ID: 907178817

View in Genome Browser
Species Human (GRCh38)
Location 1:52552755-52552777
Sequence ACTTCTTTCTTTCCTGGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 359}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907178817_907178830 13 Left 907178817 1:52552755-52552777 CCCGTTCCAGGAAAGAAAGAAGT 0: 1
1: 0
2: 1
3: 47
4: 359
Right 907178830 1:52552791-52552813 GGGGCGGCTGAGACGCTCTCAGG 0: 1
1: 0
2: 1
3: 8
4: 130
907178817_907178824 -6 Left 907178817 1:52552755-52552777 CCCGTTCCAGGAAAGAAAGAAGT 0: 1
1: 0
2: 1
3: 47
4: 359
Right 907178824 1:52552772-52552794 AGAAGTGTCAGGCCCCCAGGGGG 0: 1
1: 0
2: 1
3: 16
4: 162
907178817_907178825 -3 Left 907178817 1:52552755-52552777 CCCGTTCCAGGAAAGAAAGAAGT 0: 1
1: 0
2: 1
3: 47
4: 359
Right 907178825 1:52552775-52552797 AGTGTCAGGCCCCCAGGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 257
907178817_907178823 -7 Left 907178817 1:52552755-52552777 CCCGTTCCAGGAAAGAAAGAAGT 0: 1
1: 0
2: 1
3: 47
4: 359
Right 907178823 1:52552771-52552793 AAGAAGTGTCAGGCCCCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 165
907178817_907178821 -9 Left 907178817 1:52552755-52552777 CCCGTTCCAGGAAAGAAAGAAGT 0: 1
1: 0
2: 1
3: 47
4: 359
Right 907178821 1:52552769-52552791 GAAAGAAGTGTCAGGCCCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 150
907178817_907178822 -8 Left 907178817 1:52552755-52552777 CCCGTTCCAGGAAAGAAAGAAGT 0: 1
1: 0
2: 1
3: 47
4: 359
Right 907178822 1:52552770-52552792 AAAGAAGTGTCAGGCCCCCAGGG 0: 1
1: 0
2: 2
3: 11
4: 154
907178817_907178831 18 Left 907178817 1:52552755-52552777 CCCGTTCCAGGAAAGAAAGAAGT 0: 1
1: 0
2: 1
3: 47
4: 359
Right 907178831 1:52552796-52552818 GGCTGAGACGCTCTCAGGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907178817 Original CRISPR ACTTCTTTCTTTCCTGGAAC GGG (reversed) Intronic
900099539 1:955705-955727 CCTTCTTTCCTTCCTGAAAAGGG - Intronic
900286043 1:1901098-1901120 CCTTCTTTCTTTCTTGAGACAGG - Intergenic
902206991 1:14875863-14875885 ATTTCCTGCTTTCCTGGAAGGGG + Intronic
902811021 1:18887968-18887990 ACTTCTTTCCTTCCTAGGGCTGG + Intronic
904012579 1:27398339-27398361 ATCTCTTTCTTTCCTGGATGAGG + Intergenic
905501503 1:38443114-38443136 TCTTTTTTCCTTCCTGGAATGGG + Intergenic
906061612 1:42952774-42952796 GTTTGTTTCTTTCCTTGAACTGG + Intronic
906823746 1:48956300-48956322 GCTTCTGTCTTTCCAGGAAAGGG - Intronic
906873076 1:49505737-49505759 ACTTTTTTCTTTTCTGTATCTGG + Intronic
907178817 1:52552755-52552777 ACTTCTTTCTTTCCTGGAACGGG - Intronic
907996501 1:59638122-59638144 CCTGCTTACTTTCCTGGATCTGG + Intronic
908038639 1:60083516-60083538 ACTTCTCTCTTTTCAGGCACAGG - Intergenic
908520098 1:64933240-64933262 TCTTTTTTCTTCCCTGGAAAGGG - Intronic
908760347 1:67505932-67505954 TCTTGTCTCTTTCCTTGAACAGG - Intergenic
908773448 1:67617030-67617052 ACTTATTTATTTTTTGGAACAGG + Intergenic
913452903 1:119004190-119004212 ACTTCTGTCCTTTCTGGAGCTGG + Intergenic
914225889 1:145719320-145719342 TCTCCTTTCTCTCCTGCAACTGG - Intergenic
915040832 1:152967103-152967125 TCTTCTTTCATTCCTGGAAATGG + Intergenic
915180896 1:154058784-154058806 ACATCTTGCTTTCTTTGAACTGG + Intronic
915877619 1:159628562-159628584 ACTTCTTTGTTTCATGGGTCAGG - Intergenic
915922236 1:159985071-159985093 ACTTCCTTCTGTCCTGGTGCAGG - Intergenic
917195292 1:172457753-172457775 ACTTCTATCATTCCTGGACAAGG - Intronic
917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG + Intronic
918214639 1:182382824-182382846 ATTTCTTTATTTCCTAAAACAGG - Exonic
919956229 1:202419505-202419527 ACTTTTTTTTTTCCTAGAACTGG + Intronic
920240310 1:204542656-204542678 GGTTCTTTCTTTCTTAGAACAGG + Intronic
920767170 1:208844376-208844398 ATTTCTTTCTTGTCTGAAACTGG - Intergenic
920784655 1:209029357-209029379 TCTTTTTTCTTTCCTGAGACAGG - Intergenic
