ID: 907185026

View in Genome Browser
Species Human (GRCh38)
Location 1:52602719-52602741
Sequence CCGGGCCGGGCGCGGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 1, 2: 5, 3: 60, 4: 636}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907185026_907185039 -3 Left 907185026 1:52602719-52602741 CCCCCATCCCGCGCCCGGCCCGG 0: 1
1: 1
2: 5
3: 60
4: 636
Right 907185039 1:52602739-52602761 CGGCCCGGCCCGCGGCTACGTGG 0: 1
1: 0
2: 2
3: 13
4: 144
907185026_907185046 13 Left 907185026 1:52602719-52602741 CCCCCATCCCGCGCCCGGCCCGG 0: 1
1: 1
2: 5
3: 60
4: 636
Right 907185046 1:52602755-52602777 TACGTGGCACGGCCTTGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 36
907185026_907185045 8 Left 907185026 1:52602719-52602741 CCCCCATCCCGCGCCCGGCCCGG 0: 1
1: 1
2: 5
3: 60
4: 636
Right 907185045 1:52602750-52602772 GCGGCTACGTGGCACGGCCTTGG 0: 1
1: 0
2: 1
3: 4
4: 36
907185026_907185047 16 Left 907185026 1:52602719-52602741 CCCCCATCCCGCGCCCGGCCCGG 0: 1
1: 1
2: 5
3: 60
4: 636
Right 907185047 1:52602758-52602780 GTGGCACGGCCTTGGCGCGGAGG No data
907185026_907185042 2 Left 907185026 1:52602719-52602741 CCCCCATCCCGCGCCCGGCCCGG 0: 1
1: 1
2: 5
3: 60
4: 636
Right 907185042 1:52602744-52602766 CGGCCCGCGGCTACGTGGCACGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907185026 Original CRISPR CCGGGCCGGGCGCGGGATGG GGG (reversed) Intronic
900019995 1:181571-181593 CCGGGCTGGGGGCGGGGGGGGGG + Intergenic
900113674 1:1019931-1019953 CCGGGCGGGCCGGGGGAGGGAGG + Intergenic
900186325 1:1334860-1334882 CCTGGCAGGGTGCAGGATGGGGG - Exonic
900189944 1:1349136-1349158 CCGGGCGGGGCGCAGGCGGGCGG - Intronic
900190002 1:1349279-1349301 CCGGGCCGGGGGCGGATGGGCGG - Intronic
900290882 1:1923130-1923152 CCTGGCCGGGAGCTGGCTGGAGG + Intronic
900371853 1:2335762-2335784 CGGGGCCAGGCGAGGGCTGGTGG + Intronic
900626628 1:3611541-3611563 CCGGGCTGGGGGCGGGCCGGGGG - Intergenic
900645645 1:3707532-3707554 CTGGGCCTGGCGCGGGAAAGGGG - Exonic
900990552 1:6096434-6096456 GTGGGCCGGGCACGGGCTGGTGG - Intronic
901242822 1:7704803-7704825 CCGGGCCGGGCGGGGCCGGGCGG + Intronic
901443494 1:9293194-9293216 CGGGGCCGGGCGCGGGGGAGCGG + Intronic
901506595 1:9689486-9689508 CGGGGCGGGGCGCCGGCTGGGGG - Intronic
901525985 1:9823741-9823763 CCGGGGCGGGAGCGGCAGGGAGG + Exonic
901526052 1:9824001-9824023 CCCGGCCGGGGGCGGGGTGGCGG + Exonic
901660302 1:10794886-10794908 GCTGGCCGGGCGCGGGCGGGCGG - Intronic
901686626 1:10946969-10946991 CTGGGCCGGGAGGTGGATGGTGG + Intronic
902762330 1:18590391-18590413 CCGGGCCTGTCGTGGGGTGGGGG - Intergenic
903231131 1:21922949-21922971 TCGGGGTGGGGGCGGGATGGGGG - Intronic
903501018 1:23800283-23800305 CCGCGCCAGGCGCGGGGCGGGGG - Intronic
903846009 1:26280287-26280309 CCAGGACGGGGGCGGGGTGGGGG + Intronic
905399797 1:37692811-37692833 CTGGGGCGGTCGCGGGATGCTGG + Intronic
905406806 1:37738989-37739011 CGGGGCCTGTCGCGGGGTGGAGG + Intronic
905638975 1:39575963-39575985 CCTGGCGGGGCTCGGGGTGGTGG - Exonic
905789794 1:40783965-40783987 CCGGGGCGGGCGCGGGCGGCGGG - Intergenic
905807043 1:40884561-40884583 CCGGGACGGGCGGGGGCAGGGGG + Intergenic
906094097 1:43208632-43208654 CGGGGCCTGTCGTGGGATGGGGG + Intronic
906214343 1:44030410-44030432 CCGGGCCGGGCGGGAGAGTGGGG - Intronic
906636999 1:47416471-47416493 CCGGGCCGGGCGCGGGCGTGGGG - Exonic
906766082 1:48435737-48435759 CGGTGCGGGGCGCGGGAGGGCGG - Intronic
907136182 1:52141909-52141931 CCGGGCCGGCCGCGGGCCGCGGG + Intergenic
907185026 1:52602719-52602741 CCGGGCCGGGCGCGGGATGGGGG - Intronic
908354959 1:63319856-63319878 CCGGCGCGGGCGCGGGACGTCGG + Intergenic
910153198 1:84179948-84179970 CGGGGCCTGTCGCGGGGTGGGGG - Intronic
910188873 1:84574540-84574562 CCGGGGCGGGCGTGGGAGGTCGG + Intergenic
910266908 1:85347604-85347626 CGGGGCCTGTCGTGGGATGGGGG + Intronic
910981221 1:92961506-92961528 CCGGGCAGGGGGCGGGGAGGCGG - Intronic
911144817 1:94541850-94541872 CCGGGCCGGGGGCGGGGAGTCGG - Intergenic
911498770 1:98661532-98661554 CCTGGCCTGGGGCGGGCTGGAGG - Intergenic
912884402 1:113454648-113454670 CGGGGCCTGTCGAGGGATGGGGG - Intronic
913018353 1:114762587-114762609 CAGGGCCTGTCGTGGGATGGGGG + Intergenic
915557498 1:156668678-156668700 CGGGGGCGGGCGGGGGGTGGCGG - Intergenic
915722163 1:157993546-157993568 CAGGGGCGGGCGCGGGCGGGCGG + Intronic
916090664 1:161305847-161305869 GCGGGCCGGGCGGGGGATCGGGG - Exonic
916233287 1:162561470-162561492 CGGGGCGGGGCTAGGGATGGGGG - Intergenic
916694429 1:167221422-167221444 GCCGGGCGGGCGCGGGGTGGGGG + Intronic
916844773 1:168638488-168638510 CCGGGCCAGCCCAGGGATGGAGG + Intergenic
917817500 1:178725487-178725509 CCGGGCGGCGCGGGGAATGGCGG + Intronic
917884959 1:179374813-179374835 CGGGGCCTGTCGTGGGATGGGGG + Intronic
919228398 1:194739119-194739141 CCGGGCCTGTCGTGGGGTGGTGG - Intergenic
919325804 1:196105322-196105344 CGGGGCCAGTCGTGGGATGGGGG + Intergenic
920184583 1:204152074-204152096 CCGGGGCGGGGGCGGGCCGGGGG - Intergenic
920385483 1:205568331-205568353 CCTGGCCAGGTGCGGGAAGGAGG - Intergenic
920521056 1:206626752-206626774 CCGGGCCTGTCGTGGGGTGGAGG + Intergenic
920912670 1:210233019-210233041 CCGGGCTGGGCGCGGGCCGCGGG + Intronic
921923089 1:220690303-220690325 CCGGACGGGGCGGGGGATTGGGG - Exonic
922440514 1:225652589-225652611 CCGGGCCGGGAGAGGGAAGGCGG + Intronic
922505159 1:226121952-226121974 CCGGGCCGGGCGGGGTCTGGCGG - Intergenic
922716612 1:227878124-227878146 CAGGGCCTGTCGGGGGATGGGGG + Intergenic
923506449 1:234609751-234609773 CCGGCCCGGGCACGGGCGGGCGG + Intergenic
924527111 1:244863192-244863214 CCGGGGCGGGCGCGCTTTGGCGG - Intronic
924527490 1:244864684-244864706 CCGGGCCGAGAGCGCGGTGGAGG + Intergenic
924763140 1:247007710-247007732 CCGGGCCGGCAGCGGGATCCCGG - Intronic
924885832 1:248215502-248215524 CGGGGCCTGTCGGGGGATGGGGG + Intergenic
1063201090 10:3785691-3785713 CCGGGACGGGCGTGGGGTGGCGG - Intergenic
1063593148 10:7410979-7411001 CCGGAGCGGGCGCGCGAGGGAGG - Intronic
1063623023 10:7666740-7666762 CCGGGCCGGCGGAGGGAAGGGGG + Intronic
1064209031 10:13347970-13347992 GCGGGCCCGGCGCGGGGGGGAGG - Intronic
1064274232 10:13891875-13891897 GCGGGCCGGGCGCGGGCGAGGGG - Intronic
1065022350 10:21510446-21510468 CCGGCCGGAGCGCGGGCTGGCGG + Intergenic
1065025231 10:21534540-21534562 CCGGGCCGGGCGGGGGGCGCCGG + Intronic
1065092861 10:22252553-22252575 CCGGGCCGGGCCCGAGTCGGAGG - Intergenic
