498 17:22409167-22409189 AAGGGGCCGCGGGTGTCCCCGGG - Intergenic
1147312490 17:39603832-39603854 AATGCACTTCGGGTGTCCGACGG + Intronic
1149354377 17:55824820-55824842 ACCGTGCTTTGGGTGTACCAAGG - Intronic
1152220655 17:79063405-79063427 ACCGGGCCTCGGGAGTCACATGG + Intergenic
1152477480 17:80527469-80527491 GCCGGGCTTGGGGTGGCCCAGGG + Intergenic
1154239275 18:12637686-12637708 AATGGGCTTGGCGTGCCCCATGG - Intronic
1159764691 18:72474177-72474199 AAAGGGCTTTGAGTGTCCTAAGG - Intergenic
1162753679 19:12844269-12844291 AAGGGACTTTGGGTGTTCCAAGG - Intronic
925230947 2:2233378-2233400 AACGGGCTGCGGGAGCCCTAGGG + Intronic
929366630 2:41166078-41166100 AGCTGGCTTTGGGAGTCCCAGGG - Intergenic
929564687 2:42977009-42977031 ATCGGAGTTCAGGTGTCCCAGGG - Intergenic
933346116 2:81087819-81087841 AACAGCCATCTGGTGTCCCAGGG + Intergenic
934026561 2:88006050-88006072 AAGGGGCAGAGGGTGTCCCATGG - Intergenic
936526295 2:113243946-113243968 GATGGGCTTTGTGTGTCCCAGGG + Intronic
947995158 2:234521325-234521347 ATCGGGCCTTAGGTGTCCCATGG + Intergenic
1172706485 20:36886005-36886027 AATGGGCTTTGGGTGTTCCAGGG + Intronic
1175171222 20:57082719-57082741 AAGGGGCTCCGGCTGGCCCAAGG + Intergenic
1175793090 20:61754503-61754525 ACAGGGCTTGGGGTGTCCCTGGG + Intronic
1175926945 20:62475770-62475792 ACCGGGCTTCGGAGGTCCCCGGG + Intronic
957044567 3:75363831-75363853 CACGGCATTCGGGTGTGCCAAGG - Intergenic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
971189477 4:24413641-24413663 AACGGTCTTCTTGTTTCCCATGG - Intergenic
979480996 4:121217303-121217325 AACTGGCTTCGTGTTTCCCATGG - Intronic
985577247 5:679112-679134 AGAGGGCTTCGTGAGTCCCAGGG - Intronic
985592162 5:771162-771184 AGAGGGCTTCGTGAGTCCCAGGG - Intergenic
991682359 5:69151746-69151768 ACTGGGCTTGGGGTGTCCCCTGG - Intergenic
999196814 5:149787112-149787134 AACGGCCTCAGGGTTTCCCATGG + Intronic
1006994678 6:38247631-38247653 AATGAACTTTGGGTGTCCCAGGG + Intronic
1016086958 6:139926257-139926279 AATGGGCTTCGGGGATCCCTAGG - Intergenic
1041503523 8:58567112-58567134 AAAGGGGTTGGGGTGCCCCAAGG - Intronic
1048499014 8:134959110-134959132 AACTGGGTTCAGGTGACCCATGG - Intergenic
1049195583 8:141313927-141313949 AATGGGCTTCTGGGGTCCCACGG + Intergenic
1058241002 9:102559418-102559440 AACTGGCTTAGAGTCTCCCATGG - Intergenic
1062686739 9:137817536-137817558 ACCAGGCTTGGGGTGACCCAGGG - Intronic
1203777598 EBV:82334-82356 AATGGGCTGCGGGTGCCCCATGG - Intergenic
1200154805 X:153969764-153969786 AACGGGCTTTGGGTTTTGCAGGG + Intronic
1201781641 Y:17729543-17729565 AACGTGCCTCAGGTGTCCCCAGG + Intergenic
1201819912 Y:18176447-18176469 AACGTGCCTCAGGTGTCCCCAGG - Intergenic