921619003 1:217306027-217306049 TCTTCTCTCTTTCCTGGAGCTGG + Intergenic
921677013 1:217987560-217987582 TATTTTTCCTTTCCTGGAACTGG + Intergenic
922824035 1:228504686-228504708 ATTTATTTCTTTCCTTGATCTGG - Intergenic
922961075 1:229646011-229646033 ACTTCTGTCTTTACAGGAAGAGG - Intronic
923980614 1:239318251-239318273 TCTTCTTTATTTCCTTGAACAGG + Intergenic
924795032 1:247286858-247286880 GCCTTTTTCGTTCCTGGAACGGG - Intergenic
1062838164 10:650069-650091 GCTATTTTCTCTCCTGGAACTGG - Exonic
1063504484 10:6583551-6583573 ACACCTTTGTTTCCTGGAAGAGG + Intergenic
1065356538 10:24847064-24847086 CCTTCTTCCCTTCCTGAAACTGG + Intergenic
1065883385 10:30057559-30057581 ACTTCTTTTTTCCCCGAAACAGG + Intronic
1066309153 10:34178704-34178726 CTTTCTTTCTTTCTTGGAGCTGG - Intronic
1066447491 10:35497096-35497118 AATTTTTTCTTTCCTGGGAGAGG - Intronic
1067402352 10:45988379-45988401 ACACCTTTCTGTCTTGGAACTGG - Intronic
1068291145 10:55002770-55002792 ACTACTTTTATCCCTGGAACTGG - Intronic
1068354604 10:55895246-55895268 ACTTTTTTTTTTCCTGTAAACGG + Intergenic
1068823528 10:61407103-61407125 AATTCTTTCTCTCCTGTAACAGG + Exonic
1071938907 10:90564964-90564986 ACTTCTTTCAGTTCTTGAACAGG + Intergenic
1073104824 10:101026555-101026577 CCTTCTTGCTTTTCTGTAACTGG - Intronic
1073427972 10:103467650-103467672 ACTTCTTTCTCCCATGGGACAGG - Intergenic
1073974278 10:109083035-109083057 TCTTCTTTCTTTCCTCAAATTGG - Intergenic
1074156939 10:110807683-110807705 ACGTCGGTCTTTCCTGGATCTGG + Intronic
1078004143 11:7519731-7519753 GCCTTTTTCATTCCTGGAACGGG + Intronic
1078014072 11:7597538-7597560 ATTGCTTTATTTCCTGGAACAGG + Exonic
1078285417 11:9949041-9949063 CCTTCTTTCTTTCCTTGTCCAGG - Intronic
1078936470 11:15955712-15955734 ACTTCTTCTGTTCCTGGAATAGG + Intergenic
1079854732 11:25588289-25588311 AGTTCTTTGTTTCCTGGGAATGG - Intergenic
1080634125 11:34108464-34108486 CTTTCTTTATTTCCTGGAAGTGG + Intronic
1081479534 11:43472335-43472357 TCTTTTTTCTTTTCTGAAACAGG - Intronic
1083185489 11:61015563-61015585 TTTTCTTTCTTTTCTGGGACAGG - Intronic
1084078045 11:66797508-66797530 ACTTTTTTTTTTCCTGAGACAGG + Intronic
1084854671 11:71975092-71975114 ACTGCTTTCCCTCCTGGAACCGG + Intronic
1086989783 11:93290322-93290344 AGTTGTTTCTTCCCTGGAACCGG + Intergenic
1087122738 11:94591765-94591787 CAGTCTTTCTTTCCTGGGACAGG - Intronic
1087272015 11:96121399-96121421 AATTCTTTCCTTCCTGTTACTGG - Intronic
1087587755 11:100143574-100143596 CCTTCCTTTTTTCCCGGAACTGG - Intronic
1087886340 11:103487485-103487507 TTTTCTTTCTTTGCTGGAGCTGG + Intergenic
1088400044 11:109413556-109413578 TTTTTTTTTTTTCCTGGAACAGG - Intergenic
1088606058 11:111533724-111533746 ACTTTTTTCTTTCTTTAAACAGG + Exonic
1090576135 11:128105856-128105878 AGTTCTTTCTTTGCTAAAACTGG + Intergenic
1091443018 12:526392-526414 TCTTCTTTCTGGCCTGGGACAGG - Intronic
1092711957 12:11348351-11348373 ACATCTTTCTCCCCTGGAACTGG - Intergenic
1092756374 12:11767020-11767042 ATTTTTTTCTTTAATGGAACAGG + Intronic
1093525798 12:20102443-20102465 ACTTCATTCTGTCCTGGAGCGGG + Intergenic
1093680312 12:21994683-21994705 AATTCTTTCTTTCCAGGAGTGGG + Intergenic
1093686624 12:22062876-22062898 TCTCATTTCTTTCCTGGAATTGG - Intronic
1094232356 12:28121181-28121203 TTTTCTTTCTTTCTTCGAACAGG + Intergenic
1094331651 12:29300859-29300881 CCTTCTTTATTTCCCAGAACTGG - Intronic
1094444811 12:30518185-30518207 ACTTCTTTCTTTTTTGAGACAGG - Intergenic
1094585390 12:31772931-31772953 TCTTTTTTCCTGCCTGGAACCGG - Intergenic
1095221741 12:39624292-39624314 ACTTCTTTCCTTCCAGTCACAGG - Intergenic
1096329350 12:50696494-50696516 ACCTCTTTCTATCATGTAACTGG + Intronic
1096493306 12:52024684-52024706 TCTTCTTTCTTTCTTGTGACAGG - Intronic
1097026883 12:56063305-56063327 TCTTCTTTTTCACCTGGAACAGG - Intergenic
1098435688 12:70466310-70466332 ACATCTTTCCAGCCTGGAACGGG - Intergenic