1065099534 10:22320637-22320659 CCGGCGCGGCCGCGGGCTGGCGG + Intronic
1065342909 10:24723435-24723457 CCCGGCCGGGCGCTGGCTCGGGG - Intronic
1067769899 10:49115543-49115565 GCGGGCCCGGGGCGGGCTGGCGG - Intergenic
1068548949 10:58385166-58385188 CCGGGCCAGGAGGGTGATGGAGG - Exonic
1068620633 10:59177200-59177222 CCGGGCCAGGCGGGCGAAGGCGG - Intronic
1068788392 10:61001570-61001592 CCGGGCCGGGAGCGAGGTGGCGG - Intergenic
1070151972 10:73811041-73811063 CGGGGCCGGGCCCGGGCTTGGGG + Intronic
1073097184 10:100987062-100987084 TGGGGCCGGGCTCGGGCTGGAGG - Intronic
1073325912 10:102643984-102644006 GCTGGCCGGGCGCGGGCTGCGGG - Intergenic
1073470784 10:103720889-103720911 CAGGGCCGGGCCCGGGGAGGGGG + Intronic
1074377403 10:112951338-112951360 CCGAGCCGGGCGCGGGGCCGGGG - Intronic
1074690767 10:116002158-116002180 CAGGGCCGGCAGGGGGATGGTGG + Intergenic
1074756473 10:116627673-116627695 CCGGGCCCTGCCAGGGATGGGGG - Intronic
1075430320 10:122374856-122374878 CGGGGCCAGGCGCGAGGTGGCGG + Intronic
1075936152 10:126343181-126343203 CAGGGCCTGTCGTGGGATGGGGG - Intronic
1076850058 10:133088297-133088319 CCGGGCCGGGCGCGCGGGGCGGG - Intronic
1076864377 10:133159974-133159996 CCGGGCGGGGCCCGGGGTGGGGG - Intergenic
1077008318 11:369383-369405 CGGGGCGGGGCGCGGGGTGCGGG - Intergenic
1077010273 11:376513-376535 CCGGGCTGGGCGGGGGCTGCTGG - Exonic
1077285634 11:1764053-1764075 CCGGGCGGGGGGCGGGGTGGTGG + Intergenic
1077302794 11:1854925-1854947 CCGGGCCAGGAGCGGGGAGGGGG + Intronic
1077306089 11:1869247-1869269 CCGGGCCTGGCCAGGGATGCTGG + Intronic
1077796914 11:5501920-5501942 CCGGGCCTGTCGGGGGTTGGGGG - Intronic
1077945016 11:6887731-6887753 CGGGGCCTGTCGGGGGATGGAGG - Intergenic
1078031227 11:7753397-7753419 CAGGGCCTGTCGGGGGATGGGGG + Intergenic
1078124272 11:8544163-8544185 CCGTGCCTGTCGGGGGATGGGGG - Intronic
1078346588 11:10555055-10555077 CCGGGCCTGTCGTGGGGTGGGGG - Intergenic
1080551448 11:33376534-33376556 ACGGCCCGGGCGCCGGAGGGAGG - Intergenic
1080870065 11:36229230-36229252 CCGGACCGGGAGCGGTAGGGGGG - Exonic
1081459499 11:43258814-43258836 CAGGGCCGGTTGCGGGTTGGGGG + Intergenic
1081831857 11:46121310-46121332 CCGGGCCGGAATCGGGAGGGGGG + Intergenic
1081832185 11:46122441-46122463 CCGGGAGGGGCGGGGGACGGGGG + Intergenic
1083039026 11:59668770-59668792 CGGGGCAGGGGGCGGGCTGGGGG - Intronic
1083272981 11:61581275-61581297 GCGGGCGGGGCGCGGGGCGGCGG - Intergenic
1083664594 11:64267583-64267605 CCAGGGCGGGCGCTGGGTGGAGG + Intronic
1083828065 11:65214168-65214190 CGTGGCCGCGCCCGGGATGGAGG - Intergenic
1083886595 11:65576230-65576252 CCGGGCCGGGCCAGCGGTGGCGG + Exonic
1083920839 11:65780846-65780868 GCGGGCCGCGGGCGGGAGGGAGG - Intergenic
1083940280 11:65891797-65891819 CCGGTCCCGGCGCCCGATGGGGG - Intergenic
1084330220 11:68425759-68425781 CTGGGCTGGGCTCGGGATGAAGG - Intronic
1084396507 11:68914388-68914410 CCTCGCAGGGCGTGGGATGGGGG + Intronic
1084399355 11:68934747-68934769 CCGGGCAGGGCGGGGCAAGGTGG - Intronic
1084892554 11:72243791-72243813 CCGAGTAGGGCGCGGGCTGGTGG + Exonic
1084946691 11:72642487-72642509 GCGGGCCGGGGGCGGGCGGGGGG - Intronic
1085266552 11:75241017-75241039 GCGGCCCGGGCGCTGGATGCGGG + Exonic
1085474819 11:76783256-76783278 CCCTGCCGGGCGCCGGGTGGCGG - Intronic
1085680920 11:78574482-78574504 CCTGGGCGGACGCGGGATGCTGG - Exonic
1087002892 11:93439249-93439271 CAGGGCCTGTCGAGGGATGGGGG - Intergenic
1087762097 11:102111592-102111614 CCGGGCCGGGCTGGGAAAGGGGG + Intronic
1088893044 11:114059539-114059561 CCGGGGACGGCGCGGGAGGGGGG + Intergenic
1089527648 11:119107655-119107677 CCGGGCGGGCCGCGGGGAGGAGG - Exonic
1089622140 11:119728405-119728427 CGGGGCTGGGAGCCGGATGGCGG - Intronic
1090784112 11:130033276-130033298 CCGGGCGGCGCGCGGGCTGCAGG - Intergenic
1090862173 11:130663696-130663718 CAGGGCCGGTCGCGGGGTGCGGG + Intergenic
1091373375 12:11185-11207 CCGGGCTGGGGGCGGGGGGGGGG + Intergenic
1091740753 12:2959237-2959259 CCGGGCCGGGCCGGGGCGGGCGG - Intergenic
1092002725 12:5045014-5045036 CAGGGGCGGGCGCGGGAGGCTGG - Exonic
1092046162 12:5432955-5432977 CTGGCCCGGGCGTGGGCTGGGGG + Intronic
1092496881 12:9005191-9005213 CCGGGCCTGTCGGGGGGTGGGGG + Intronic
1092860661 12:12716997-12717019 CCGGGCGAGGAGCGGGAGGGAGG + Intronic
1093502859 12:19832298-19832320 CAGGGCCTGTCGGGGGATGGGGG - Intergenic
1094016620 12:25871509-25871531 CCGGGCCTGTTGCGGGGTGGGGG + Intergenic
1094523746 12:31218646-31218668 CAAGGCAGGGCGGGGGATGGGGG - Intergenic
1095206309 12:39443441-39443463 CAGGGCGGGGCGCAGGCTGGGGG - Intergenic
1095752888 12:45729989-45730011 CCGGGCCGGGCACGGGGTCCCGG + Intronic
1096271095 12:50167053-50167075 GGGGGCCGGGCGCGGGCCGGGGG - Intronic
1096699350 12:53371842-53371864 CCGGGCCGGGCCGGGCGTGGTGG + Intergenic
1096796761 12:54082599-54082621 CGGGGCCGGGGCCGGGCTGGGGG + Intergenic
1097078530 12:56412681-56412703 CAGGGCCGGGCGGGGGGGGGCGG + Intergenic
1098106007 12:67069413-67069435 CCGGGCCGGGGGCGGGGAGCTGG + Intergenic
1098255438 12:68611095-68611117 CGGGGCCGGGCGCCGGCTGAGGG + Intronic
1099499183 12:83389851-83389873 CCTCGCAGGGCGTGGGATGGGGG - Intergenic
1100404708 12:94263198-94263220 CGGGGCCGGGGGCGGGGAGGCGG - Intronic
1100565449 12:95790332-95790354 CCGGGCCGGGCGGGTGCCGGAGG + Exonic
1101662036 12:106774589-106774611 CCGGCCCGGGCGGAGGCTGGCGG + Intronic
1101861639 12:108487017-108487039 CCGGGCCTGTCGTGGGGTGGGGG - Intergenic
1103649681 12:122422764-122422786 CGGGGCCGGGCGCGGGCCGCAGG - Intergenic
1103698413 12:122835222-122835244 CCGGGGTCGCCGCGGGATGGGGG + Intronic
1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG + Intronic
1103807555 12:123584949-123584971 CGGGGCGGGGCGGGGGGTGGCGG - Intronic
1104104320 12:125644739-125644761 TCTTGCCCGGCGCGGGATGGTGG - Intronic
1104981322 12:132574209-132574231 CCGGGCCCTGTGCGGGCTGGTGG + Intronic
1105000664 12:132687869-132687891 CCGGGCCGGGACCAGGCTGGGGG + Intronic
1105004254 12:132711085-132711107 TGGGGCCGGGGTCGGGATGGGGG + Intronic
1105422655 13:20266662-20266684 CCGTGCAGGGCGCAGGATGAAGG - Intergenic
1105445434 13:20451048-20451070 CCGGGCCTGTCGAGGGGTGGGGG + Intronic
1106022714 13:25930368-25930390 CTGGGCGGGGTGGGGGATGGGGG - Intronic
1107086558 13:36432393-36432415 CCGGGCCGGGCGGGGCAGGGCGG - Exonic
1108409117 13:50129971-50129993 CCAGGCGGGGCCCGGGGTGGCGG + Intronic
1108734359 13:53267213-53267235 CAGGGCCTGTCGCGGGGTGGGGG - Intergenic
1110861657 13:80350842-80350864 CGGGGCCTGTCGGGGGATGGGGG - Intergenic
1111262572 13:85760912-85760934 CCTGGCAGGGCGTGAGATGGGGG + Intergenic
1111364544 13:87224708-87224730 CGGGGCCTGTCGGGGGATGGGGG - Intergenic
1113241907 13:108347547-108347569 CGGGGCCTGTCGGGGGATGGGGG - Intergenic
1113541776 13:111115156-111115178 CCAGGCCGTGCGCGGGGCGGCGG - Intronic
1114618647 14:24081864-24081886 CCGGGCCTGGAGCTGGATGCCGG - Intronic
1114866016 14:26597192-26597214 CCGGGCCGCGGGAGGGAGGGAGG + Intronic
1115340435 14:32287926-32287948 CCGGGCCAGTCGGGGGAAGGGGG - Intergenic
1116432249 14:44859402-44859424 CAGGGCCTGTCGTGGGATGGGGG + Intergenic
1116673118 14:47869486-47869508 CGGGGCCTGTCGTGGGATGGAGG - Intergenic
1116905189 14:50396960-50396982 CCGGGCCGGGGGTGGGAAGCTGG - Intronic
1118092177 14:62494510-62494532 CAGGGCCTGTCGTGGGATGGGGG - Intergenic
1118752346 14:68816419-68816441 CCGGGCCGGGCGCGGGGCCCGGG + Intergenic
1118757221 14:68853853-68853875 CTGGGCAGGGTGCGGGGTGGAGG - Intergenic
1119016704 14:71064770-71064792 CCAGGCCTGTCGGGGGATGGGGG - Intronic
1120207523 14:81602415-81602437 CGGGGCCTGTCGCGGGGTGGGGG - Intergenic
1121115408 14:91339469-91339491 CCGGGCAGAGAGGGGGATGGAGG + Intronic
1121157466 14:91700086-91700108 CCGGGCCTGTCGAGGGGTGGGGG - Intronic
1121321892 14:92996421-92996443 CGGGGCCTGTCGCGGGGTGGGGG + Intronic
1122130854 14:99604033-99604055 CCGGTCCGCGCGCGGGCGGGGGG + Intergenic
1122444944 14:101761572-101761594 CGGGGCCGGGCGCGGGGGTGGGG + Intergenic
1122445060 14:101761928-101761950 CGGGCCCGGCCGCGGGACGGAGG + Intronic
1122467143 14:101941582-101941604 CGGGGCCTGTCGTGGGATGGGGG - Intergenic
1122582181 14:102777738-102777760 CCGCCCAGGGCGCGGGATGGAGG - Intronic
1122917278 14:104865059-104865081 CTGGGGCAGGGGCGGGATGGCGG + Intergenic
1122941129 14:104981879-104981901 GCGGGCAGGGCCCGGGATGGGGG - Intergenic
1123174127 14:106401334-106401356 CCGGGACGCGCGGGGGCTGGCGG - Intergenic
1123174158 14:106401441-106401463 CGGGGACGCGCGGGGGATGGCGG - Intergenic
1123182336 14:106482268-106482290 CCGGGACGCGCGGGGGCTGGCGG - Intergenic
1123182366 14:106482374-106482396 CGGGGACGCGCGGGGGATGGCGG - Intergenic
1202944537 14_KI270726v1_random:14356-14378 CGGGGACGCGCGGGGGATGGCGG + Intergenic
1202944567 14_KI270726v1_random:14462-14484 CCGGGACGCGCGGGGGCTGGCGG + Intergenic
1124232135 15:27954858-27954880 CAGGGCCAGGAGCGGGCTGGTGG + Intronic
1124640020 15:31391593-31391615 CGGGGGCGGGGGCGGGGTGGGGG - Intronic
1124640354 15:31392809-31392831 CGGGGGCGGGGGCGGGGTGGGGG - Intronic
1125474683 15:40039059-40039081 CCTGGCCGGCCGAGGGAAGGGGG - Intronic
1125518069 15:40333993-40334015 CAGGGCTGGGGGCAGGATGGCGG - Exonic
1125536160 15:40441871-40441893 CCGGGCCGGGGGCGGCAGGGGGG + Intronic
1126150903 15:45522824-45522846 CCGGGCGAGGCGCGCGAGGGAGG + Intergenic
1126483643 15:49155360-49155382 CCGGGCCCGGTGCGGGAACGGGG + Intronic
1128133919 15:65248919-65248941 CCAGGCTGGACGCTGGATGGTGG + Intronic
1128315107 15:66655121-66655143 CCGGGCCGGGAGCCGGGTGGGGG - Intronic
1128374430 15:67065436-67065458 GCGTGCTGGGCGCGGGGTGGTGG + Intronic
1128841339 15:70853823-70853845 CCGGGCCGCGCGCGAGTTCGGGG - Intronic
1129116567 15:73368293-73368315 CCGGGCCGGGGGCAGGAGCGCGG + Exonic
1129144242 15:73633084-73633106 GCGGGCCGGGCGGGGGTTGAGGG - Intronic
1129468500 15:75737689-75737711 CGGGGGCGGGGGCGGGGTGGGGG + Intergenic
1130296079 15:82647743-82647765 CCGCACGGGGCGGGGGATGGGGG + Intronic
1131431718 15:92393794-92393816 CGGAGCCGGGCGCGGGGCGGGGG + Intergenic
1131828450 15:96338875-96338897 GCTGGCCGGGCGGGGGGTGGTGG + Exonic
1132487664 16:203705-203727 CAGGGCGGGGGGCGGGGTGGAGG + Intronic
1132518696 16:377624-377646 CTTGGCCAGGCGCGGGAGGGTGG + Intronic
1132576267 16:665817-665839 CCGGGCCGGGGGCGGGATGGGGG + Intronic
1132582958 16:693822-693844 CTGGGCCCTGCCCGGGATGGGGG + Exonic
1132586014 16:706006-706028 CCGGGCCTGGCGCGTGCTCGTGG - Intronic
1132604578 16:788414-788436 GCGGGCCGGGGGCGGGCCGGGGG - Intergenic
1132765347 16:1531667-1531689 GCAGGCTGGGCGCGGGAGGGCGG - Intronic
1132934930 16:2475311-2475333 CCCGGCCACGCGCGGGTTGGGGG + Intronic
1132945997 16:2531773-2531795 CCCGGCCGGGCGCGGTCTGCGGG - Intergenic
1132947151 16:2537993-2538015 ACGGGGCGGGCGCAGGATGAGGG + Exonic
1132987817 16:2777189-2777211 CCGGGCCGGGCCGGGGGCGGCGG - Intronic
1133273770 16:4624808-4624830 CCGGGCCGAGCCGGGGGTGGGGG + Exonic
1136453942 16:30370078-30370100 CCGGGCCGGGCCCGTCGTGGTGG - Exonic
1136913978 16:34163853-34163875 CGGAGGCGGGCGCGCGATGGCGG - Intergenic
1136996096 16:35188886-35188908 CCGGGCTGGGGGCAGGGTGGAGG + Intergenic
1137914576 16:52415137-52415159 CAGGGCCAGTCGGGGGATGGGGG - Intergenic
1138398889 16:56730013-56730035 CGGGGCCGGGGGCGGGGCGGAGG - Intronic
1138472059 16:57245505-57245527 CCGGGCCGGGCCGGGCAGGGTGG + Intronic
1138855606 16:60687541-60687563 CGGGGCCTGTCGTGGGATGGGGG + Intergenic
1138986361 16:62333575-62333597 CGGGGCCTGTCGTGGGATGGGGG + Intergenic
1139418082 16:66830704-66830726 CCGTGCGGGGCGCGGGAAGCCGG - Intronic
1139597790 16:67968362-67968384 CGGGCGCGGGCCCGGGATGGCGG + Intronic
1140223061 16:73058082-73058104 GCGGGCCGAGGGCGGGAGGGCGG - Intronic
1140475576 16:75237965-75237987 CCGGGGCAGGCGCGGCAGGGAGG - Intronic
1141989615 16:87602596-87602618 GCGGGCCGGGCGCGGGGCGGCGG - Intronic
1141989889 16:87603543-87603565 CCGGGCCGGGCCGGGGCGGGAGG + Intronic
1142173593 16:88634966-88634988 CTGGGCGGGGCGCAGGATGCGGG + Intergenic
1142184167 16:88686525-88686547 TCGCGCCGGGCGCTGGTTGGCGG - Intergenic
1142412334 16:89923132-89923154 CTGGGCCGGGCGCGGTCTGAGGG - Intronic
1142586863 17:979460-979482 CCGGGCCGGGGCCGGGAGCGGGG - Exonic
1142764961 17:2059533-2059555 CCAGCCTGGGCTCGGGATGGGGG - Exonic
1142876206 17:2853419-2853441 CGGGGCCGGGCCGGGGAGGGCGG + Intronic
1142932736 17:3300844-3300866 CAGGGCCTGTCGTGGGATGGGGG - Intergenic
1142980596 17:3668936-3668958 CCGGGCCGGCCGGGAGGTGGTGG - Exonic
1143030360 17:3964138-3964160 CCGGGCCGGGCCGGGGAGCGGGG - Intronic
1143211572 17:5191889-5191911 CTGGGCGGGGCGCGGACTGGGGG - Intergenic
1143498137 17:7324078-7324100 CCGGGCTGGGCTGGGGCTGGGGG - Intronic
1143520167 17:7440225-7440247 CCGGGGCAGGCGGGGGCTGGGGG - Intronic
1143877409 17:10002563-10002585 CCGGGCCTGTTGTGGGATGGGGG - Intronic
