ID: 907183215

View in Genome Browser
Species Human (GRCh38)
Location 1:52588863-52588885
Sequence GTATGTATGCAAAAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907183210_907183215 29 Left 907183210 1:52588811-52588833 CCATTCTACATGCAGATTACAGA No data
Right 907183215 1:52588863-52588885 GTATGTATGCAAAAGTTGGAGGG No data
907183209_907183215 30 Left 907183209 1:52588810-52588832 CCCATTCTACATGCAGATTACAG No data
Right 907183215 1:52588863-52588885 GTATGTATGCAAAAGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907183215 Original CRISPR GTATGTATGCAAAAGTTGGA GGG Intergenic
No off target data available for this crispr