ID: 907179093

View in Genome Browser
Species Human (GRCh38)
Location 1:52553670-52553692
Sequence CGGGGGCCTCGGCAGAGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907179093_907179100 -2 Left 907179093 1:52553670-52553692 CCTAGTCTCTGCCGAGGCCCCCG 0: 1
1: 0
2: 0
3: 5
4: 148
Right 907179100 1:52553691-52553713 CGAGCTGGAAGCCGAGCCCGAGG 0: 1
1: 0
2: 0
3: 14
4: 128
907179093_907179102 8 Left 907179093 1:52553670-52553692 CCTAGTCTCTGCCGAGGCCCCCG 0: 1
1: 0
2: 0
3: 5
4: 148
Right 907179102 1:52553701-52553723 GCCGAGCCCGAGGGCCGCCTCGG 0: 1
1: 0
2: 1
3: 12
4: 128
907179093_907179101 -1 Left 907179093 1:52553670-52553692 CCTAGTCTCTGCCGAGGCCCCCG 0: 1
1: 0
2: 0
3: 5
4: 148
Right 907179101 1:52553692-52553714 GAGCTGGAAGCCGAGCCCGAGGG 0: 1
1: 0
2: 2
3: 16
4: 139
907179093_907179107 24 Left 907179093 1:52553670-52553692 CCTAGTCTCTGCCGAGGCCCCCG 0: 1
1: 0
2: 0
3: 5
4: 148
Right 907179107 1:52553717-52553739 GCCTCGGCGCCTCGCTCCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907179093 Original CRISPR CGGGGGCCTCGGCAGAGACT AGG (reversed) Intergenic
900152579 1:1185070-1185092 CCGGGGCCTCGCCAAGGACTGGG + Exonic
900175172 1:1288329-1288351 CGGGGGACGGGGCAGAGACACGG - Intronic
900175346 1:1289075-1289097 CGGGGGACGGAGCAGAGACTCGG - Intronic
900175442 1:1289453-1289475 CGGGGGACGGGGCAGAGACACGG - Intronic
900175549 1:1289910-1289932 CGGGGGACGGGGCAGAGACACGG - Intronic
901528114 1:9836666-9836688 CTGGGGCCTTGGCAGACACCTGG - Intergenic
901529615 1:9844739-9844761 GAGGGACCTCGGCAGAGCCTGGG - Intergenic
901569333 1:10146886-10146908 AGGGGGACTGGGCAGGGACTGGG - Intronic
901730071 1:11273076-11273098 CGGGGGCCTGGTCAGAGGCGGGG - Intergenic
903282484 1:22257839-22257861 CGGGGGGCAGGGCAGAGCCTTGG - Intergenic
903420904 1:23217372-23217394 CGGGGGTCGCGGCGGAGACAAGG - Intergenic
905462289 1:38129672-38129694 AGGGGGCGTTGGCAGAGACAGGG + Intergenic
907179093 1:52553670-52553692 CGGGGGCCTCGGCAGAGACTAGG - Intergenic
911445250 1:97984444-97984466 CTGGGGCCTGGGCAGAATCTGGG - Intergenic
912682671 1:111739110-111739132 CGGGGGCCGGGGCGGAGACCAGG + Intronic
915674549 1:157518221-157518243 TGGGGCCCTCTGCAGAGAATAGG + Intronic
918420966 1:184363874-184363896 CTGGGTCCCCGGCAGAGGCTGGG + Intergenic
919806046 1:201381624-201381646 CTGTGACCTGGGCAGAGACTGGG + Exonic
921164660 1:212498144-212498166 CGGGGGCCTGAGCAGAAACCTGG - Intergenic
923102481 1:230827448-230827470 CAGGGGCCTCTTCAGAGACATGG - Intergenic
1066438296 10:35414203-35414225 CTGCAGCCTCGTCAGAGACTGGG - Intronic
1067161182 10:43826153-43826175 CGGGAGCCTCGGGAGGGCCTCGG - Intergenic
1067732072 10:48819748-48819770 TGTGGGCATCAGCAGAGACTGGG + Intronic
1071086844 10:81875288-81875310 CGAGGGCCGCGGCAGAGGCATGG - Intergenic
1072252081 10:93589583-93589605 GGGGGGCCTGGGCAAAGATTAGG + Exonic
1075119137 10:119651599-119651621 CGGCGGCCCGGCCAGAGACTCGG + Exonic
1077140605 11:1022587-1022609 TGGGCGCCTCGGCCGACACTGGG + Intronic