1146654458 17:34626809-34626831 GGGGGCCGGGCCCGGGGTGGGGG + Intronic
1147123794 17:38352194-38352216 CCGGGCCGCGCGAGGAAGGGTGG - Intergenic
1147134725 17:38428386-38428408 CGGGGCCGAGCGCGGTGTGGGGG - Intergenic
1147315347 17:39617773-39617795 CCGTGCCAGGCGCGGGGCGGGGG - Intergenic
1147522953 17:41191976-41191998 CAGGGCCTGTCGGGGGATGGGGG + Intronic
1147554750 17:41470151-41470173 CAGGGCCTGTCGGGGGATGGGGG + Intergenic
1147580685 17:41625636-41625658 CAGGGCCGGGCTTGGGGTGGTGG - Intergenic
1147671635 17:42180157-42180179 CCTGGCCGGGATCTGGATGGTGG - Intronic
1147907554 17:43832924-43832946 GCGGGGCGGGCGCGGGAAGAGGG + Intronic
1147918131 17:43900622-43900644 CCTGGCCGGGCTGGGGAAGGCGG + Intronic
1147987589 17:44315351-44315373 GCGGGCCGGGCGGGGGATCCGGG + Intronic
1147987606 17:44315378-44315400 CCGGGGCGGGGCGGGGATGGGGG + Intronic
1148122758 17:45222271-45222293 GCGGGTCGGGCGCGGGCGGGGGG + Intronic
1148331984 17:46818734-46818756 CCGCGCTGGGCTCGGGAGGGGGG - Exonic
1148553500 17:48564419-48564441 CGGGGGCGGGGGCGGGGTGGGGG - Intronic
1148738790 17:49880435-49880457 CCAGGACGGGGGCAGGATGGGGG - Intergenic
1149064184 17:52460573-52460595 CGGGGCCTGGCGTGGGGTGGGGG + Intergenic
1149470896 17:56914229-56914251 GCGGGCTGGGCGCGGGACGCCGG + Intergenic
1149575323 17:57707856-57707878 CCGGGTCAGGAGCGGGGTGGAGG - Intergenic
1149626585 17:58084126-58084148 CCAGGCCGGGTGGGGGAGGGCGG + Intronic
1150210414 17:63438467-63438489 CCGGGCGGGGAGCGGGGTGGGGG - Intronic
1150460144 17:65343791-65343813 CGGGGCCTGTCGGGGGATGGGGG + Intergenic
1150488791 17:65560928-65560950 CCGGGCCGGCCGCGGCGTCGGGG + Intronic
1150823813 17:68457415-68457437 CCGGGCCGAGCCCCCGATGGAGG - Exonic
1150928512 17:69559429-69559451 CCGGGCCTGTCGTGGGGTGGGGG - Intergenic
1151005955 17:70436152-70436174 CTGGGCCTGTCGGGGGATGGGGG - Intergenic
1151426983 17:74037371-74037393 CTGGGCAGGGCTCGGGAGGGAGG + Intergenic
1151728239 17:75896670-75896692 CGGGGCCGGGGCCGGGATCGGGG + Exonic
1151954490 17:77373607-77373629 GTGGGCCTGGCGCGGGACGGGGG + Intronic
1152352926 17:79793392-79793414 TCCGGCCGGGCACGGGAAGGAGG - Exonic
1152396367 17:80035922-80035944 CCGGGCCGGGGGCGGGCCCGGGG - Intergenic
1152402425 17:80075552-80075574 CCGGGGCGGGCGGCAGATGGAGG - Intronic
1152407879 17:80107906-80107928 CCGGCCCGGGCGCTGGGCGGCGG - Intergenic
1152453827 17:80401291-80401313 CCGGACCGGGTGTGGGAGGGAGG - Intergenic
1152552001 17:81034784-81034806 CCGGGCTGGGGGCGGGGAGGCGG - Intergenic
1152703868 17:81833107-81833129 CGGGGCCGGGCGCGGGGGAGTGG - Intronic
1152720852 17:81923266-81923288 CTGGGCCGGGGGCGGGGGGGGGG - Intronic
1152744142 17:82031476-82031498 CCGGGCCGGGGTCGCGCTGGAGG + Intergenic
1152809877 17:82376367-82376389 CCGGGCTGGGGGCTGGAGGGGGG - Intergenic
1152959966 18:73644-73666 CCGGTCAAGGCACGGGATGGTGG - Intergenic
1153051467 18:906211-906233 CCCTGCCTGGCCCGGGATGGAGG + Intronic
1153805448 18:8705822-8705844 CCGGGCCGGGCGCGGCGGGCCGG - Intronic
1154241703 18:12658422-12658444 CGGGGCCGGGCGCGCGGTCGGGG + Intronic
1154927606 18:20952961-20952983 CAGGGCCTGTCGAGGGATGGGGG + Intronic
1154942932 18:21132624-21132646 CGGGGCAGGGCTCGGGATGTGGG - Intergenic
1158435893 18:57435533-57435555 CCGGGGTGGGGGCGGGGTGGGGG - Intergenic
1160201821 18:76802189-76802211 CCCGGCCGGGCGCCAGGTGGCGG + Intronic
1160766025 19:808461-808483 CCGGGGCGGCCCCGGGGTGGAGG + Intronic
1160766820 19:812542-812564 CGGGGCCGGGGGCGGGCGGGGGG - Exonic
1160821732 19:1062159-1062181 CCGGGCCACGCTGGGGATGGGGG - Exonic
1160873240 19:1286354-1286376 CGAGGCCGGGCGCGGCTTGGGGG - Intronic
1161153763 19:2721916-2721938 CCTGGGCAGGGGCGGGATGGGGG + Intronic
1161194684 19:2979807-2979829 CGGGGGCGGGCGGGGGAGGGGGG + Intronic
1161215817 19:3094592-3094614 CCGGGCCGGGGGCCGGGGGGCGG + Exonic
1161216193 19:3096015-3096037 CTGGGCCGGGGGCGGGGCGGTGG + Intronic
1161241131 19:3224612-3224634 CCGGGGCGGGCGCGGGCGGGAGG + Intergenic
1161273584 19:3403822-3403844 CCGGGCGCGGCGGGGGGTGGCGG - Intronic
1161948184 19:7452007-7452029 CCAGGCTGGGCGTGGCATGGTGG - Intronic
1162079315 19:8209210-8209232 CGGGGCCTGGCGCGGGGCGGGGG - Intronic
1162110365 19:8396708-8396730 CCGGGGGGGGGGCGGGAGGGAGG + Intronic
1162510666 19:11116240-11116262 CAGGGCCGGGCACAGGCTGGAGG + Intronic
1162515024 19:11142628-11142650 CGGGGGCGGGGGTGGGATGGGGG + Intronic
1162535724 19:11262165-11262187 CGGGGCTGGGAGCGCGATGGCGG - Intronic
1162731712 19:12722296-12722318 ACGGGCCGGGCGGGGGAGGGGGG - Intronic
1162778673 19:12995688-12995710 CCGGGCCGAGCGCGGGGCCGCGG + Exonic
1163248264 19:16110770-16110792 CCGGGCCAGCCCGGGGATGGTGG - Intergenic
1163370377 19:16897853-16897875 CCGGGCCGGGCCGGGGGTGCGGG + Intronic
1163660116 19:18571917-18571939 CCGGGCCGAGAGCGGGTTGGGGG + Intronic
1163786442 19:19277241-19277263 CCGGGGCGGGCGGGGGGGGGGGG + Intronic
1163807011 19:19405683-19405705 CCCAGCCGGGCGCGGGCGGGCGG + Intronic
1164812036 19:31164994-31165016 CCGGGACGGGCTCGGCAGGGTGG - Intergenic
1165245052 19:34493918-34493940 CCTGGCCTGGCAGGGGATGGAGG - Intronic
1165295772 19:34925032-34925054 CCTGGCAGGGCGTGCGATGGGGG + Intergenic
1165349509 19:35268485-35268507 CCGGGGCGGACGCGCGCTGGGGG - Intergenic
1165420061 19:35718079-35718101 CCGGGCCGGCCGCGGGGCGCCGG + Exonic
1165851390 19:38852053-38852075 CCGGGCCGGCCGCGGGGGCGGGG - Intronic
1165886704 19:39084157-39084179 CAGGGCGTGGCGCGGGAAGGGGG - Intronic
1166039113 19:40191589-40191611 CCGGGCCGGGCGGGGGTGGCGGG - Intergenic
1166853631 19:45771734-45771756 CGGGGCCGGGGCCGGGATGCGGG - Intronic
1167369845 19:49073939-49073961 CCGGAACGGGCGGGGGTTGGGGG + Intergenic
1167551317 19:50162915-50162937 CGGGGCTGGGCGAGGGATGCCGG - Intronic
1167638339 19:50667637-50667659 CCGGGCGGCGGGCGGGCTGGCGG + Exonic
1168251746 19:55145988-55146010 TCGGGCCGGGGGCGGGGGGGCGG - Intronic
925390127 2:3488941-3488963 CTGGGCTGGGCGGGGGCTGGAGG - Intergenic
925519170 2:4722486-4722508 CAGGGCCTGTCGCGGGGTGGGGG - Intergenic
927125966 2:20012614-20012636 GGGGGCCGGGCGCGGCATGGTGG + Exonic
927472414 2:23385861-23385883 CCGGGCCGGGCGTGGGAGCGGGG + Intronic
927751272 2:25673123-25673145 CCGGGCCGGGAGGGGTATCGGGG - Intronic
927881444 2:26692663-26692685 CGGGGCCGGGCGGAGGAGGGCGG + Intergenic
928022469 2:27715537-27715559 CCGGGCCGGGAGGGGGCTGCGGG + Intronic