1099651607 12:85435271-85435293 TCTTCTTTCTCTTCTGGAGCTGG - Intergenic
1100084580 12:90893637-90893659 CCTTTTTTCTTTCCTGGATTTGG - Intergenic
1100413343 12:94345607-94345629 CCATCTTTCTGTCTTGGAACTGG + Intronic
1101619482 12:106370951-106370973 ACTTCTTTCTTTCTTGTATATGG + Intronic
1101896539 12:108761340-108761362 ACTTCTTTCCTTCCTGCATTTGG - Intergenic
1102897113 12:116607259-116607281 ACGTCTCTCTTGCCTGGAGCTGG - Intergenic
1104093986 12:125539278-125539300 CCTCCTTTCTTTTCTGGAATGGG + Intronic
1106202669 13:27553981-27554003 AGTTCTTTTCTTCCTGAAACAGG - Intronic
1106315233 13:28587484-28587506 TCTTCTTTCTTTTTTGAAACAGG + Intergenic
1106790256 13:33148188-33148210 AGTTATTTCTTTCATGGACCAGG - Intronic
1107073197 13:36294297-36294319 CCTTCTGTTTTTCCTGTAACTGG + Intronic
1107188683 13:37553012-37553034 ACCTCTCTCATTCCTGAAACTGG - Intergenic
1107257269 13:38442997-38443019 AATTCTTTCTTTCATGGATCAGG + Intergenic
1107505579 13:41029780-41029802 AATTCTCTCTTTCTTGGAGCTGG + Intronic
1107630455 13:42337378-42337400 AGATCTTTCTTTCCTGGAAATGG - Intergenic
1108018861 13:46104725-46104747 TCTTTTTTCTTTCCTGGCTCTGG - Intronic
1108286391 13:48913311-48913333 ACTTGTTTCTTTTCTGGTCCAGG + Intergenic
1108312727 13:49211792-49211814 ACCTGGTTCTTTCCTGGGACAGG - Intergenic
1108482584 13:50889785-50889807 ACTTCTTTATTTCATATAACTGG + Intergenic
1108695536 13:52899467-52899489 GCATCTTTGTTTCGTGGAACTGG - Intergenic
1109785249 13:67165622-67165644 ACTTTTTTTTTTCCTGGAGGGGG - Intronic
1110711267 13:78653565-78653587 AGTTCTTTCTTCCTTGGAGCAGG + Intronic
1110806936 13:79765586-79765608 AATGCCTTCTTTCCTGGACCTGG - Intergenic
1112426071 13:99302441-99302463 ATTTCTTTCTTCCCTGGAGCAGG - Intronic
1113225048 13:108150464-108150486 ACTTCTTTCTCTTTTGGAATTGG + Intergenic
1113813020 13:113153684-113153706 GCTTGTTTTTCTCCTGGAACTGG - Intergenic
1114733704 14:25021450-25021472 TCTTCTATTTTTCCTGTAACGGG - Intronic
1114876978 14:26732375-26732397 ACTTCTTTCTTTCTTGAGACAGG + Intergenic
1115314610 14:32012994-32013016 ACCTCTTTCTCTGCTGCAACTGG - Intronic
1115361495 14:32508451-32508473 TCTTCTGTCTTTCCTGCAACCGG - Intronic
1115831672 14:37349469-37349491 ACTTCATTCATTCCTGCTACAGG + Intronic
1116999641 14:51359378-51359400 TCTTCTATCTTTCCTGCAAATGG - Intergenic
1117808718 14:59522265-59522287 ATTTGTTTCTTTCTTGAAACTGG - Intronic
1118617131 14:67581648-67581670 ACTTCTGTATTTCCTGGAATTGG - Intronic
1118743547 14:68758290-68758312 TATTCTTTCTTTCATGGACCCGG - Intergenic
1118825096 14:69372668-69372690 ACTTCTTTCCTTCTTAGAAAAGG - Intergenic
1119707391 14:76791924-76791946 CCTTCTTTCTTTCCTGATATTGG - Intronic
1120966133 14:90169355-90169377 AGTACTTTATTTCCTGGATCAGG + Intronic
1121183441 14:91946925-91946947 TCCTCTTTCTTTTCTGGAAAGGG - Intronic
1122868272 14:104620271-104620293 ACTTCTTTTTTTCCAGGAGTGGG - Intergenic
1124412282 15:29446383-29446405 AGGTTTTTTTTTCCTGGAACAGG + Intronic
1125153818 15:36563598-36563620 ACGTCTTACATGCCTGGAACAGG - Intergenic
1125868159 15:43074265-43074287 ACTTCTTTATTTCCTTGACTGGG + Intronic
1126733987 15:51713323-51713345 GCTTCTGTTTTTCCTGGAAGAGG - Exonic
1127167405 15:56260783-56260805 TTTTCTTTCTTTCCTGAAAGAGG + Intronic
1130127430 15:81105421-81105443 TCTTCTTTCTTTTCTGAGACGGG + Intronic
1130864292 15:87918967-87918989 ACTGCTTTTTTTCCTGGACTGGG - Intronic
1130889051 15:88117882-88117904 TCTGCTTCCTTCCCTGGAACAGG + Intronic
1131596477 15:93803303-93803325 AGTTCTTTCTGTCTTGGAAAAGG + Intergenic
1131619541 15:94053036-94053058 TCTTCTTTCTTTTTTGGAAGTGG - Intergenic
1131678291 15:94694364-94694386 ACATCATTTGTTCCTGGAACAGG + Intergenic
1131918587 15:97298259-97298281 CCTTCTTTGTTTCCTGTAACAGG + Intergenic
1133167257 16:3957109-3957131 TCTTCGTTCTTTCCTTGAAAAGG + Intronic
1133385507 16:5366726-5366748 TCTTATTTCATTCCTGTAACAGG + Intergenic
