ID: 907178892

View in Genome Browser
Species Human (GRCh38)
Location 1:52553022-52553044
Sequence CGCTGCCGCCGCTGGAGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 268}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907178885_907178892 -10 Left 907178885 1:52553009-52553031 CCGCCGCCGTCGCCGCTGCCGCC 0: 1
1: 43
2: 1217
3: 1845
4: 3511
Right 907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 268
907178880_907178892 7 Left 907178880 1:52552992-52553014 CCCTCCGCCTCCTGCTGCCGCCG 0: 1
1: 0
2: 3
3: 59
4: 417
Right 907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 268
907178881_907178892 6 Left 907178881 1:52552993-52553015 CCTCCGCCTCCTGCTGCCGCCGC 0: 1
1: 5
2: 26
3: 211
4: 1248
Right 907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 268
907178882_907178892 3 Left 907178882 1:52552996-52553018 CCGCCTCCTGCTGCCGCCGCCGT 0: 1
1: 2
2: 13
3: 115
4: 670
Right 907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 268
907178883_907178892 0 Left 907178883 1:52552999-52553021 CCTCCTGCTGCCGCCGCCGTCGC 0: 1
1: 4
2: 27
3: 233
4: 964
Right 907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 268
907178879_907178892 15 Left 907178879 1:52552984-52553006 CCTGCTCTCCCTCCGCCTCCTGC 0: 1
1: 2
2: 26
3: 320
4: 3249
Right 907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 268
907178884_907178892 -3 Left 907178884 1:52553002-52553024 CCTGCTGCCGCCGCCGTCGCCGC 0: 1
1: 36
2: 255
3: 494
4: 1297
Right 907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907178892 Original CRISPR CGCTGCCGCCGCTGGAGGCC GGG Intronic
900175878 1:1291159-1291181 CGCTGCCCCCGCTCTAGCCCAGG - Intronic
900332279 1:2141893-2141915 CGCTTCGGCTGCTGGATGCCTGG - Intronic
900332358 1:2142313-2142335 CGCTTCGGCTGCTGGATGCCTGG - Intronic
900404384 1:2486054-2486076 TGGTGCCGCCCCTGGTGGCCAGG - Intronic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG + Intronic
901828606 1:11878773-11878795 CGCTGCAGCCGCAGGAAGCCCGG - Intergenic
901894786 1:12301691-12301713 CGCTGCTCTCCCTGGAGGCCTGG + Intronic
904664406 1:32108662-32108684 AGCTTGCGCCGCTGAAGGCCGGG + Intronic
904822946 1:33256816-33256838 CGCCGCCGCCGCTCTGGGCCGGG - Intronic
905870987 1:41404561-41404583 GGCTGCAGCCGCTGGGGGCTGGG + Intergenic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
907303104 1:53500464-53500486 AGATGCCGGCGCTGGAGGCTCGG - Intergenic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG + Exonic
910569540 1:88684425-88684447 CGCAGCCCCTGCTGGAGGCGCGG - Exonic
914808376 1:151008407-151008429 CGCCTCCGCCGCTGGGGGCGGGG + Intronic
915333921 1:155129711-155129733 TGCTGCCCCCGCCTGAGGCCTGG - Intronic
916131027 1:161611967-161611989 CGCACCCTCCGCTGGAGGCGTGG - Intronic