928314069 2:30232413-30232435 CCGGGCCGGGCGCGGGGCGTCGG + Intronic
928717777 2:34082795-34082817 CAGGGCCTGTCGTGGGATGGGGG - Intergenic
928795908 2:35018415-35018437 CAGGGCCTGTTGCGGGATGGGGG + Intergenic
929242313 2:39665763-39665785 CCGGGCCGGGGGCGGGCGGGCGG + Intronic
930124352 2:47783898-47783920 CGGGGCGGGGGGCGGGGTGGCGG + Intronic
930803603 2:55468136-55468158 CAGGGCCTGGCGTGGGGTGGGGG + Intergenic
931602534 2:64019033-64019055 CCCGGCCGGGCGCCGGGCGGCGG - Exonic
931825520 2:65996622-65996644 CGGGGGCGGGGGCGGGGTGGGGG - Intergenic
932288223 2:70554100-70554122 CCGAGCAGGGCGCGGGCTGCTGG + Intronic
932567146 2:72917431-72917453 CGGGGCGGGGCGAGGGACGGCGG - Intronic
932830959 2:74989419-74989441 CCGGGCCTGTCGGGGGGTGGGGG + Intergenic
934113326 2:88762739-88762761 CTGGGCCTGTCGGGGGATGGGGG - Intergenic
934539048 2:95159593-95159615 CGGGGGCTGGCGCGGGGTGGCGG - Exonic
934539059 2:95159617-95159639 CGGGGGCTGGCGCGGGGTGGCGG - Intronic
934539070 2:95159641-95159663 CGGGGGCTGGCGCGGGGTGGCGG - Intronic
934539081 2:95159665-95159687 CGGGGGCTGGCGCGGGGTGGCGG - Intronic
935046714 2:99489783-99489805 CCGGGCCGGCGGCGGGGTGGGGG - Intronic
935112420 2:100105146-100105168 CGGGGCCGGGCGCGGGCGGGCGG - Intronic
935963444 2:108449250-108449272 GCGGGCCGGCGGCGGGCTGGCGG + Exonic
935971597 2:108534667-108534689 CCGGGCCTGGCGCGGGCGGGCGG + Intronic
936507092 2:113116486-113116508 CCAGGCGGGGCGGGGGGTGGGGG + Intronic
937221499 2:120345295-120345317 CCCGGCCGGGCGCGGGGCGCCGG - Intergenic
937912934 2:127085026-127085048 TGGGGCGGGGCGGGGGATGGAGG - Intronic
938099194 2:128486617-128486639 CGTGGCCGGGGGCGGGGTGGGGG + Intergenic
938796027 2:134718870-134718892 CCGGGGCGGCGGCGGGACGGTGG + Exonic
941029218 2:160493113-160493135 CCGGGCGGCGCGCGGGGCGGCGG - Intronic
941580616 2:167292815-167292837 GCGGGAGGGGCGCAGGATGGGGG - Intergenic
941808617 2:169734137-169734159 CGGGGCCGGGCGCGGGGAGCGGG + Intronic
941808625 2:169734156-169734178 CGGGGCCGGGCGCGGGCAGCGGG + Intronic
941929975 2:170929445-170929467 CGGGGCCGGCCGCGGGGAGGCGG + Intronic
942042996 2:172083256-172083278 CCGCGGCGGGCGCGGGGTCGGGG - Intergenic
942965773 2:181891662-181891684 CCGCGCGGGGCGCGGTAGGGCGG - Intergenic
944070011 2:195657624-195657646 GCGGGCCGCGCCCGGGGTGGGGG + Intronic
944192743 2:197020951-197020973 CTGGGCCTGTCGTGGGATGGGGG - Intronic
944615111 2:201451804-201451826 CGGCGCGGGGCGCGGGAGGGCGG - Exonic
945032943 2:205682242-205682264 GCGGGGCGGGCGAGGGGTGGTGG + Intronic
945102568 2:206275144-206275166 CCGGGCCGGGATCGAGGTGGCGG + Intronic
945251584 2:207769552-207769574 CGGGGCCGGGAGCCGGACGGAGG + Exonic
945849758 2:214991871-214991893 CAGGGCCTGTCGGGGGATGGAGG + Intronic
946177351 2:217929692-217929714 CCGGGGCGGGTGGGGGGTGGAGG - Intronic
946311214 2:218883567-218883589 CCGGGGCGCGCGGGGGAGGGAGG - Intronic
946326077 2:218985300-218985322 CCGGGCCGCGCGGGGGCCGGAGG - Exonic
946578249 2:221099979-221100001 CCGGGCCTGTTGTGGGATGGGGG - Intergenic
947549895 2:231038216-231038238 CCCGGCTGGGCGCGGGCGGGCGG + Intronic
947623350 2:231604673-231604695 CCGGGCCGGGCTGGGGCTGGGGG - Intergenic
947792472 2:232876125-232876147 ACGGGCGGGGCGGGGGAGGGAGG + Intronic
948142442 2:235683850-235683872 TGGGGCCGGGCGGGGGACGGGGG - Intronic
948205201 2:236159778-236159800 CAGGGCCGGGCCCGGGGTGGGGG - Intergenic
948886900 2:240889127-240889149 CAGGGCCTGGGGCAGGATGGAGG - Intronic
948958886 2:241316209-241316231 CAGGCCCGGGCGCGGGAGTGGGG + Intronic
1169088334 20:2840838-2840860 CCAGGCCGTGGGCGGGAGGGCGG - Intronic
1169306556 20:4495957-4495979 CCGGGCCTGTCGTGGGGTGGGGG - Intergenic
1169680190 20:8203551-8203573 CCAGGCCGGGGGTGGGGTGGGGG + Intronic
1170494080 20:16907588-16907610 CAGGGCCTGTCGTGGGATGGGGG - Intergenic
1170688115 20:18587726-18587748 AGGGGCTGGGCCCGGGATGGGGG + Intronic
1170998618 20:21391526-21391548 CGCAGCCGGGGGCGGGATGGTGG + Intergenic
1171185570 20:23121869-23121891 CAGGGCCAGGCACAGGATGGTGG + Intergenic
1172245875 20:33444428-33444450 TCGGGGAGGGCGGGGGATGGGGG + Intergenic
1172274928 20:33674253-33674275 CCGGGTCGGGCGCGAGCTGGGGG + Exonic
1172422030 20:34825655-34825677 CCGGACCGGGCCGGGGAGGGAGG + Intergenic
1172581971 20:36055554-36055576 CCGGGACGGGCTGGGGAGGGTGG - Intergenic
1174246828 20:49188084-49188106 CCGGGCCGGGCCGGGCCTGGTGG - Intronic
1174873980 20:54208180-54208202 GGGGCCCGGGCGCGGGATGCTGG + Intronic
1174908575 20:54579933-54579955 CAGGGCCTGTCGGGGGATGGAGG - Intronic
1175429342 20:58891162-58891184 CCCGGCCGGGCGCGGGCGGAGGG + Intronic
1175847496 20:62066165-62066187 CCGGGCGGGGCGCGGGATGCGGG + Intergenic
1175888029 20:62303180-62303202 CCGGGCCGGGCGGGGGTTCTGGG + Intronic
1176131608 20:63498885-63498907 CCGGGCTGGGCCCGGGGTGGGGG - Intronic
1176221150 20:63969843-63969865 CCGGGCCGGGCCGGGGCGGGGGG + Intronic
1176303842 21:5113373-5113395 CCGGGCCTGGCCGGGGAAGGTGG + Intergenic
1178104125 21:29299240-29299262 CCGGGGCGGGCGGGGGCTGGGGG + Intronic
1178714583 21:34952214-34952236 CGGGGCCTGTCGGGGGATGGGGG + Intronic
1179626895 21:42653934-42653956 CGGGGCCGGGCGCGGCGGGGCGG + Intronic
1179853188 21:44148577-44148599 CCGGGCCTGGCCGGGGAAGGTGG - Intergenic
1180064299 21:45405069-45405091 GCGGGGCGGGCGCGGGCAGGGGG - Intergenic
1180559188 22:16601849-16601871 CCGGGCGGGGAGCGGGCGGGCGG - Intergenic
1180650218 22:17370307-17370329 CGGGGCCGGGCGCGGGGGGGGGG + Intronic
1180871695 22:19150277-19150299 CCCGGCCGGGCCGGGCATGGCGG - Exonic
1180959623 22:19756737-19756759 CCGGGCCAGGTGAGGGAGGGAGG + Exonic
1181082918 22:20426052-20426074 CCGGGCCCGGGGCGAGATTGGGG - Exonic
1181094356 22:20495624-20495646 CGGGGGCGGGCGCGGGCCGGAGG - Intronic
1181283462 22:21735956-21735978 CCCGGCCGGGTGCGAGCTGGCGG - Intergenic
1182695595 22:32197560-32197582 CAGGGCCTGTCGTGGGATGGGGG - Intronic
1182785809 22:32906660-32906682 CCGGGCCTGTCGGGGGGTGGGGG - Intronic
1182804344 22:33057962-33057984 CCGGGCCGGGCGCTGGGTGGAGG + Intronic
1182903989 22:33920873-33920895 CCTGGCCGGGCGCGGGAGGCGGG - Intronic
1183294041 22:37019530-37019552 GCGGGGGAGGCGCGGGATGGCGG - Intronic
1183538277 22:38415622-38415644 CAGGGCAGGGCGCGGGAGGGCGG + Intergenic
1183606024 22:38867036-38867058 CCGGGCGGGGCAGGGGACGGCGG + Exonic
1183683789 22:39350272-39350294 CCGCCCCGGGCCCGGGAAGGAGG - Intronic
1184044879 22:41966808-41966830 CCTGGCAGGGAGCGAGATGGAGG + Intergenic