1134791040 16:16989518-16989540 ATTTCCTTCTCTCCTGGAACAGG - Intergenic
1134829921 16:17314618-17314640 AGGCCTTTCTTTCCTGGAATGGG - Intronic
1135274453 16:21099841-21099863 ACATATTTATTTCCTTGAACAGG - Intronic
1135618495 16:23932801-23932823 ACTTATTCCTTTGCTTGAACTGG + Intronic
1137800157 16:51255591-51255613 ATCTCCTTATTTCCTGGAACAGG + Intergenic
1137968884 16:52964063-52964085 GCTTCTTTGTTTGCTGGAATGGG + Intergenic
1138880516 16:61008664-61008686 ACTTGTTGCTTTCCTGGAATGGG + Intergenic
1140696743 16:77542127-77542149 ACTTCTTTCTTTACAGGAAAGGG + Intergenic
1141084126 16:81079264-81079286 TCCTCTTTCTTCCCTGCAACAGG - Intergenic
1141936259 16:87240691-87240713 ACATCTGTCTTTCCCGGTACCGG - Intronic
1143080575 17:4378250-4378272 ACTTCTTTCCTTCCTCCAAAAGG + Intergenic
1143369515 17:6429639-6429661 ACTTATTTATGTCCTGGCACTGG + Intronic
1144466281 17:15500040-15500062 AGCTCCTTCTTTCCTGGAGCTGG - Intronic
1146082302 17:29791411-29791433 TCTTCTTTGTTACCTGGAACTGG + Intronic
1146431315 17:32797979-32798001 ATTTCTTTCTTACCTGTAACTGG - Intronic
1149303145 17:55324066-55324088 ACTTCTTTCTCTTCAGGAAGTGG + Exonic
1149924341 17:60688107-60688129 ACTTCCTTTTTTCCTGTATCAGG - Intronic
1151410558 17:73924689-73924711 ACTTCTTTATGTCCAGGAAAAGG - Intergenic
1151997631 17:77620248-77620270 ACCATTCTCTTTCCTGGAACAGG + Intergenic
1152105331 17:78325372-78325394 ACTTCTTTATTTCAGGGAAGAGG + Intergenic
1153111812 18:1599381-1599403 TCTCCTTTCTGTCCTGGAACAGG + Intergenic
1153146509 18:2039012-2039034 CCTTCTATCTTACCTGGCACTGG - Intergenic
1153152200 18:2108205-2108227 ATTACATTCTTTCCTGGAATGGG + Intergenic
1153654742 18:7272659-7272681 GCTACTTTCTTTCCTAGAGCAGG + Intergenic
1153873992 18:9349134-9349156 AATTTTTTTTTTCCTGAAACAGG - Intronic
1153879943 18:9413161-9413183 ACTTCTTTCTTTTCTTAATCTGG + Intergenic
1154524796 18:15274665-15274687 AATTCTTTCTTTCATGTACCTGG + Intergenic
1156113331 18:33755100-33755122 ACCAGTTACTTTCCTGGAACAGG + Intergenic
1156916047 18:42465255-42465277 ACTCCTTTCCTTCCTGGGAATGG + Intergenic
1158066809 18:53420398-53420420 ACTTCTTTATTTCAGGAAACAGG + Intronic
1158308654 18:56135052-56135074 ACTTTATTTTTTCCTTGAACAGG + Intergenic
1159186324 18:64979811-64979833 AATTCTTACTTTTCTGGAAATGG - Intergenic
1159583293 18:70258462-70258484 ATTACTTTGTTTCCTGGAAAGGG + Intergenic
1161265321 19:3360986-3361008 AGTTCCTTTTTTCCTGTAACTGG + Intronic
1163452743 19:17388417-17388439 TCTTCTTTCTTTTCTTGAAGGGG + Intergenic
1163939642 19:20479981-20480003 GCCTTTTTCATTCCTGGAACGGG + Intergenic
1164790831 19:30979027-30979049 ACTTCTCCCTTTCCTGAAGCTGG - Intergenic
1165379569 19:35468766-35468788 ACATCTTGCTTCCCTGGAAGGGG - Intergenic
1165739987 19:38199265-38199287 ACTTCCCACTGTCCTGGAACTGG - Intronic
1167089865 19:47336511-47336533 TTTTCTTTCTTTCTTGGGACAGG + Intronic
1167497647 19:49828950-49828972 TCTTCTCTCTTTCCTGGTAGTGG + Exonic
925965649 2:9062892-9062914 TTTTCTTTCTTTCTTGAAACAGG - Intergenic
926592505 2:14754626-14754648 ATTTCTTTCTCTCATGGATCAGG - Intergenic
926671886 2:15584318-15584340 TCTTCTTTCTTTGCAGGAAGGGG - Intergenic
926789469 2:16555773-16555795 ACTTCTTTCTTCACTAGACCAGG + Intronic
928631485 2:33197677-33197699 ACATGTTTGTTTCCAGGAACTGG - Intronic
929428401 2:41867346-41867368 ACATCTTTCTTGCCTGGATCTGG - Intergenic
930118363 2:47739427-47739449 AGTTAATTCTTTCCTGGATCAGG - Intronic
931433245 2:62226471-62226493 TCTTGTTTCTTGCCTAGAACAGG + Intergenic
932988964 2:76763167-76763189 ACTGTTTTTTTTCCTGGAATAGG - Intronic
935113940 2:100118095-100118117 ATTTCTATCTTTTCTGGAGCAGG + Intronic
935350953 2:102151564-102151586 ACTGCTTTCTTCCCTGGCCCAGG + Intronic
935523235 2:104135546-104135568 CCTTCTCTCTTTCCTGGCAGTGG - Intergenic
935523343 2:104136957-104136979 TCTTCTCTCTTTCCTGGCAGTGG - Intergenic
