ID: 907178817

View in Genome Browser
Species Human (GRCh38)
Location 1:52552755-52552777
Sequence ACTTCTTTCTTTCCTGGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 359}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907178817_907178830 13 Left 907178817 1:52552755-52552777 CCCGTTCCAGGAAAGAAAGAAGT 0: 1
1: 0
2: 1
3: 47
4: 359
Right 907178830 1:52552791-52552813 GGGGCGGCTGAGACGCTCTCAGG 0: 1
1: 0
2: 1
3: 8
4: 130
907178817_907178825 -3 Left 907178817 1:52552755-52552777 CCCGTTCCAGGAAAGAAAGAAGT 0: 1
1: 0
2: 1
3: 47
4: 359
Right 907178825 1:52552775-52552797 AGTGTCAGGCCCCCAGGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 257
907178817_907178823 -7 Left 907178817 1:52552755-52552777 CCCGTTCCAGGAAAGAAAGAAGT 0: 1
1: 0
2: 1
3: 47
4: 359
Right 907178823 1:52552771-52552793 AAGAAGTGTCAGGCCCCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 165
907178817_907178821 -9 Left 907178817 1:52552755-52552777 CCCGTTCCAGGAAAGAAAGAAGT 0: 1
1: 0
2: 1
3: 47
4: 359
Right 907178821 1:52552769-52552791 GAAAGAAGTGTCAGGCCCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 150
907178817_907178831 18 Left 907178817 1:52552755-52552777 CCCGTTCCAGGAAAGAAAGAAGT 0: 1
1: 0
2: 1
3: 47
4: 359
Right 907178831 1:52552796-52552818 GGCTGAGACGCTCTCAGGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 155
907178817_907178824 -6 Left 907178817 1:52552755-52552777 CCCGTTCCAGGAAAGAAAGAAGT 0: 1
1: 0
2: 1
3: 47
4: 359
Right 907178824 1:52552772-52552794 AGAAGTGTCAGGCCCCCAGGGGG 0: 1
1: 0
2: 1
3: 16
4: 162
907178817_907178822 -8 Left 907178817 1:52552755-52552777 CCCGTTCCAGGAAAGAAAGAAGT 0: 1
1: 0
2: 1
3: 47
4: 359
Right 907178822 1:52552770-52552792 AAAGAAGTGTCAGGCCCCCAGGG 0: 1
1: 0
2: 2
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907178817 Original CRISPR ACTTCTTTCTTTCCTGGAAC GGG (reversed) Intronic