1082739898 11:56899365-56899387 TGGTGGCCTGTGCAGAGACTTGG - Intergenic
1084361889 11:68674052-68674074 CTGGGGCCTGGGCAGTGGCTGGG + Intergenic
1084535294 11:69752950-69752972 CAGGGGTCTGGGCAGAGAATGGG - Intergenic
1085645242 11:78218403-78218425 CGGGGGCCTCTGAGGGGACTGGG + Exonic
1089283124 11:117388233-117388255 CAGGGGCCTCGGGAGAGAGATGG - Intronic
1090003992 11:122984323-122984345 CTGGGGCCCCGGCAGAGGCGGGG - Intergenic
1090187027 11:124745703-124745725 CGGCGGCCCCAGCGGAGACTAGG + Exonic
1090855948 11:130609486-130609508 CGGGTGTCCCAGCAGAGACTGGG + Intergenic
1099636662 12:85222359-85222381 AGGGGCCCTTGGAAGAGACTGGG + Intronic
1101851831 12:108409485-108409507 CAGAGGGCTCGGCAGAGACATGG + Intergenic
1102247214 12:111362978-111363000 CGGGGGCAAGGGCAGGGACTGGG + Exonic
1102565738 12:113796392-113796414 CTGCGGCCTCGCCAGGGACTTGG + Intergenic
1103560224 12:121789710-121789732 CGGAGGCCTGGGCTGAGACAAGG - Intronic
1104376336 12:128267582-128267604 CGGGGGCCTCGGCGGGGGCTCGG + Intronic
1105290421 13:19049785-19049807 CGGGCCCCTCTGCAGGGACTGGG + Intergenic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1120291951 14:82586171-82586193 CGGGTGCCTCAGCAGAGTCATGG - Intergenic
1121509942 14:94505137-94505159 CGGAGGCCTCGGAAGAGCCATGG + Intronic
1121845833 14:97171333-97171355 AGTGGGCATCGGCAGACACTTGG - Intergenic
1122268666 14:100558521-100558543 TGGGGGCCTCAGCAGAGAGATGG - Intronic
1122817525 14:104320930-104320952 CGGGACTCTCGGCAGAGGCTGGG + Intergenic
1123038429 14:105480651-105480673 AGGGGTCCTGGGCAGAGAATGGG + Intergenic
1123108133 14:105852453-105852475 CGGGGGCACAGGCCGAGACTGGG + Intergenic
1123122793 14:105925846-105925868 CGGGGCCGTTGGCAGAGGCTGGG - Intronic
1123405438 15:20017266-20017288 CGGGGCCGTTGGCAGAGGCTGGG - Intergenic
1123514769 15:21023914-21023936 CGGGGCCGTTGGCAGAGGCTGGG - Intergenic
1125861999 15:43008361-43008383 CCGGGGCCGCGGCAGCGCCTGGG - Intronic
1130547642 15:84868451-84868473 CGGTAGCCTCCGCAGAGGCTGGG + Exonic
1131200017 15:90388308-90388330 CGGCTTCCTCAGCAGAGACTCGG + Exonic
1132679284 16:1133122-1133144 CGGCGGCCTGGACAGGGACTCGG + Intergenic
1132809758 16:1791898-1791920 CGAGGGCCTCGGCAGCCTCTGGG - Exonic
1136006642 16:27334934-27334956 CTGGGGACTCGGCAGTGAATGGG + Intronic
1138581728 16:57946042-57946064 AGGGGGCCTTGGCAGGCACTGGG - Intronic
1139841858 16:69888211-69888233 CGGGGGCCTGGGCAGCCGCTGGG - Exonic
1140022326 16:71250434-71250456 TGGGGACATGGGCAGAGACTTGG + Intergenic
1141552116 16:84813184-84813206 AGGGGGGCTCGGCAGAGAGAAGG - Intergenic
1144667682 17:17112854-17112876 CGCGGGCCTTGGGAGAGGCTAGG + Intronic
1147037197 17:37690528-37690550 AGGGGGCCTGGGCTGGGACTAGG + Intronic
1147452053 17:40511886-40511908 AGGGTGCCTCAGCAGAGTCTAGG + Intergenic
1147467133 17:40619111-40619133 CTGGGGCCCCGGCAGAGAGGAGG + Intergenic
1147700019 17:42388085-42388107 AGCGGGCCTCGGAAGGGACTCGG - Intronic
1152127655 17:78456933-78456955 CCGGAGCCTCAGCAGAGCCTGGG - Intronic
1152335097 17:79696170-79696192 CAGGAGCCTGGGCAGAGGCTTGG + Intergenic
1152648410 17:81481045-81481067 CGGTGGCCTCAGCGGAGGCTTGG - Intergenic
1152940704 17:83171774-83171796 CCGGGGCCTCGCCTGTGACTCGG + Intergenic
1152940723 17:83171831-83171853 CCGGGGCCTCGCCTGGGACTCGG + Intergenic
1152940734 17:83171860-83171882 CCGGGGCCTCGCCTGGGACTTGG + Intergenic
1153503092 18:5768650-5768672 CGTGGGCCTTGGCAGTGACCTGG - Intergenic
1157546015 18:48547007-48547029 CAGGGGCCTGGGGAGAGTCTGGG + Intronic
1158893752 18:61894803-61894825 CCGGGTCCTAGGCACAGACTGGG - Intergenic
1160241081 18:77123730-77123752 AGGGGGCCACGGCAGATGCTTGG + Intronic
1160752124 19:739324-739346 CCGGGGTCACGGCGGAGACTGGG - Intronic
1160862127 19:1241907-1241929 CGGCGGCCTCGGCATAGGCACGG - Exonic
1163129835 19:15265450-15265472 CGGGGGCGTCTGCAGTGGCTGGG + Exonic
1163556993 19:17998623-17998645 CGGGGGCCTGGGGAGAGTCGGGG - Exonic
1166852431 19:45767061-45767083 CAGCGGCCTCGGCGGACACTGGG + Exonic
1167520016 19:49949092-49949114 CGGGAGACTAGGCAGAGAATTGG - Exonic
1167634942 19:50648992-50649014 CGGGGGCCTGGGGAGATGCTGGG + Intronic
1168148612 19:54433091-54433113 CTGTGGCCTAGGCAGAAACTGGG + Intronic
1168684220 19:58338183-58338205 CGGGGCCCTCGGCAGAGTAGGGG + Intronic
932571247 2:72939614-72939636 CTGAGGCCTGGGCAGAGACAAGG - Intergenic
934071533 2:88388914-88388936 CTGGGCCCTGGGGAGAGACTGGG + Intergenic
940346902 2:152637742-152637764 GGGAGGCCTCTGCAGAGAGTTGG - Intronic
946005368 2:216520278-216520300 GGGGGGGCTCAGCAAAGACTTGG + Intronic
947518762 2:230828553-230828575 CGGGGCCCTCTGCAGGGACGCGG - Intergenic
948869857 2:240792393-240792415 TGGGGGCCTGGCCAGAGCCTGGG - Intronic
948991638 2:241558773-241558795 CGGGGGCCTGGGCAGCGAGGTGG - Exonic
1170626976 20:18037492-18037514 AGGGTGGCTCGGCAGAGACTAGG - Intronic
1171494688 20:25547584-25547606 CAGGGGCCTCTGAAGAGAATTGG + Intronic
1173165985 20:40687777-40687799 CTGGGGCCGCGGCAGGGACAGGG + Exonic
1173454091 20:43189767-43189789 CGGGGGCCGGGGCCGGGACTGGG + Exonic
1176179758 20:63743752-63743774 CAGGCGCCTAGGCAGAAACTTGG + Exonic
1176388554 21:6151747-6151769 TGGGGGACCCTGCAGAGACTGGG - Intergenic
1179721924 21:43321106-43321128 CGGTGGCCTCAGCTGAGACTGGG - Intergenic
1179734918 21:43386501-43386523 TGGGGGACCCTGCAGAGACTGGG + Intergenic
1180056614 21:45362247-45362269 AGGGGGCCTGGGCAGAGCTTGGG - Intergenic
1180095184 21:45553106-45553128 CGGGGGCCTCGCTGGAGGCTGGG + Intergenic
1181594717 22:23906812-23906834 CTGGGGCCTCTGCAGGGAGTTGG + Intergenic
1182275828 22:29188067-29188089 CATGGGCCTGGGCAGTGACTGGG + Intergenic
1182664054 22:31944638-31944660 CGGCGGCCTCCGCAGCGACCGGG + Exonic
1182712715 22:32332574-32332596 TGGGAGCCTCTGCAGAGACAGGG + Intergenic
1183598850 22:38828449-38828471 CGGTGGGCACAGCAGAGACTGGG + Exonic
1184399957 22:44267956-44267978 TGGGAGCCTCTGCAGAGACACGG + Intronic
1184415048 22:44347395-44347417 CTGGGGCCTAGGCTGAGCCTGGG - Intergenic
1184556142 22:45234091-45234113 CGGGGGCCTTGGCAGAGGCCGGG + Intronic
961807217 3:129498073-129498095 CTGGGGCCATGGCAAAGACTTGG - Intronic
964819610 3:160755690-160755712 CGGGAGCCTGGGCAGAGACAGGG - Intronic
966852023 3:184170398-184170420 CGGGGGCAGCGGCAGCGAATCGG + Exonic
968548018 4:1208380-1208402 CGGGGGCCTTGGCAGGAAGTTGG - Intronic
968809423 4:2793251-2793273 CGGGGGTCTCGGGGGAGTCTCGG + Intronic
969586549 4:8097392-8097414 CTGAGGCCTCGGCACACACTTGG + Intronic
969869360 4:10095064-10095086 AGGGGGCCTCTGCAGGGAGTGGG + Intronic
985724516 5:1508851-1508873 TGGTGGCCTTGGCAGAGACGAGG - Intronic
986712425 5:10497800-10497822 CGGGGACCACGGCAGAGGGTGGG + Intergenic
988723200 5:33899645-33899667 TGGAGGCCTCCGAAGAGACTTGG - Intergenic
995471986 5:112512156-112512178 TGGGGCCCTTGGCAAAGACTGGG - Intergenic
997773624 5:136577500-136577522 TGGGGCTCTAGGCAGAGACTAGG - Intergenic
998292508 5:140928287-140928309 CGGGGTCCTGGGCAAACACTCGG - Exonic
1002180950 5:177430968-177430990 GTGAGGCCTGGGCAGAGACTGGG + Intronic
1006941246 6:37753693-37753715 GGGGGGCCTGGCCAGAGACCAGG + Intergenic
1006941386 6:37754030-37754052 CGGGGGCCTGGCCAGAGAGCAGG + Intergenic
1007837183 6:44682623-44682645 CGGGAGCCTGGACAGAGCCTGGG - Intergenic
1009622411 6:66094676-66094698 CGGAGCCCTGGGGAGAGACTGGG + Intergenic
1019108535 6:169690502-169690524 CAGGGGCCTCTGCTGAGACCTGG - Intronic
1019419972 7:946321-946343 CTGGGGCCTGGGCAGAGAGGAGG - Intronic
1021792292 7:24217812-24217834 CTGGGGCCTGGGCAGGGGCTTGG - Intergenic
1026131566 7:67625415-67625437 CGGGGGCCTCTGCAGGGAGCTGG - Intergenic
1035543326 8:459119-459141 CCTGGGCCTCTGCAGAAACTGGG + Intronic
1036207777 8:6817978-6818000 CGGGGGCTTGGCCAGAGACAGGG - Intronic
1037531996 8:19785806-19785828 CGGGGGACACAGCAGAGAGTTGG - Intergenic
1037613666 8:20497441-20497463 CTGGGGCTACAGCAGAGACTAGG - Intergenic
1039370682 8:36981185-36981207 GGGCAGCCTCGCCAGAGACTTGG + Intergenic
1048273486 8:133047902-133047924 TGAGGGCCTGGGCAGAGACAAGG - Exonic
1048963364 8:139597816-139597838 CTGGGGCTTTGGCACAGACTTGG - Intergenic
1049271542 8:141698721-141698743 CCGGGGCCCTGGCACAGACTTGG + Intergenic
1052163127 9:25290150-25290172 CGGGGGCTTCTGAGGAGACTGGG - Intergenic
1053301900 9:36958438-36958460 CGGGGGCCTGGCTGGAGACTTGG + Intronic
1058958326 9:109969701-109969723 CAGGAGCCTTGGCAGAGGCTGGG + Intronic
1060409820 9:123392818-123392840 CTGGGGCCTCGGCAGGGAAAGGG - Intronic
1061011063 9:127954955-127954977 CGGGGGCCTTGGCAGGATCTGGG + Intronic
1061905445 9:133694392-133694414 CTGGGGCCTCAGCACAGACCCGG - Intronic
1062490679 9:136803501-136803523 CAGGGACCTTGGCACAGACTGGG - Intronic
1188973957 X:36651225-36651247 CAGGGACCTTGGCAGGGACTTGG - Intergenic
1190114973 X:47620265-47620287 CAGGGCCCTCTGCAGATACTCGG + Intergenic
1190332757 X:49246398-49246420 CGGGGGACAGGGCAGAGACAGGG - Intronic
1195174558 X:102303034-102303056 CGGGGGCCAGGGCAGATACCAGG + Intergenic
1195184307 X:102384059-102384081 CGGGGGCCAGGGCAGATACCAGG - Intronic