936735049 2:115430879-115430901 ACTTCTTTTTTTCTTGGAGAGGG + Intronic
937131257 2:119515582-119515604 TTCTCTCTCTTTCCTGGAACTGG + Intronic
938538927 2:132269298-132269320 ACTTCTCACTTTCGTGGAAGGGG + Intergenic
938851600 2:135266429-135266451 AGTTAATTCTTTCCTGGATCAGG - Intronic
939327114 2:140706827-140706849 ACTTTTTTTTTTCCTGTCACAGG + Intronic
939601372 2:144195225-144195247 AATTCCTTCGTTTCTGGAACAGG + Intronic
940376840 2:152967262-152967284 GCTTCATTCTTTTCTGGAAATGG - Intergenic
940717829 2:157247671-157247693 ATTTTTATCTGTCCTGGAACTGG + Intergenic
941966824 2:171308962-171308984 TTTTCTCTCTCTCCTGGAACTGG - Intergenic
942612363 2:177755521-177755543 ACCTCTTTCCTTTCTAGAACTGG + Intronic
942756246 2:179344683-179344705 ATCTCTTTCTTTCCTGTAAGCGG - Intergenic
942797221 2:179835688-179835710 AGCTTGTTCTTTCCTGGAACTGG + Intronic
943022270 2:182589572-182589594 AATGCTTTCTTTCCTGGATGAGG - Intergenic
943481555 2:188426419-188426441 ACTTACTTCTTTCCTGGATCAGG + Intronic
944402573 2:199345102-199345124 TCTTCTCTCTTTCCTGGGGCTGG + Intronic
944814471 2:203361460-203361482 ACTTTTTTCTTTTCTGAGACAGG - Intronic
945435573 2:209813558-209813580 TCTTCTTTCTGCCATGGAACAGG + Exonic
946045728 2:216819434-216819456 CCTCCCTTCTTTCCTGGAATGGG + Intergenic
946776115 2:223142927-223142949 TCTCCTTTCTTTTCTGAAACTGG - Intronic
947360309 2:229339686-229339708 AGTTGTTTTCTTCCTGGAACTGG + Intergenic
1168961777 20:1875033-1875055 ACTTCTTCCCTTCCTAGAAGAGG - Intergenic
1170554911 20:17507122-17507144 CATTCTTTTTGTCCTGGAACTGG + Intronic
1170858385 20:20078885-20078907 ACCTCTTTCATTCCTGATACTGG - Intronic
1170870764 20:20203963-20203985 ACTGCTTCCTTTCCAGGAATGGG + Intronic
1171126260 20:22604248-22604270 ACTTCTTTATTTCCTATAATTGG - Intergenic
1171236857 20:23534527-23534549 ACCTCATTCTTTCCAGAAACAGG - Intergenic
1171867838 20:30501209-30501231 ACTTCTCACTTTCATGGAAGGGG + Intergenic
1172566010 20:35931015-35931037 ACTTCCTCATTTCCTGGAACTGG - Intronic
1173206902 20:41002361-41002383 CCTTCTTTCTTTTCCTGAACAGG + Intergenic
1174108488 20:48180493-48180515 ATTTCTTTCTTTCCTATAATTGG + Intergenic
1175081963 20:56428275-56428297 CCTTCTCTCTTTCCTGTCACAGG - Intronic
1176227926 20:64013450-64013472 CCTTCTTTCTTTCTTGAGACAGG + Intronic
1177995550 21:28091697-28091719 ACTCCTTGCTTTTCTGGAAGTGG - Intergenic
1178164949 21:29962827-29962849 CTTTCTTTCTTTCCTAGAAATGG + Intergenic
1178897211 21:36568717-36568739 CCTTCTTTTTTTCTTGGGACAGG - Intronic
1179372254 21:40817315-40817337 GCTTGTTTCTTCTCTGGAACAGG + Intronic
1179462176 21:41543858-41543880 CCTTCCTTCTCTCCTGGAATAGG + Intergenic
1181560165 22:23695389-23695411 ACTTCCTTCCTTCCTCAAACCGG + Intronic
1182156400 22:28077294-28077316 ACTTATTTATTTACTGAAACAGG + Intronic
1183465546 22:37978454-37978476 AGTTTTTCCTTTCCTTGAACTGG - Intronic
1183635424 22:39059499-39059521 ACTTCTTTCCTTCCTGGGCATGG - Intronic
1185052635 22:48561892-48561914 AGTCCTTTCTGTCCTGGGACTGG + Intronic
949312074 3:2711188-2711210 ACTTATTTCTTTTCTGTATCCGG - Intronic
949599113 3:5579338-5579360 TCCTCTCTCTTTCTTGGAACTGG + Intergenic
949666826 3:6348576-6348598 AATTCTTTCTCTTCTGGAGCTGG - Intergenic
950090238 3:10289866-10289888 ACTCCTTTCTCTGCTGGAAGGGG + Exonic
950287372 3:11755404-11755426 TCTTCTTTCTCTCCTGCAACAGG - Intergenic
951568272 3:24035050-24035072 ACCTTTATCTTTTCTGGAACAGG - Intergenic
952081304 3:29760624-29760646 AATTCTTTTCTTCCTGGAAATGG + Intronic
952267614 3:31801679-31801701 GCTTCTTTCTTTCCTTGCAATGG - Intronic
952357037 3:32593987-32594009 ATTTCTTTCCCTCCTGGCACAGG + Intergenic
952420672 3:33128271-33128293 ACCTTTTTTTTTCCTGGTACAGG + Intronic
952569360 3:34695749-34695771 ACTACTGTAGTTCCTGGAACAGG - Intergenic
953345692 3:42173431-42173453 GCTTCCTTATTTCTTGGAACAGG + Intronic