1184184271 22:42853910-42853932 CCCTTCCGGGCGTGGGATGGTGG + Intronic
1184342215 22:43892149-43892171 CCGGGGCGGGCGCGTGGGGGCGG - Intergenic
1184545568 22:45164606-45164628 CCGGGCGGGGCGCGCGGTGGGGG + Intronic
1184759720 22:46537521-46537543 GCGGGCCCGGCGCGGGGCGGGGG + Intergenic
1184766907 22:46576978-46577000 CCGAGCCGGCCGCGGGGCGGGGG + Intronic
1184827237 22:46960657-46960679 CCAGGCCAGGCGCGGCGTGGTGG + Intronic
1184996866 22:48213656-48213678 CTGTGCCGGGCAAGGGATGGAGG + Intergenic
1185133163 22:49052092-49052114 CGGGGCCGGGCCCGGGACCGAGG - Intergenic
1185413492 22:50697743-50697765 GCGGGCCCGGCGCGGGGAGGGGG + Intergenic
950586361 3:13895299-13895321 CCCCGCCGGGCTCGGGTTGGGGG - Intergenic
950650213 3:14402543-14402565 CCGGGCCGGGGGCGGGGCCGGGG - Intergenic
950683983 3:14603208-14603230 GGGCGCCGGGGGCGGGATGGCGG + Intergenic
951544480 3:23810792-23810814 CGGGGGCGCGCGCGGGGTGGGGG + Intronic
952788339 3:37176932-37176954 GGGGGCGGGGAGCGGGATGGAGG + Intronic
953246432 3:41198890-41198912 CCCGGCCGGGCGCGGGTTAGGGG - Intronic
953988842 3:47467878-47467900 CAGGGCCTGCCGGGGGATGGGGG - Intronic
954327184 3:49869938-49869960 CCGGGCCGGGGGCGGGCTGGGGG + Exonic
954401366 3:50321403-50321425 CTGGGCTGGGCCCGGGATGGCGG - Exonic
954469013 3:50675420-50675442 GCGGGGCGAGCGCGGGGTGGGGG + Intronic
954473866 3:50724674-50724696 CGGGGCCTGTCGGGGGATGGGGG + Intronic
954615533 3:51967296-51967318 GCGGGCCGGGCGGGGCACGGCGG - Intronic
954615593 3:51967501-51967523 CCGGGCGGGCCGGGGGGTGGGGG - Intronic
954795958 3:53161441-53161463 CGGGTCCGGGCGCGGGATCGGGG + Intronic
954812364 3:53256019-53256041 CGAGGCCGGGCGCGGGGCGGGGG + Exonic
954930700 3:54278822-54278844 CAGGGCCTGTCGGGGGATGGGGG + Intronic
958519663 3:95168698-95168720 CTGGGCCGGGCCCGGTGTGGTGG + Intergenic
958718963 3:97821973-97821995 CCGCGCCGGGCGAGGGCGGGAGG + Intergenic
958814673 3:98901952-98901974 CCGGGCCGGGCGGGGGCCGCGGG - Intergenic
959679494 3:109076815-109076837 CAGGGCCTGGCGGGGGATCGGGG + Intronic
961202565 3:125056111-125056133 CCGGGCGGGTCGCTGGCTGGCGG + Intergenic
961505461 3:127368291-127368313 CCGGGCTGGGCAAGGGGTGGGGG - Intergenic
961539436 3:127590073-127590095 CCCGGTCCGGCGCGGGGTGGCGG - Intronic
961545344 3:127629302-127629324 CGGGCCCGAGCGCGGGAGGGCGG + Intronic
961947996 3:130713960-130713982 CCGCGCCGGGCCTGGGATGAAGG + Intronic
962146189 3:132842549-132842571 CGGGGCCTGTCGTGGGATGGGGG - Intergenic
963038336 3:141051252-141051274 ACGGCCGGGGCGCGGGATGGTGG + Intergenic
963939753 3:151086515-151086537 CCCAGCTGGGCGCAGGATGGGGG - Intronic
964500781 3:157346017-157346039 CCGGGCCTGTCGTGGGGTGGGGG + Intronic
964720426 3:159763965-159763987 CCGGGCCGGGCCGGGGCGGGGGG + Intronic
965002685 3:162976557-162976579 CAGGGCCTGTCGTGGGATGGGGG - Intergenic
965433082 3:168612944-168612966 CCTGGCAGGGCGTGCGATGGGGG - Intergenic
965721959 3:171671980-171672002 CCAGGGCGGGGGCGGGGTGGGGG - Intronic
965852224 3:173041793-173041815 CCGGGGCTGTTGCGGGATGGGGG + Intronic
966570791 3:181440851-181440873 CAGGGCCTGTCGGGGGATGGGGG + Intergenic
966886464 3:184380208-184380230 CCGGGCCGGGGGCGGTGCGGCGG - Exonic
966919913 3:184604519-184604541 CGGGGCCGGGCGAGGGTGGGTGG + Intronic
967251217 3:187541231-187541253 CCGGGCCTGTCGTGGGGTGGGGG + Intergenic
968434169 4:576362-576384 CGGGGCCGCGGGCGGGGTGGGGG - Intergenic
968475568 4:805124-805146 CGGGGCCTGGAGCGGGAGGGAGG + Intronic
968657126 4:1783483-1783505 CAGGGATGGGGGCGGGATGGGGG + Intergenic
968657132 4:1783494-1783516 GCGGGATGGGGGCGGGATGGGGG + Intergenic
968815326 4:2818661-2818683 TCGGGCCGGGCGCGGTTGGGCGG + Intronic
968831395 4:2934439-2934461 CCGGGACGCACGCGGGATGGCGG - Exonic
968908051 4:3463556-3463578 GCGGGGCGGGCGGGGGACGGGGG + Intronic
969153196 4:5187608-5187630 AGGGGCCGGGCGGGGGAGGGGGG + Intronic
969244471 4:5923562-5923584 CAGGGCTGGGCGAGGGATCGGGG + Intronic
972958315 4:44419689-44419711 CGGGGCCTGTCGGGGGATGGGGG + Intronic
974047277 4:56908363-56908385 CCCCGCCGGGCGGGGGCTGGCGG + Intronic
975269154 4:72408904-72408926 CAGGGCCGGTCGGGGGGTGGGGG + Intronic
975983599 4:80184283-80184305 CCGGGGCGGGGGCGGGACGCCGG - Intronic
976032713 4:80776574-80776596 CCGGGCCTGTCGGGGGATGAGGG + Intronic
976265980 4:83186190-83186212 CCCGTCCGGGAGCGGGGTGGGGG - Intergenic
978541580 4:109821982-109822004 CTGGGCCTGTCGGGGGATGGGGG + Intronic
979134016 4:117085624-117085646 CCGGGCCTGGCGCCGGGTAGGGG - Intergenic
979711031 4:123779509-123779531 CGGGGCCTGTCGCGGGGTGGGGG - Intergenic
981531949 4:145761916-145761938 AGGGGCCGGGCGGGGGCTGGAGG - Intronic
981761886 4:148203642-148203664 CGGGGCGGGGGGAGGGATGGGGG - Intronic
985646658 5:1088192-1088214 CCGGGCCGGGGGCTGCCTGGGGG - Intronic
985660861 5:1155922-1155944 GCGGGGCGGGCGCGGGAGGCCGG + Intergenic
985784563 5:1887027-1887049 CCGGGGCGGGGGCGGGAGCGGGG + Exonic
985896300 5:2751570-2751592 CCGGGGCGGCGGCGGGGTGGCGG + Exonic
987340648 5:16936308-16936330 CGGGGCCGGCTGCGGGAGGGCGG - Intergenic
987340657 5:16936328-16936350 CGGGGCCGGCTGCGGGAGGGCGG - Intergenic
987340666 5:16936348-16936370 CGGGGCCGCGAGCGGGAGGGCGG - Intergenic
988061988 5:26183197-26183219 CAGGGCCTGTCGGGGGATGGGGG - Intergenic
988064453 5:26217478-26217500 CGGGGCCTGTCGGGGGATGGGGG - Intergenic
988577773 5:32444040-32444062 CCGGGCCGGGCCGGGCAAGGCGG + Intronic
989813774 5:45710816-45710838 CAGGGCCTGTTGCGGGATGGGGG + Intergenic
990410343 5:55535057-55535079 CCGGGCAGCGCGCGGGTTCGCGG + Intergenic
991198438 5:63961724-63961746 GCGCGCCCGGCGCGGGAAGGGGG + Exonic
991579903 5:68143935-68143957 CCGGGCCTGTCGGGGGGTGGGGG + Intergenic
991594449 5:68288488-68288510 CCGGGCGGGGCGTGGGGCGGAGG + Intronic
992335201 5:75760213-75760235 CGGGGCCTGTCGAGGGATGGGGG - Intergenic
992627547 5:78648865-78648887 CCGGCCCGCTCGCGGGACGGAGG - Intronic
993017508 5:82551711-82551733 CTGGGCCGGGGGTGGGGTGGGGG + Intergenic
993496875 5:88617601-88617623 CGGGGCCTGTCGTGGGATGGGGG - Intergenic
993566030 5:89476889-89476911 CAGGGCCTGTCGGGGGATGGGGG - Intergenic
994075669 5:95646834-95646856 CCGCGCAGGGGGCGGGCTGGCGG + Intronic
995048164 5:107672448-107672470 GCTGGCTGGGCGCGGGCTGGCGG - Intergenic
995854069 5:116574583-116574605 CAGGGCGGGGGGCGGGGTGGGGG + Exonic
996182626 5:120438188-120438210 CGGGGCCTGTCGCGGGGTGGGGG + Intergenic