918215819 1:182391487-182391509 TGCTTCCGCCGCTGGTGGCTTGG - Intronic
921023823 1:211259632-211259654 CGCTGCCGCCGCCGCCTGCCGGG - Exonic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
922527653 1:226318191-226318213 CGCTCCCTGCGCTGGAGGGCTGG + Intergenic
922533629 1:226363702-226363724 CACTGCCAGCTCTGGAGGCCTGG + Intronic
922776478 1:228216409-228216431 CCCTGGGGCCGCTGGGGGCCAGG - Exonic
923011262 1:230089579-230089601 CCCTGCAGCCACTGGCGGCCAGG + Intronic
923163410 1:231337382-231337404 CGCCGCCGCCTCTGGAGGGGAGG - Exonic
923622234 1:235588355-235588377 CACAGCCCCCGCTGGGGGCCAGG - Intronic
924561076 1:245156548-245156570 CGCCGCCGCTGCCGGAGCCCGGG - Exonic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1064982009 10:21174343-21174365 CGCCACCGCCGCTGCAGGCCGGG + Intergenic
1066429342 10:35336883-35336905 CGCCGCCGCCGCTGCTGACCCGG + Exonic
1067565282 10:47331712-47331734 CACTGTCACAGCTGGAGGCCAGG - Intergenic
1069019171 10:63466092-63466114 CGCTGCCGCCTCCGCAGGGCCGG - Intergenic
1069615325 10:69802945-69802967 CGCTCCCAGCGCTGGAAGCCGGG - Intronic
1073253125 10:102133807-102133829 TCCTGCCGGGGCTGGAGGCCCGG + Intronic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1074814508 10:117134337-117134359 CGCGGGCGCCGCTGCAGGCTCGG - Exonic
1076192537 10:128492768-128492790 TGCTGCCTCCGCGGGAGCCCTGG + Intergenic
1076646137 10:131956098-131956120 AGCCGCCTCCGCTGGAGGCCCGG + Exonic
1077074666 11:694939-694961 CGCGGCCGCGGCAGGAGGCGAGG - Exonic
1077074898 11:695872-695894 CGCGCCCGCCGCTGCAAGCCCGG - Intronic
1077136229 11:1000497-1000519 CGCTGCCGCCGGAGGAGGGTGGG - Exonic
1077551811 11:3203765-3203787 GGCTGCAGCCGCTGCAGTCCAGG + Intergenic
1078753964 11:14191186-14191208 CGCTGCTGCCTCTGGTGGCCTGG + Intronic
1079459758 11:20669465-20669487 CGCAGCCGCAGCGGGGGGCCGGG + Intergenic
1082787431 11:57324664-57324686 CGCTGGGGACGCTGGAGGCCCGG - Intronic
1083033489 11:59615490-59615512 CGCGGCGGCGGCGGGAGGCCCGG - Exonic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083651813 11:64208555-64208577 CGCTGCTGCTCCAGGAGGCCAGG - Intronic
1084695912 11:70755558-70755580 CACTGCCACCACTGCAGGCCGGG - Intronic
1089666002 11:120019671-120019693 GGCTGCCTCCCCTGCAGGCCAGG - Intergenic
1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG + Exonic
1094107787 12:26832582-26832604 CGCTGCCGCGCGTGGTGGCCCGG - Intronic
1094375404 12:29783757-29783779 CGCCGCCGCCGCTGCTGCCCTGG + Exonic
1096077641 12:48815143-48815165 CGCAGCCGCCGCCGGAGGATGGG + Intronic
1096157297 12:49347753-49347775 CGCTGCCGCCGATGGAAGGGGGG - Exonic
1097107671 12:56634956-56634978 CGCCGCCGCCGCCTGCGGCCCGG - Intronic
1102084482 12:110124646-110124668 GGCAGCCCCCGCTAGAGGCCCGG + Exonic
