ID: 907185026

View in Genome Browser
Species Human (GRCh38)
Location 1:52602719-52602741
Sequence CCGGGCCGGGCGCGGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 1, 2: 5, 3: 60, 4: 636}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907185026_907185045 8 Left 907185026 1:52602719-52602741 CCCCCATCCCGCGCCCGGCCCGG 0: 1
1: 1
2: 5
3: 60
4: 636
Right 907185045 1:52602750-52602772 GCGGCTACGTGGCACGGCCTTGG 0: 1
1: 0
2: 1
3: 4
4: 36
907185026_907185042 2 Left 907185026 1:52602719-52602741 CCCCCATCCCGCGCCCGGCCCGG 0: 1
1: 1
2: 5
3: 60
4: 636
Right 907185042 1:52602744-52602766 CGGCCCGCGGCTACGTGGCACGG 0: 1
1: 0
2: 0
3: 3
4: 44
907185026_907185046 13 Left 907185026 1:52602719-52602741 CCCCCATCCCGCGCCCGGCCCGG 0: 1
1: 1
2: 5
3: 60
4: 636
Right 907185046 1:52602755-52602777 TACGTGGCACGGCCTTGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 36
907185026_907185047 16 Left 907185026 1:52602719-52602741 CCCCCATCCCGCGCCCGGCCCGG 0: 1
1: 1
2: 5
3: 60
4: 636
Right 907185047 1:52602758-52602780 GTGGCACGGCCTTGGCGCGGAGG No data
907185026_907185039 -3 Left 907185026 1:52602719-52602741 CCCCCATCCCGCGCCCGGCCCGG 0: 1
1: 1
2: 5
3: 60
4: 636
Right 907185039 1:52602739-52602761 CGGCCCGGCCCGCGGCTACGTGG 0: 1
1: 0
2: 2
3: 13
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907185026 Original CRISPR CCGGGCCGGGCGCGGGATGG GGG (reversed) Intronic