997239171 5:132294354-132294376 CCCGGCCGGGCGCGGGGAAGGGG - Intronic
997239182 5:132294362-132294384 CCGCGCCCGGCCGGGGATGGGGG + Intronic
997470476 5:134114628-134114650 CCGGGCCGGGGGCGGGACACAGG - Intergenic
997521284 5:134525895-134525917 CTGGGGCCGGCGCGGGAGGGCGG - Intronic
998150692 5:139756029-139756051 CCTGGCGGGGCGCGGGAGGGCGG - Intergenic
998435888 5:142108697-142108719 CCGGGCCGGGCCGGGCAGGGCGG + Exonic
998644815 5:144050091-144050113 CGGGGCCTGTCGTGGGATGGGGG - Intergenic
998691025 5:144588594-144588616 CGGGGCCTGTCGTGGGATGGGGG - Intergenic
999322631 5:150624788-150624810 CTGGGCCTGGCGCGGGGCGGGGG + Intronic
999462919 5:151772213-151772235 CCGGGACGGGAGCGGGAGCGAGG - Intronic
1000467469 5:161597526-161597548 CAGGGCCTGTCACGGGATGGGGG + Intronic
1001375390 5:171251755-171251777 CGGGGGCGGGCGCGGGAGGAGGG - Intronic
1001653257 5:173329783-173329805 GCGGGCGGGGCGCGGGGCGGGGG - Intergenic
1001822981 5:174724497-174724519 CCAGGCCCGGCGCGGATTGGCGG + Intergenic
1001928726 5:175658092-175658114 CCGGCGCGGGCGCGGGACCGAGG + Exonic
1001984271 5:176060848-176060870 CAGGCACTGGCGCGGGATGGCGG - Intronic
1002021205 5:176365542-176365564 TCGGGCCGGGCGAGGGACGCAGG - Exonic
1002059913 5:176620165-176620187 CTGGGCTGGGCGCCGGGTGGGGG - Exonic
1002233205 5:177783217-177783239 CTGGCACTGGCGCGGGATGGCGG + Intronic
1002262774 5:178006564-178006586 CAGGCACTGGCGCGGGATGGCGG - Intronic
1002897804 6:1389540-1389562 CCGGGGAGGGCGAGGGAGGGAGG + Intergenic
1004043944 6:12009149-12009171 CCGGGCCGCGCGCTGGGCGGAGG + Intronic
1004262066 6:14117536-14117558 CCGGCCCGGGCGCGCGGGGGCGG + Intronic
1004270021 6:14186781-14186803 CCGGGGTGGGTGGGGGATGGGGG - Intergenic
1004312536 6:14558268-14558290 CCGGGCCTGTCGGGGGATGGGGG - Intergenic
1005048957 6:21666337-21666359 CCGAGCCGGGCGGGAGATGCGGG + Intergenic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1006047349 6:31308716-31308738 CCGGGCGGGACGTGGGAGGGAGG - Intronic
1006078061 6:31547059-31547081 CAGGGGAGGGGGCGGGATGGTGG - Intronic
1006134887 6:31889177-31889199 GGGGGCCGGGCGGGGGCTGGAGG + Intronic
1006300729 6:33192500-33192522 CCGGGCCGGGGGCGGGGGCGAGG - Intergenic
1007581118 6:42960752-42960774 CCAGGCGCGGCGCAGGATGGTGG + Exonic
1007702229 6:43771935-43771957 CCCGGCCGGGCGGGGGAGGGCGG - Intronic
1007844854 6:44745462-44745484 CAGGGCCTGTCGGGGGATGGGGG - Intergenic
1007927737 6:45663543-45663565 GCGGGCCGGGCTCGGGGCGGCGG - Intronic
1009487599 6:64244980-64245002 CCGGGCCTGTCGTGGGGTGGGGG - Intronic
1009947924 6:70361272-70361294 CAGGGCCTGTCGTGGGATGGGGG + Intergenic
1010251102 6:73708151-73708173 CGGGGCCTGTCGTGGGATGGGGG - Intronic
1010898914 6:81401507-81401529 CCGGGCCTGTTGCGGGGTGGGGG + Intergenic
1010980365 6:82364092-82364114 GCTGGCGGGGCGCGGGCTGGGGG + Intronic
1011735634 6:90308168-90308190 CCGGGCCTGCCGAGGGGTGGGGG + Intergenic
1013155739 6:107490061-107490083 CCGAGCCGGGGGCGGGCCGGGGG - Exonic
1013978216 6:116100829-116100851 CCGGGCCGGACGCGGCGGGGCGG - Exonic
1016340815 6:143060473-143060495 CCGGGCCGGGCGAGGGGGCGGGG - Intergenic
1017038078 6:150285132-150285154 CAGGGCAGGGCGGGGGGTGGTGG + Intergenic
1017339248 6:153301767-153301789 CCTGGCAGGGCGTGCGATGGGGG + Intergenic
1017725825 6:157275195-157275217 CGGGGCCGGGCGCGGGCGGCGGG + Intergenic
1017731811 6:157323637-157323659 CCGGCCCCGGCGCGGGAGGAGGG - Intergenic
1017954800 6:159169244-159169266 GCGGGCGGGGCGCGGGACGAAGG - Intergenic
1018727748 6:166627016-166627038 CCGGGCTGGGCGCGGGGCGATGG - Intronic
1018876732 6:167827451-167827473 GCGGGCCGAGCGGGGGCTGGCGG + Intronic
1019420097 7:946675-946697 CCTGGAGGGGCGCGGGGTGGGGG - Intronic
1019421765 7:954177-954199 CCGGGCCGGGCGCAGCGGGGGGG - Intronic
1019421831 7:954336-954358 CCGGGGTGGGCGCGGGGTGCCGG - Intronic
1019505116 7:1386714-1386736 CCAGGCCAGACGCGGGATGGCGG - Intergenic
1020080262 7:5282894-5282916 CGGGGCCGGGCGCGGGGGGCGGG + Intronic
1020113377 7:5460796-5460818 CGAGGCCGGGCTTGGGATGGAGG - Intronic
1020274330 7:6615600-6615622 CCGGGCCGGGGGCGGGGGCGCGG - Exonic
1020796806 7:12686837-12686859 CCGGGCGGCGCGCGGGCAGGGGG + Intronic
1021797629 7:24273133-24273155 CGGGGCCTGTCGTGGGATGGGGG - Intergenic
1022400183 7:30028816-30028838 CCGGGCCGGGGGCGCGCCGGGGG + Intronic
1022528309 7:31052309-31052331 CCAGGCTGGGCGCTGGAGGGAGG - Intergenic
1025018042 7:55456787-55456809 CAGGGCCTGTCGGGGGATGGGGG + Intronic
1025198662 7:56949303-56949325 CGGGGCCGAGCGCGGGGAGGCGG - Intergenic
1025673290 7:63627633-63627655 CGGGGCCGAGCGCGGGGAGGCGG + Intergenic
1025829784 7:65038701-65038723 CGGGGCCGGGTGGGGGGTGGCGG + Intergenic
1026740674 7:72976520-72976542 CCCGGGGGGGCGCAGGATGGGGG - Intergenic
1026827887 7:73595559-73595581 CCAGGCTGGGCCTGGGATGGAGG - Intronic
1026941263 7:74289376-74289398 CAGGGGCGGGCGCGGGAGGGCGG - Intergenic
1027103058 7:75388551-75388573 CCCGGGGGGGCGCAGGATGGGGG + Intergenic
1027495393 7:78881416-78881438 CGGGGCCTGTCGTGGGATGGGGG + Intronic
1028160115 7:87475737-87475759 CCGGGCCGGACGCGCGTGGGGGG - Exonic
1028319493 7:89441503-89441525 CCGGGCCTGTCGTGGGGTGGGGG - Intergenic
1029423610 7:100483958-100483980 CCGGGCGGAGCCCGGCATGGGGG + Exonic
1029441093 7:100586903-100586925 CCGGGCTGGGGGCGGGCGGGGGG + Intronic
1029483830 7:100827532-100827554 CGGCGCCGGGCCCGGGAGGGAGG + Intronic
1030138930 7:106285332-106285354 CCGGCACGGGCGCGGGAGGGCGG + Intronic
1030525944 7:110655285-110655307 CCGGGCCTGTCGTGGGGTGGGGG - Intergenic
1031668727 7:124517675-124517697 CGGGGCCTGTTGCGGGATGGGGG + Intergenic
1032068634 7:128790985-128791007 GCCGGCCGGGCGGGGGAGGGAGG + Intronic
1033662056 7:143408876-143408898 GCGGGCCGGGCGGGGGCGGGGGG + Exonic
1034323104 7:150203852-150203874 CCGGGCCGGGTGTGGTGTGGTGG - Intergenic
1034345727 7:150384154-150384176 CAGGGCCAGGCGTGGGAAGGGGG + Intronic
1034383671 7:150720517-150720539 CCGGGCCTTGCGCGAGCTGGTGG + Exonic
1034418639 7:150977944-150977966 CCGGGCCGGGCCGGGGTGGGTGG - Exonic
1034770077 7:153765252-153765274 CCGGGCCGGGTGTGGTGTGGTGG + Intergenic
1035117159 7:156534163-156534185 CAGTGCCGGGAGTGGGATGGTGG - Intergenic
1035167596 7:157000583-157000605 CGGGGGCGGGGGCGGGGTGGGGG + Intronic
1035404383 7:158588126-158588148 CCGGGCCGGGCGGGGAGCGGCGG - Intergenic
1036578942 8:10054762-10054784 TCGGGCGGGTCGCGGGGTGGGGG + Intronic
1036635547 8:10547724-10547746 CGGGGCGGGGCGGGGGGTGGGGG - Intronic