1102648755 12:114421448-114421470 CTCTGCCCCCGATGGGGGCCAGG - Intergenic
1103309125 12:119990044-119990066 AGCTGGCGCTGCTGGCGGCCGGG + Exonic
1103764803 12:123272071-123272093 CGCGGCGGCTGCGGGAGGCCAGG + Exonic
1105454225 13:20525713-20525735 CGCTGCTGCCCCTGGAGCCCGGG - Intronic
1105830748 13:24161278-24161300 CACGGCCGCCCCTGTAGGCCAGG - Intronic
1106340243 13:28820240-28820262 CGCCGCCCCCGCTCGAGGGCCGG - Intergenic
1107408721 13:40139028-40139050 CGCTGAGGCCTCTGGAGGCTGGG - Intergenic
1108227461 13:48303954-48303976 CGCTGCCGCCGCGGAACCCCCGG + Exonic
1108541498 13:51451736-51451758 CGCCGCCGCCGCTGCCGGGCCGG + Intronic
1110630062 13:77697733-77697755 GGCTGCCGCGGCCGGAGGCGAGG + Intergenic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1117072588 14:52069557-52069579 CGCTCCTGGCTCTGGAGGCCTGG + Intergenic
1117690391 14:58299346-58299368 CGCTGCCGCCACCGCGGGCCCGG + Intronic
1119200825 14:72751487-72751509 TGATGCTGCCGCTGCAGGCCAGG + Intronic
1122068296 14:99188809-99188831 GGCTCCCGCGGCTGGAGCCCAGG + Intronic
1122931135 14:104933520-104933542 CGTTTCCTCCGCTGGAGTCCCGG - Exonic
1123782251 15:23640025-23640047 AGCTGCCGGGGCTGGAAGCCTGG - Intergenic
1125482621 15:40091010-40091032 CACTGCCACCACTGGCGGCCTGG - Exonic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1126436713 15:48645113-48645135 GGCTGCTGCCGCCGGGGGCCTGG - Intronic
1126649734 15:50908697-50908719 CCCGGCCGCCGCTGCCGGCCCGG - Exonic
1127763628 15:62164588-62164610 CGCCGCCGCAGCTGTGGGCCCGG + Exonic
1128062036 15:64741317-64741339 CGGTGTCCCCGCTGGAGTCCTGG + Intronic
1128354016 15:66911694-66911716 AGCTGGAGCCGCTGGGGGCCTGG + Intergenic
1129217170 15:74107087-74107109 GGCTGCCCCTGCAGGAGGCCAGG - Intronic
1129515312 15:76153649-76153671 CGCTGAGGCGGCTGGAGGCTGGG + Intronic
1129683057 15:77669146-77669168 CTCTGCCTCTGCTGCAGGCCTGG + Intronic
1129893794 15:79089539-79089561 CGCTGCCTCCGCAGCAGCCCTGG + Intronic
1132342329 15:101086440-101086462 CGCAGGCGCCGGAGGAGGCCGGG - Intergenic
1132589853 16:721868-721890 CGCTGGCGCGGCTGCACGCCTGG + Exonic
1132735801 16:1385295-1385317 CGGAGCCGGCGCTGGACGCCAGG + Intronic
1132809876 16:1792393-1792415 CTCTCCCCCCGCAGGAGGCCTGG - Exonic
1132857509 16:2053388-2053410 CGGAGCGGCCGCTGGAGGCCCGG + Exonic
1133323842 16:4931478-4931500 TGCTGCAGCCTCTGGAGCCCGGG - Intronic
1134308747 16:13057176-13057198 GGCTGCCACAGCTGGAGGACTGG - Intronic
1136220165 16:28823405-28823427 GGAGGCGGCCGCTGGAGGCCCGG - Exonic
1136224072 16:28846811-28846833 CTCTGCCGCAGCTGGAGGTAGGG + Exonic
1136375548 16:29863122-29863144 GGCGACCGCAGCTGGAGGCCCGG - Exonic
1137426442 16:48384966-48384988 CGCCCCCGCCCCTGGAGCCCCGG - Intronic
