ID: 907178892

View in Genome Browser
Species Human (GRCh38)
Location 1:52553022-52553044
Sequence CGCTGCCGCCGCTGGAGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 268}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907178879_907178892 15 Left 907178879 1:52552984-52553006 CCTGCTCTCCCTCCGCCTCCTGC 0: 1
1: 2
2: 26
3: 320
4: 3249
Right 907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 268
907178880_907178892 7 Left 907178880 1:52552992-52553014 CCCTCCGCCTCCTGCTGCCGCCG 0: 1
1: 0
2: 3
3: 59
4: 417
Right 907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 268
907178885_907178892 -10 Left 907178885 1:52553009-52553031 CCGCCGCCGTCGCCGCTGCCGCC 0: 1
1: 43
2: 1217
3: 1845
4: 3511
Right 907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 268
907178881_907178892 6 Left 907178881 1:52552993-52553015 CCTCCGCCTCCTGCTGCCGCCGC 0: 1
1: 5
2: 26
3: 211
4: 1248
Right 907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 268
907178884_907178892 -3 Left 907178884 1:52553002-52553024 CCTGCTGCCGCCGCCGTCGCCGC 0: 1
1: 36
2: 255
3: 494
4: 1297
Right 907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 268
907178882_907178892 3 Left 907178882 1:52552996-52553018 CCGCCTCCTGCTGCCGCCGCCGT 0: 1
1: 2
2: 13
3: 115
4: 670
Right 907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 268
907178883_907178892 0 Left 907178883 1:52552999-52553021 CCTCCTGCTGCCGCCGCCGTCGC 0: 1
1: 4
2: 27
3: 233
4: 964
Right 907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907178892 Original CRISPR CGCTGCCGCCGCTGGAGGCC GGG Intronic