1037142973 8:15540211-15540233 CCTGGAAAGGCGCGGGATGGGGG - Intronic
1038126738 8:24682248-24682270 CAGGGCCTGTCGGGGGATGGGGG - Intergenic
1038963499 8:32548084-32548106 GCTGGCCGGGCGGGGGGTGGCGG - Intronic
1039518317 8:38151143-38151165 CAGGGCCAGGCGAGGGATGGAGG + Exonic
1039830928 8:41213723-41213745 CCGGGCCTGTCGGGGGATGGGGG + Intergenic
1040107124 8:43547467-43547489 CCGGACCGGGTGGGGGAAGGGGG - Intergenic
1041603547 8:59752141-59752163 CCGGGCCTGTCGTGGGGTGGGGG + Intergenic
1042926273 8:73971792-73971814 CCGGGCTGAGCGCGGGAGGGTGG - Intronic
1043502830 8:80873901-80873923 CGGGGCCGGGCCCGGGACAGGGG + Intronic
1044242514 8:89902907-89902929 CCGGGCCGGGACCGGGGTGGAGG + Intronic
1044548824 8:93489215-93489237 CAGGGCCTGTCGTGGGATGGGGG + Intergenic
1045571284 8:103371436-103371458 CCACGCCGGGCTCGGGGTGGGGG + Intergenic
1046436233 8:114192937-114192959 CCGGGCCTGTCGTGGGATGGGGG + Intergenic
1047654486 8:126961843-126961865 CCGGGCGGGGGGTGGGGTGGGGG + Intergenic
1047998471 8:130358246-130358268 CCAGGCCGGGCGGCGGGTGGCGG - Intronic
1047998614 8:130358719-130358741 CCGGGCCGGGGGCGGGGCGCGGG - Intronic
1049406301 8:142453113-142453135 CCGGGCCGGGCCGGCGAGGGGGG - Intronic
1049408743 8:142463185-142463207 CAGGGCCTGGGGAGGGATGGAGG - Intronic
1049442871 8:142617222-142617244 CAGGGACGGGCACGGGGTGGGGG - Intergenic
1049639336 8:143707595-143707617 CCGGGCCGGGGGCGGGGTGGGGG - Intronic
1049697912 8:143992625-143992647 CTTGGCCGGGGGCGGGATGCTGG + Intronic
1049784504 8:144444117-144444139 CCGGGCCCGGGCCGGGATCGGGG - Intronic
1049792722 8:144479349-144479371 CCGGGCTGGGGTTGGGATGGGGG + Intronic
1049801945 8:144521967-144521989 CTGGGCTGGGCTCGGGCTGGAGG + Exonic
1049883083 9:11159-11181 CCGGGCTGGGGGCGGGGGGGGGG + Intergenic
1050090696 9:2015163-2015185 CCCGTCCGGGCGCGGGTTGGCGG - Intergenic
1051655726 9:19379971-19379993 GCGGGCCGGGAGCGCCATGGTGG - Intronic
1052068317 9:24050602-24050624 CAGGGCCGGTCATGGGATGGGGG - Intergenic
1052459417 9:28743337-28743359 CGGGGCCTGTCGGGGGATGGGGG - Intergenic
1053004159 9:34593266-34593288 CCGGGCCGAGCCAGGGAGGGGGG + Intergenic
1053569362 9:39288235-39288257 TGGGGCCGGGCGCGGCTTGGCGG - Intronic
1053835321 9:42129277-42129299 TGGGGCCGGGCGCGGCTTGGCGG - Exonic
1054090991 9:60847219-60847241 TGGGGCCGGGCGCGGCTTGGCGG - Intergenic
1054112402 9:61122775-61122797 TGGGGCCGGGCGCGGCTTGGCGG - Intergenic
1054127783 9:61330775-61330797 TGGGGCCGGGCGCGGCTTGGCGG + Intergenic
1054595303 9:67059354-67059376 TGGGGCCGGGCGCGGCTTGGCGG + Intergenic
1056773930 9:89498014-89498036 CCGGGCCGGGGAGGGGGTGGCGG + Intronic
1057199883 9:93134295-93134317 GCGGGCCGGGGGCGGGCCGGGGG - Intergenic
1057594983 9:96408050-96408072 CCGGGCCTGTCGCGGGGTGGCGG + Intronic
1058208245 9:102134776-102134798 CAGGGCCAGTCGGGGGATGGGGG + Intergenic
1058346645 9:103971536-103971558 CAGGGCCTGGTGGGGGATGGGGG - Intergenic
1059080081 9:111239500-111239522 CGGGGCCTGTCGCGGGGTGGAGG - Intergenic
1059414861 9:114156207-114156229 CCGGGCCAGGCGCGGCAGGGCGG - Intronic
1060106773 9:120877425-120877447 CGGGGGCGGGCGGGGGCTGGCGG - Intronic
1060191741 9:121598400-121598422 CCGGGCCAGGCCCGGGGTGAGGG - Intronic
1060700958 9:125748065-125748087 CCGGGCCCGGCGCGGGGCGATGG + Intronic
1061149176 9:128819200-128819222 CCGGGCCGGTCGCGGAATGCGGG + Intronic
1061212671 9:129202919-129202941 CCGGGCGGGGCGGGCGCTGGTGG - Intergenic
1061608944 9:131733353-131733375 CCGGGGCGGGGGCGGGGGGGGGG + Intronic
1061754335 9:132802310-132802332 CAGGGCAGGGGGCGGGAGGGGGG + Intronic
1062230602 9:135479804-135479826 GCGGCCCGGGCGCGGGGCGGCGG + Exonic
1062230648 9:135479930-135479952 GCGGGCCGGGGGCGGGCCGGAGG - Exonic
1062272214 9:135714723-135714745 AGGGACCGGGCGCGGGGTGGGGG + Intronic
1062306070 9:135907669-135907691 GCGGGGCGGGCGCGGGCTGGCGG - Intergenic
1062389377 9:136327897-136327919 CCGGGCTGGGCTCGGCCTGGAGG - Intronic
1062425023 9:136502156-136502178 CCGGGCCTGGCGTGGGAGGTGGG + Intronic
1062467444 9:136687461-136687483 CGGGGCGGGGCGCGGCGTGGGGG + Intergenic
1062476022 9:136727977-136727999 CCGCGCGAGCCGCGGGATGGGGG - Intergenic
1062596506 9:137302168-137302190 CCGGGCCCGGCCGGGGACGGCGG + Exonic
1062629932 9:137458994-137459016 CAGGGCGGGGTGCGGGAAGGCGG + Intronic
1062659172 9:137619274-137619296 GCGGGCCGGGCGGCGGCTGGGGG + Intronic
1062696412 9:137878246-137878268 CCGGGCGGGGACCGGGGTGGGGG + Intronic
1062738115 9:138149954-138149976 CCGGTCAAGGCACGGGATGGTGG + Intergenic
1187067413 X:15854596-15854618 TCGGGGCGCGCGCGGGGTGGCGG + Intronic
1187915519 X:24149708-24149730 CTGGGCCGGGCTCCGGCTGGTGG - Intronic
1187960740 X:24564218-24564240 CCTGGCCCGGCCCGGGATGATGG + Intronic
1190450197 X:50571717-50571739 CAGGGCCTGTCGGGGGATGGGGG + Intergenic
1190881522 X:54495584-54495606 CTGGCCCGGGCCCGGGCTGGGGG - Exonic
1191004183 X:55692865-55692887 CGGGGCCTGTCGGGGGATGGAGG + Intergenic
1191201462 X:57786976-57786998 CAGGGCCTGTCGGGGGATGGTGG + Intergenic
1193513088 X:82430574-82430596 CGGGGCGGGGCGGGGGGTGGAGG - Intergenic
1193969968 X:88039134-88039156 CCGGGTCGGGCGGGGGGCGGGGG - Intergenic
1194953135 X:100150733-100150755 CAGGGCCTGTCACGGGATGGGGG - Intergenic
1195923294 X:110002968-110002990 CCGGGCGGGCCGCGGGCTGGGGG + Intronic
1197695010 X:129540628-129540650 CGGGGCGGGGCGGGGGAGGGCGG + Intronic
1197754309 X:129983712-129983734 CCGGGCCGGGCGCGGCGGGGAGG + Intronic
1197792329 X:130268560-130268582 CAGGGCCCGGCGCAAGATGGTGG + Intronic
1197952490 X:131912925-131912947 CCGGGCCTGTCGTGGGGTGGGGG - Intergenic
1198128548 X:133671808-133671830 CGGGGCCTGGCGTGGGATGGGGG - Intronic
1198201502 X:134423949-134423971 CAGGGCCGGTCGTGGGATGGGGG + Intronic
1198527079 X:137512284-137512306 CAGGGCCTGTCGCGGGGTGGGGG + Intergenic
1198534721 X:137574568-137574590 GCGGGCAGGGCGCGGGAGTGGGG - Intronic
1199976598 X:152898128-152898150 CCGGGCCGGGCCGGGGAGGCAGG - Intergenic
1200058882 X:153475233-153475255 CAGGGCCGTGGTCGGGATGGGGG - Intronic
1200092537 X:153642640-153642662 CCAGGCCGGGTGGGGGGTGGGGG - Intronic
1200128681 X:153829976-153829998 GTGCGGCGGGCGCGGGATGGAGG - Intronic
1200217527 X:154374672-154374694 GCGGGGCGGGCGCGGGGCGGGGG - Intergenic
1200400246 X:156015688-156015710 TCGGTCGGGGCACGGGATGGTGG - Intergenic
1200958605 Y:8974421-8974443 CTGGGCCGGTTGGGGGATGGGGG + Intergenic