1138431975 16:56974909-56974931 CCCTGTCCCGGCTGGAGGCCTGG - Intronic
1139361547 16:66402835-66402857 CGCGGCCCGCGCTGGACGCCCGG + Exonic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139954740 16:70687728-70687750 AGCTGACAGCGCTGGAGGCCTGG + Exonic
1140481713 16:75265857-75265879 CGCTGGCGCCGCTGCCCGCCAGG - Exonic
1141580370 16:84994043-84994065 CTCTGCCTCCGCTGAAGCCCTGG + Intronic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1142171283 16:88624097-88624119 GGCTGCAGCCTGTGGAGGCCTGG - Intronic
1142246116 16:88970829-88970851 TGCAGCCGACGCTGGGGGCCGGG + Intronic
1143119464 17:4597959-4597981 CCCGTCCGCCGCTGGAGCCCTGG - Intronic
1143742582 17:8965417-8965439 CGCTGCCCCCGCGGTGGGCCAGG + Intronic
1144955502 17:19017020-19017042 AGCTGGCGCAGCAGGAGGCCAGG - Intronic
1145236783 17:21214101-21214123 CGCTGCCGCCACTGCTGCCCGGG + Exonic
1146062016 17:29612647-29612669 CGCAGCCGCGGCAGGAGGCTGGG - Exonic
1147582918 17:41636994-41637016 CGCTGCCGGGGCTGCAGGCCTGG - Intergenic
1147672423 17:42184308-42184330 TGCAGCCGACCCTGGAGGCCCGG + Exonic
1148197822 17:45727407-45727429 GGCTGCCTCTGCTGTAGGCCTGG - Intergenic
1148551196 17:48551637-48551659 GGCTGCCGTTTCTGGAGGCCGGG + Intronic
1148787200 17:50151115-50151137 CGCAGCCGCCGCTGGGGGACTGG + Intergenic
1148849794 17:50549039-50549061 CCCCGCCGCTGCTGGTGGCCTGG - Exonic
1150137638 17:62704308-62704330 GGCTGCGGAGGCTGGAGGCCCGG + Intronic
1150383888 17:64742414-64742436 CTCTGCCGCCGCCGGAGGAAAGG - Intergenic
1151582427 17:74987938-74987960 AGTTCCCGACGCTGGAGGCCCGG + Exonic
1151963408 17:77419230-77419252 CGCTGCCACAGCAGGAGGCTGGG - Intronic
1152094921 17:78267344-78267366 CCCTGCCCACTCTGGAGGCCAGG + Intergenic
1152249005 17:79201808-79201830 CCCTGACTCCGCTGGAGGCTGGG + Intronic
1152914058 17:83023766-83023788 CCCTGCAGCTGCTGGAGGTCGGG - Intronic
1153818086 18:8808225-8808247 CGCTGCTGATGCTGCAGGCCGGG - Intronic
1155199328 18:23503522-23503544 CGCAGCCGCCGCTACAGTCCGGG + Exonic
1155987302 18:32243687-32243709 TGCTGCCGCTGTTGGTGGCCAGG + Intronic
1157545201 18:48541383-48541405 CGCCGCCGCTGCTGGAGCCAGGG + Intronic
1157662819 18:49460480-49460502 CGCTGTCGCCGCCGCAGCCCAGG + Exonic
1157794103 18:50559625-50559647 GGCTGCAGCCGCCGGGGGCCCGG - Intergenic
1158401052 18:57121924-57121946 CGATCCCGCCTCGGGAGGCCAGG - Intergenic
1160781637 19:880119-880141 CGCTGCCGTCGTGGAAGGCCAGG + Exonic
1160857653 19:1224590-1224612 CACGGCCGCCCCTGCAGGCCAGG + Intronic
1161059755 19:2209082-2209104 CCCTGCCGCCCCTCGGGGCCCGG + Intronic
1161059841 19:2209454-2209476 GGCTGCCCCCTCTTGAGGCCTGG + Intronic
1161319255 19:3633442-3633464 CGCTCTCGCCGTCGGAGGCCGGG + Exonic
1161339016 19:3730526-3730548 CGCTCCCGCCGGCCGAGGCCTGG + Exonic
