ID: 907186318

View in Genome Browser
Species Human (GRCh38)
Location 1:52612136-52612158
Sequence CAGTGGGTATGGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907186318_907186330 23 Left 907186318 1:52612136-52612158 CCTTCCTCCCTCCATACCCACTG No data
Right 907186330 1:52612182-52612204 TCCCCTCACTGTGCCCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907186318 Original CRISPR CAGTGGGTATGGAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr