ID: 907183010

View in Genome Browser
Species Human (GRCh38)
Location 1:52587334-52587356
Sequence TGGTACTCACAGATGGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907183007_907183010 -1 Left 907183007 1:52587312-52587334 CCAGTCGGGGGATAAAATAGACT No data
Right 907183010 1:52587334-52587356 TGGTACTCACAGATGGTACAAGG No data
907182999_907183010 24 Left 907182999 1:52587287-52587309 CCTGATCCTTGCCCTTCAAGGGC No data
Right 907183010 1:52587334-52587356 TGGTACTCACAGATGGTACAAGG No data
907183000_907183010 18 Left 907183000 1:52587293-52587315 CCTTGCCCTTCAAGGGCTTCCAG No data
Right 907183010 1:52587334-52587356 TGGTACTCACAGATGGTACAAGG No data
907183004_907183010 12 Left 907183004 1:52587299-52587321 CCTTCAAGGGCTTCCAGTCGGGG No data
Right 907183010 1:52587334-52587356 TGGTACTCACAGATGGTACAAGG No data
907183002_907183010 13 Left 907183002 1:52587298-52587320 CCCTTCAAGGGCTTCCAGTCGGG No data
Right 907183010 1:52587334-52587356 TGGTACTCACAGATGGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907183010 Original CRISPR TGGTACTCACAGATGGTACA AGG Intergenic
No off target data available for this crispr