1161420987 19:4175798-4175820 CGCAGCCTCCCCTGGAGCCCAGG + Intronic
1161799880 19:6411726-6411748 CGATGACGACGCTGGGGGCCTGG - Intergenic
1163577279 19:18118126-18118148 CGCCGCAGCCGCCCGAGGCCGGG - Intronic
1163708624 19:18832374-18832396 CGGTGGCGGCGCGGGAGGCCCGG + Exonic
1163743896 19:19033493-19033515 CGCCGCCGCCGCGCGAGGCGGGG + Intronic
1165433433 19:35784724-35784746 CGCTGCCCTCGCTGGCTGCCGGG + Intronic
1165433826 19:35786409-35786431 CTGTGCAGCCTCTGGAGGCCTGG - Intronic
1166621428 19:44304853-44304875 CGCGGCCAGCGCTGGAGGGCGGG - Intronic
1167743654 19:51339061-51339083 CGCTTCCGCTGCTCGTGGCCCGG - Exonic
1168235082 19:55057842-55057864 TGCTGCCGCGGCTGGAGTGCTGG + Intronic
1168300562 19:55402480-55402502 AGCTGGGGCTGCTGGAGGCCTGG - Intronic
1168363039 19:55759132-55759154 CGCAGAAGCAGCTGGAGGCCAGG + Exonic
1168363991 19:55769132-55769154 CGCAGAAGCAGCTGGAGGCCAGG + Exonic
926217096 2:10912351-10912373 CGCCGCTGCCGCTGGGGGTCCGG - Exonic
926581438 2:14634969-14634991 CGCGTCCGCCGCCGGTGGCCCGG + Exonic
927591348 2:24360527-24360549 CGCGGCCTCCGCAGGAAGCCGGG + Exonic
928278059 2:29920537-29920559 CGGGGCCGCCGCTGCAGCCCCGG - Exonic
931253503 2:60552413-60552435 CGCCGCCGCCGCCGAAGGGCAGG - Intronic
931867224 2:66426074-66426096 CCCGGCGGCCGCTGGAAGCCGGG + Intergenic
938305508 2:130251880-130251902 CGCTGCAGCCGGTGCAGTCCTGG + Intergenic
941367086 2:164621745-164621767 CCCCGGCGCCGCTGGAGGCGGGG + Exonic
942068488 2:172294117-172294139 CGCTGCCATGGATGGAGGCCTGG - Intergenic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
943571511 2:189580777-189580799 CGCCGCCGCCGCCGTGGGCCGGG + Exonic
944547552 2:200812382-200812404 CGCTGCTTTCGCTGGAGGGCGGG + Exonic
946295772 2:218782324-218782346 CGTTGCCGCCGCCGGACACCAGG - Exonic
946767346 2:223052899-223052921 CGCTGCCGCCGCCGGCCGCACGG - Exonic
947523599 2:230865762-230865784 CGCTGCGGCCTCTGGACGTCGGG + Intronic
948207742 2:236171577-236171599 CGCTGCCGCCGCCAGAGTCGAGG + Intergenic
948792576 2:240386518-240386540 CCCTGCCGCAACTGGAGACCTGG + Intergenic
948836409 2:240628189-240628211 GGCAGCCCCCGCTGGGGGCCAGG - Intronic
1169065684 20:2693164-2693186 CGCTGGCGCCGCGGGCGGGCGGG + Intronic
1169488384 20:6052308-6052330 CGCTGCGGGCGCTGCAGCCCCGG - Exonic
1170150267 20:13220988-13221010 CGCTGCCGCCGAGGGCGCCCCGG + Intergenic
1171262591 20:23747334-23747356 GGCTGCTGCAGCTGAAGGCCTGG + Intergenic
1171283182 20:23918314-23918336 GGCTGCTGCAGCTGAAGGCCTGG + Intergenic
1171437174 20:25132855-25132877 GGCAGGCGCCGCTGGAGGGCTGG + Intergenic
1172039086 20:32031266-32031288 CGCTCCCGCCCCTGGAGCCCCGG - Exonic
1172100887 20:32483549-32483571 CGCTGCCGCCGCTGCTCGCCTGG - Intronic
1172587269 20:36093477-36093499 CGCCGCCGCCGCTGGGAGCTGGG + Intronic