953656328 3:44857706-44857728 ACTCCTTTCCTTCCTGGACATGG - Intronic
953796997 3:45993532-45993554 ACTTCTTATTTTCTTGAAACTGG + Intronic
954435617 3:50494273-50494295 AGTTGTTTGTTTGCTGGAACTGG + Intronic
955158074 3:56436912-56436934 ACTTCTATGATTCCTGGATCTGG - Intronic
955168623 3:56540795-56540817 ACTTCTTACCTTCCAGGTACAGG + Intergenic
955418306 3:58713282-58713304 ATTGCTCTCTTTTCTGGAACTGG - Intergenic
955710031 3:61769011-61769033 TCTTCTTTATTTCTTGGAAATGG + Intronic
955784159 3:62518668-62518690 GCTTCTTCCTTACCTGGGACAGG + Intronic
955808891 3:62765373-62765395 GCTGCTTTCTTTTCTGGAGCTGG - Intronic
956543409 3:70370743-70370765 ACTACTTTCTTTCATTCAACAGG + Intergenic
957449403 3:80358170-80358192 ACTTCTTTCTTTGCTGTAAGGGG + Intergenic
957963833 3:87295792-87295814 ATCTCTTTATTTCCTAGAACAGG + Intergenic
959256120 3:104016879-104016901 TCTACTTTTTTTCCTGGAAATGG - Intergenic
959671930 3:108988121-108988143 ACTCCTTTATTTCCTGGGAGGGG - Intronic
961323055 3:126091666-126091688 AGTTAATTCTTTCCTGGATCAGG + Intronic
961582283 3:127892592-127892614 ACTCCTTTCTTTCCTTGAAAAGG - Intergenic
962470121 3:135699415-135699437 ATTTCTTTCTTTCTTTGAATCGG + Intergenic
963756420 3:149239279-149239301 AGTTCATTCTCTCCTGGATCAGG + Intergenic
964848094 3:161065530-161065552 TCCTCTTTCTTTCCTTCAACTGG - Exonic
965439136 3:168691471-168691493 ACTTCTCACTTTCCAGGAACTGG - Intergenic
966175323 3:177132295-177132317 ATATCTTTCTTTCTTGGATCAGG - Intronic
967104214 3:186242340-186242362 ACTTTTTTTTTTCTTGGAAATGG + Intronic
967464053 3:189781600-189781622 ATTTTTTTTTTTCCTGGAAAGGG + Intronic
967657906 3:192073277-192073299 ACTCCTTTCCTTCCTAGAAATGG - Intergenic
968853063 4:3096740-3096762 AAATCTTTCTTTCCTAAAACAGG - Intronic
968971109 4:3795157-3795179 ACCTATTTCATTCCTGAAACTGG - Intergenic
969635430 4:8366398-8366420 ATTACTTTCTTTTGTGGAACTGG - Exonic
970186469 4:13459785-13459807 ACTTCTTTCTTCCCTAAAATAGG + Intronic
972131111 4:35834385-35834407 ACTTCTTCATTCCCTGTAACAGG + Intergenic
972235408 4:37127430-37127452 ACTTCTTTCATTCATGAAATTGG - Intergenic
974655754 4:64818584-64818606 CATTCTTTCTTTCATGGATCAGG + Intergenic
974665827 4:64960184-64960206 TCTTCTTTCTTTCTTAAAACGGG + Intergenic
975719871 4:77239023-77239045 ACTTCTGGCTTTCCCAGAACGGG + Intronic
976460149 4:85302024-85302046 TCTTTTTTTTTTCCTGGAAAAGG + Intergenic
977591312 4:98830401-98830423 ATTTCATTCTTTCTTGGGACAGG - Intergenic
978001961 4:103567108-103567130 ACTTCTCGTTTCCCTGGAACAGG - Intergenic
978194863 4:105959435-105959457 ACTTCTTTTATTCCTGGGAATGG - Intronic
978752274 4:112263500-112263522 ATTTCTTTTTTTCCTGGAACTGG + Intronic
978759690 4:112343330-112343352 ACTTCTTTCTTTCTTCAAAATGG - Intronic
978834481 4:113132526-113132548 ACTACTTTGTACCCTGGAACTGG + Intronic
979370670 4:119882125-119882147 ACTTTTTTTTTTCCTAGAAAGGG - Intergenic
979482307 4:121234151-121234173 CCTTCTTTCATTCCTAGGACTGG + Intergenic
980605899 4:135088629-135088651 ACTTTTTTCTCTTCTGGAATTGG - Intergenic
981821695 4:148894432-148894454 GCTTCATACTTTCCTGGAGCTGG - Intergenic
982057436 4:151566517-151566539 TCTTCTTGCTTTCCTAGAATAGG + Intronic
983035507 4:162860688-162860710 ACTCATTTCTTTCCTGAAATAGG - Intergenic
983057687 4:163117996-163118018 AATTCTCTTTTTCTTGGAACTGG - Intronic
983497535 4:168460485-168460507 ATTTCTTGCTTTCCAGGATCTGG + Intronic
984115739 4:175679088-175679110 ATTTCTTTCTTGCCTGATACCGG + Intronic
984246173 4:177277668-177277690 ACTTATTTCTTTACTGACACAGG + Intergenic
984370107 4:178852916-178852938 ACTTCTTTCTCTCCTTGGTCTGG - Intergenic
984418043 4:179485839-179485861 ACTTCCTTATTTTCTGGAAATGG - Intergenic
984785991 4:183567707-183567729 AATTCTCTCTTTCCTGGAGCTGG - Intergenic
985112270 4:186557725-186557747 AGTTCTTGCTCTCCTGGGACTGG + Intergenic
985197047 4:187442785-187442807 ACTTCTTTCTCTGCTGCAACTGG + Intergenic
985869561 5:2543284-2543306 ACTCCTTTCTGTCCTGCCACCGG + Intergenic
986554847 5:9000735-9000757 ACTTCTTTCCTTCCTGGGCATGG - Intergenic
988522076 5:31955147-31955169 TCTTCTTTCTTTTTTGGAACAGG + Intronic
988685450 5:33521229-33521251 ACTTCTTTCTTTTTTGAGACAGG + Intergenic
989586103 5:43074921-43074943 GCCTTTTTCATTCCTGGAACGGG + Intronic
990970645 5:61502205-61502227 ACTTCTTTCCTTCCTGCTCCTGG - Intronic
993811239 5:92479187-92479209 CCTTCTTTGTTTCCTGTAACAGG - Intergenic
994088572 5:95786998-95787020 AGTTCTTTCATTCCTGGAAGCGG + Intronic
994102460 5:95908871-95908893 CCTTCTTTCTTTCTGGGAAGGGG + Intronic
994160063 5:96547436-96547458 AATTCTTTCTCTCCTTGAGCTGG - Intronic
995327656 5:110909468-110909490 AATACTTTCTTTTCTGGAAAGGG - Intergenic
995912650 5:117205829-117205851 TTTTCTCTCTTTCCTGCAACGGG - Intergenic
996144016 5:119951212-119951234 AATTATTTCTCTCCTGGAAGTGG + Intergenic
996889703 5:128403700-128403722 ACTCCTTTTTTTTTTGGAACTGG + Intronic
997636988 5:135418250-135418272 ACCTCTTTCATTCCTGGTATTGG + Intergenic
998103968 5:139456775-139456797 ACCTCTTTCTTTCCTGAACCAGG + Intronic
999067998 5:148712624-148712646 ACTTCCTTCTATTCTGGAAAGGG + Intergenic
1000718819 5:164680500-164680522 ACTTAATTCTCTCCTGGATCAGG + Intergenic
1003419980 6:5948559-5948581 ACTTGTTGCTTTCCTGGAGCTGG + Intergenic
1003785595 6:9482787-9482809 AGTTCTAGCTTTCCTAGAACTGG + Intergenic
1003866524 6:10368330-10368352 ACTTCTTTATTGCCTAGAACTGG - Intergenic
1004565739 6:16795550-16795572 TCTTCTTTCATTCCTGGTATTGG - Intergenic
1005386450 6:25290099-25290121 ACTTCTTTTTTTTCTGAGACAGG + Intronic
1006641667 6:35492510-35492532 GCTTCCCTCCTTCCTGGAACAGG + Intronic
1007064398 6:38975358-38975380 AGTTCTTTCTTTCCTGGGGTTGG + Intronic
1008921830 6:56850579-56850601 TTTTCTTTCTTTCTTGGAAATGG - Intronic
1009383369 6:63060016-63060038 ACATCTTTCTCTCCTGGCATTGG - Intergenic
1009464558 6:63953564-63953586 ACTCCTTTCCTTCCTGGACATGG + Intronic
1009472945 6:64050576-64050598 CTTTCTTTCTTTCCTAGTACTGG + Intronic
1009865714 6:69395262-69395284 ACTTATTTATTTCCAAGAACGGG + Intergenic
1010626141 6:78138314-78138336 ACTTCCTTCATTTCTGGCACTGG - Intergenic
1011507203 6:88058631-88058653 ACTTTTTTTTTTCCTGAGACAGG - Intronic
1011860020 6:91742752-91742774 TTTCCTTTCTTTCCTGGAGCTGG - Intergenic
1016190494 6:141259965-141259987 ACTTCATTCTTTTCTGGCTCAGG - Intergenic
1017827371 6:158091912-158091934 TCTTCTTGCTTTCCAGGGACTGG + Intronic
1020714366 7:11651323-11651345 AATTCTTTATTTTCTGAAACTGG - Intronic
1021438897 7:20655111-20655133 CCTTCTTTCATTCCTGATACTGG - Intronic
1022106479 7:27200607-27200629 ACTGTTTTCTTTCCAGGAACCGG + Intergenic
1022455201 7:30552582-30552604 AATTCCTTCTTGCCTGGAAGAGG + Intergenic
1022723760 7:32963042-32963064 AATCCTTCCTTCCCTGGAACGGG - Intronic
1023610649 7:41967210-41967232 ATTTCTGACTTTCCTTGAACTGG + Intronic
1024579478 7:50790402-50790424 ACTTTTTTTTTTCCTGGTAGTGG - Intronic
1026067345 7:67086637-67086659 AATTCCTTCTTGCTTGGAACAGG + Intronic
1026424889 7:70280945-70280967 ACTTCTCTCCTTCATGGACCTGG + Intronic
1026537768 7:71254331-71254353 ACTTAATTCTCTCCTGGATCAGG + Intronic
1026709578 7:72725690-72725712 AATTCCTTCTTGCTTGGAACAGG - Intronic
1028152669 7:87392353-87392375 TCTTATTTCTTTCCTGGAATAGG - Intronic
1028368969 7:90069362-90069384 AGTTAATTCTTTCCTGGATCAGG + Intergenic
1028443509 7:90892054-90892076 ACTTGTTTCTGCCCTGGAAATGG + Intronic
1029453047 7:100653060-100653082 ACTTTTTGTTTTCCTAGAACTGG - Intronic
1030153756 7:106431212-106431234 CCTTATTTATTTCCTGGAACTGG + Intergenic
1030758813 7:113324803-113324825 ACTTCTACCTTTCCTCCAACAGG + Intergenic
1030924378 7:115433367-115433389 GTTTCTGTCTTTCCTGGATCTGG + Intergenic
1030968020 7:116017766-116017788 GCTTCTCTCTTTTCAGGAACAGG + Intronic
1032805458 7:135349689-135349711 TTTTCTTTTTTTCCTTGAACTGG - Intergenic
1032967929 7:137122964-137122986 ACTTCTTTCTAGCCTGGGGCAGG + Intergenic
1034066295 7:148140175-148140197 GCACATTTCTTTCCTGGAACGGG + Intronic
1035143076 7:156783800-156783822 TCTTCTTTCTTTCCTGTTATGGG - Intronic
1035951433 8:4026034-4026056 ACTTATTTATTTGCAGGAACTGG - Intronic
1036680752 8:10871499-10871521 ACCTCTTTGTTGCCTGGAAAGGG - Intergenic
1037448985 8:18997701-18997723 ACTTCCTGCCTTCCAGGAACAGG - Intronic
1037570433 8:20153366-20153388 ACTTCTTTCTTTCCTCAACTTGG - Intronic
1037572581 8:20171258-20171280 TCTTCTTTCTTTTCTACAACGGG + Intronic
1038400355 8:27279816-27279838 GCTTCTGTCTTCCCTGGTACTGG + Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1039826304 8:41176752-41176774 TCCTCATTCTCTCCTGGAACTGG - Intergenic
1042137102 8:65643182-65643204 ACTGCTGTCTTTCCTGGTGCTGG - Intergenic
1042307716 8:67348835-67348857 ACTTTTGTCTTTCCTGGTAAAGG + Intergenic
1042538345 8:69882087-69882109 AGTGCTTTCTTTCCTGGATCAGG + Intergenic
1043694406 8:83201811-83201833 ACTCCTGTTTCTCCTGGAACAGG + Intergenic
1043713875 8:83456337-83456359 ACTTTTGACTTTCCTGTAACTGG - Intergenic
1043839430 8:85084861-85084883 CCTTCTTTCCTCCCTGGAATTGG + Intergenic
1044445306 8:92268434-92268456 TATTCTTTCTGTCCTGAAACTGG - Intergenic
1044653900 8:94527549-94527571 ACTTCTTTTTTTCCTGAAAGGGG + Intronic
1044793637 8:95873224-95873246 ACTGCCTTCTTTCCTGCAAATGG + Intergenic
1047112279 8:121803839-121803861 AATTCTTTCTTGCTAGGAACTGG + Intergenic
1048137169 8:131757764-131757786 TCTTCTTTGTTCCCTGTAACAGG - Intergenic
1050172832 9:2840757-2840779 ACATCCTTATTTCCTGGCACTGG + Intronic
1050894989 9:10875450-10875472 ACTCTTTTCTTTCCTGAAATTGG + Intergenic
1053015655 9:34660550-34660572 AATCCTTTCTTTCCTGGGACTGG + Exonic
1056528575 9:87467077-87467099 ACTACTGTCATTCCTGGACCAGG - Intergenic
1056602478 9:88056974-88056996 TCTTCTTTCTTTTCTGAGACAGG + Intergenic
1057472968 9:95374294-95374316 ACTTCTTTCTTTCATTGACTTGG + Intergenic
1058336388 9:103834597-103834619 AATTCTTTCTCTCCTGGTACTGG + Intergenic
1058449476 9:105082693-105082715 AGTTCATTCTCTCCTGGATCAGG + Intergenic
1059198192 9:112390806-112390828 AATTCTTTTTTTCCTGTAAGTGG - Intronic
1059720665 9:116957281-116957303 ACTTTTTTCTTTTTTTGAACTGG + Intronic
1062312208 9:135944897-135944919 GCTTCTCTCTCTCCTGGGACAGG + Intronic
1185911618 X:3986337-3986359 CCTTCCTTCCTTCCTGGAAGTGG - Intergenic
1185972284 X:4678725-4678747 ACTTCTTTCTTTCCTGCCCTGGG + Intergenic
1186146857 X:6633251-6633273 GCCTTTTTCTTTCCTGAAACTGG - Intergenic
1186572460 X:10729737-10729759 ACTTCTTTCATTTCTAGAAATGG + Intronic
1187982840 X:24777615-24777637 ACTTCTTACTCTACTGTAACTGG - Intronic
1188074112 X:25754492-25754514 ACTTCAATCTCTCCTGGATCAGG - Intergenic
1188200723 X:27291164-27291186 ACTCCTTTCTTTCCTGGGCATGG - Intergenic
1188486199 X:30685007-30685029 CCTTTTATCTTTTCTGGAACTGG + Intronic
1188775071 X:34206787-34206809 ACTCCTTGCTGTCCTTGAACTGG + Intergenic
1189198231 X:39169440-39169462 CCTTTTTTTTTTCCTGAAACAGG - Intergenic
1189604547 X:42662200-42662222 ATTTTTTTCTTTCCAGGCACAGG + Intergenic
1189957104 X:46287191-46287213 AGTTAATTCTCTCCTGGAACAGG + Intergenic
1190689245 X:52899735-52899757 TCTTCTTTCTTTCTTGAAAGTGG + Intronic
1190696738 X:52956057-52956079 TCTTCTTTCTTTCTTGAAAGTGG - Intronic
1190768809 X:53498201-53498223 GCTTTTTTCTTTCCTGGCAAGGG - Intergenic
1192807864 X:74525642-74525664 ACTGCTTACTTTCCTGGAGCAGG - Intronic
1194793700 X:98183272-98183294 TCTTCTTTCTCTTCTGGAGCTGG - Intergenic
1196287387 X:113898314-113898336 TCTTAGTTCTTTCCTGGATCAGG + Intergenic
1196761718 X:119206686-119206708 ATTTCTTCCTCTCCTGGACCCGG - Intergenic
1201706479 Y:16943049-16943071 ACTTCTTTCTTTCCTGTCCTAGG - Intergenic
1202578374 Y:26351681-26351703 AATTTTTTTTTTCCTAGAACTGG - Intergenic