1173166205 20:40688864-40688886 CGCAGCCGCCGCTGCCGCCCGGG + Exonic
1175268711 20:57718770-57718792 AGCCGCCGCCGCTGCAGCCCCGG - Intergenic
1175399482 20:58692601-58692623 GGGCGGCGCCGCTGGAGGCCGGG + Exonic
1176011524 20:62899132-62899154 GTCTGCCGCCTCTGGAGACCGGG - Intronic
1176386973 21:6142984-6143006 CTCTCCCTCCGCTGGTGGCCTGG + Intergenic
1178436949 21:32567947-32567969 CTCAGACACCGCTGGAGGCCAGG + Intergenic
1178487363 21:33027549-33027571 TGCTGCCGCCGCTGCAGCCGCGG + Exonic
1178922591 21:36748123-36748145 CGCCGCAGCCCCGGGAGGCCGGG - Exonic
1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG + Intronic
1179664835 21:42903983-42904005 CTCTGCCGCCCCAGGAGGACTGG - Exonic
1179674910 21:42974753-42974775 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1179736500 21:43395268-43395290 CTCTCCCTCCGCTGGTGGCCTGG - Intergenic
1180341757 22:11625903-11625925 CCCTGCCACCTCTGGAAGCCCGG + Intergenic
1181085126 22:20436392-20436414 CGCCGCCGCCGCTGCATTCCTGG + Intronic
1181572031 22:23772944-23772966 AGCCGCCGCCGCTGCTGGCCCGG + Exonic
1182226176 22:28800431-28800453 CGCCTCCGCCGCCGGAGCCCCGG - Exonic
1182485055 22:30634577-30634599 CGCTGCGCCCTCTGGTGGCCAGG - Intergenic
1184461228 22:44639390-44639412 CTCTTCCTCCGCTGGAGCCCAGG + Intergenic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
1184662550 22:45972088-45972110 CGGTTCCAGCGCTGGAGGCCCGG + Intronic
1185055122 22:48575429-48575451 CGCTGCCGGCCCAGGTGGCCGGG - Intronic
1185369986 22:50456532-50456554 CGCTGCGGACGCAGGAAGCCCGG + Exonic
950125047 3:10505692-10505714 CCCTGCCGCTGCCGGAGGCTGGG + Intronic
951613950 3:24521824-24521846 CGCCGCAGCCGCTGGAGCCTTGG + Intergenic
951717483 3:25664604-25664626 CGCGGGCGCCGCTGCAGGCCGGG + Intronic
952744533 3:36764542-36764564 CGCTCCTGGCCCTGGAGGCCGGG + Intergenic
961202401 3:125055578-125055600 CGCTCCCGCCTCTGGGGGCCCGG + Exonic
963904509 3:150762819-150762841 CGCTGGGGCCGGTGGAGGACGGG + Exonic
968405495 4:336745-336767 CGCTGCAGCCGCTGGAGCCGGGG - Intergenic
968745167 4:2356209-2356231 TGCAGCCGTCGCTGGAGCCCAGG - Intronic
969138606 4:5050806-5050828 GGCTCCCGCCGCAGGAGCCCAGG + Intergenic
969247702 4:5946083-5946105 CGCTGCCGCTCCTGGAGGCTGGG - Intronic
969416977 4:7067475-7067497 CCGTGCCGCAGCTCGAGGCCGGG - Intronic
969715870 4:8867842-8867864 CGCAGCCGCCGCTGGGCCCCCGG - Exonic
972725824 4:41745962-41745984 AGCGGCGGCAGCTGGAGGCCTGG - Exonic
973292435 4:48483672-48483694 CGGGGCCGGCGCTGGAGGCAGGG - Exonic
975701999 4:77075737-77075759 GGCCGCCGCCGCTCGAGCCCGGG + Exonic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
982157417 4:152535854-152535876 TGCAGCCGCCGCTGCCGGCCGGG + Exonic
983904362 4:173168974-173168996 CGCTGCCGCCGGAGGGGGCCGGG - Intronic
985884907 5:2670200-2670222 TGCTGCGGGCGCTGGAGGCCGGG - Intergenic
985995926 5:3596671-3596693 CGGTGCCCGCGCTGGAGGTCGGG + Intronic
992460309 5:76953977-76953999 CGCTGCGGCGGCTGCAGCCCGGG + Intronic
992530216 5:77645658-77645680 CGCTGCGCCCCCTGGGGGCCGGG - Intergenic
995048173 5:107672470-107672492 CGCTGCTGCCGCTGCGGCCCGGG + Intergenic
995052738 5:107724771-107724793 GGCCGCCGCCGCCGGGGGCCGGG - Intergenic
995304718 5:110631550-110631572 TGCTGCTGCCACTGGAGGCTAGG + Intronic
996623363 5:125538037-125538059 CTCTGCCCTCGCTGGAGGCTGGG + Intergenic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997965478 5:138352872-138352894 CGCTGCCGCCGCGGGAGCCGAGG - Exonic
998957642 5:147453737-147453759 GGCAGCCGCCGCGGGAGCCCGGG - Intronic
1000319080 5:160119359-160119381 CGCTGCCGCCTCTGCAGCCACGG + Exonic
1001825979 5:174745377-174745399 CGCTGCAGCCTCTGGAGGGGAGG + Intergenic
1002639502 5:180624047-180624069 TGCTGCCGCCGCCGGCTGCCAGG + Exonic
1002926818 6:1609832-1609854 GGCTGCCGCCGCTGGCGGGGCGG + Intergenic
1002927234 6:1611543-1611565 AGCTGCCCGCGCTGGAGGTCTGG - Exonic
1003290470 6:4775674-4775696 CGCTGGCTCCGCGGCAGGCCGGG - Intronic
1003351869 6:5325392-5325414 CCCTGCCGCCACTGGATGGCAGG - Intronic
1007161075 6:39792340-39792362 GGCTGCCGCCCCTCCAGGCCCGG - Intergenic
1007654321 6:43443121-43443143 CGGTGCTGCTGATGGAGGCCGGG + Exonic
1007739138 6:44000509-44000531 CACTCCCGCCGCGGCAGGCCAGG + Intergenic
1008751396 6:54737445-54737467 CTCTGCGCCCCCTGGAGGCCTGG + Intergenic
1013312757 6:108912668-108912690 GGCTGCTGCCCTTGGAGGCCAGG - Intronic
1017311559 6:152982713-152982735 CGCTGCCGCCGCCCGAGGCCGGG + Intronic
1018677570 6:166236127-166236149 CGCTGCGGCGGCTGGTGGGCAGG - Intergenic
1019270436 7:144090-144112 CGCTGCAGCCCCTGGAGGGGAGG + Intergenic
1019317036 7:391583-391605 GGGTGCTGCCGCAGGAGGCCAGG + Intergenic
1019437199 7:1028335-1028357 CGCTGAGGCTGCTGGAGGCGCGG - Intronic
1019883113 7:3880771-3880793 AGCCGCAGCCTCTGGAGGCCCGG - Intronic
1020082723 7:5295519-5295541 CTCTGCAGGGGCTGGAGGCCAGG - Intronic
1021553951 7:21900815-21900837 CGGTGCCTCCGCTGCAGGCAGGG + Intronic
1024717126 7:52092410-52092432 CCCAGCCTCTGCTGGAGGCCAGG - Intergenic
1027052979 7:75031291-75031313 CGCTGCTGCTGCTGGTGACCCGG - Intronic
1029537258 7:101163923-101163945 GGCTGGCGCAGGTGGAGGCCGGG - Exonic
1033253190 7:139777818-139777840 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1034414735 7:150958447-150958469 CGCTGCTGGCGCTGACGGCCCGG - Exonic
1034522628 7:151632327-151632349 CGCCGCCGCCGCAGGTGGCGCGG + Intronic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1035448161 7:158957067-158957089 CGCTGCTGCTGCTGCCGGCCTGG + Intergenic
1037891328 8:22625253-22625275 CGCTGCTGCTGCTGGAGGGCTGG + Intronic
1038002624 8:23404198-23404220 GGCGGCCGCCGCAGCAGGCCCGG + Exonic
1041552684 8:59119264-59119286 CGCTGCCGCCGCCGCCGGGCAGG + Intergenic
1041690272 8:60680037-60680059 AGCTGCCGCCGCCGGCGGCCCGG - Intronic
1042837754 8:73093070-73093092 CGCAGGCGCCGCCGGAGCCCTGG - Exonic
1043053257 8:75407456-75407478 CGCTGCGGTCTCGGGAGGCCGGG + Intergenic
1043768050 8:84162515-84162537 CGCTGACTCCTTTGGAGGCCAGG + Intergenic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1044776405 8:95693495-95693517 ACCTGCGGCCCCTGGAGGCCTGG - Intergenic
1045336059 8:101205392-101205414 TGCTGACGCCGCGGGACGCCCGG - Intronic
1045738011 8:105318838-105318860 CGCCGCCGCCGCCGCTGGCCAGG - Exonic
1049215465 8:141405863-141405885 CACTGCCTGTGCTGGAGGCCAGG - Intronic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049711145 8:144063936-144063958 AGCTGCCGCCGCTGGCTGCCAGG - Intergenic
1049724174 8:144137856-144137878 CGCTGGCGCCTCGGGAGGGCCGG + Exonic
1049762324 8:144337034-144337056 GGCTGCGGGCTCTGGAGGCCGGG - Intergenic
1049796852 8:144500945-144500967 GGCTGCCGGCGCTGGAGGTGCGG - Exonic
1051413001 9:16810494-16810516 AGATGCTGCCGCTGCAGGCCAGG + Intronic
1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG + Exonic
1056732818 9:89180432-89180454 GGCTGAGGCCGCTGGAGCCCAGG - Intergenic
1057182103 9:93035799-93035821 CACTGCTGGGGCTGGAGGCCAGG - Exonic
1057533484 9:95875728-95875750 CGCCGCCGCCGGAGGAGGACAGG - Exonic
1057997148 9:99828723-99828745 CGCAGCCGCCGCGGGCAGCCAGG + Exonic
1061061006 9:128250556-128250578 CGTTGGCGCCGCTGGGGGCGGGG + Intronic
1061192176 9:129088279-129088301 GGCTGCCGGGGCTGGAGCCCAGG + Intronic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061666419 9:132163009-132163031 CGCTGCCGCCTGTGGCGACCCGG - Intronic
1061921988 9:133787554-133787576 CACTGCCAGCCCTGGAGGCCAGG + Intronic
1062506992 9:136882615-136882637 CCCTGCCCCTGCTGGAGGCCTGG + Intronic
1185623126 X:1465489-1465511 CTCTCCTGCCTCTGGAGGCCGGG + Exonic
1187016660 X:15335526-15335548 GGCTGCAGCCGCGGGAGGTCCGG - Intronic
1187332544 X:18354277-18354299 CGCTGTCGGCGCTGCAGGCGAGG + Intronic
1189002061 X:36957880-36957902 CGCTGCCGCCCGAGGACGCCAGG - Intergenic
1190881530 X:54495598-54495620 CGCTGCCACGGCTGCTGGCCCGG - Exonic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1199500369 X:148500673-148500695 CGCCGCCGCCGCTGCCGCCCCGG + Exonic
1200123945 X:153804507-153804529 CGCTGTTGCCTCCGGAGGCCCGG + Exonic
1200292483 X:154886325-154886347 CGCCGCCGCAGCTGGCGGGCGGG - Intronic
1200339327 X:155382065-155382087 CGCCGCCGCAGCTGGCGGGCGGG - Intergenic
1200347143 X:155458628-155458650 CGCCGCCGCAGCTGGCGGGCGGG + Exonic