ID: 907189364

View in Genome Browser
Species Human (GRCh38)
Location 1:52635395-52635417
Sequence CTCAAGGAATGGTGGCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907189359_907189364 2 Left 907189359 1:52635370-52635392 CCAGAGAATTCGGAGACTATGGT No data
Right 907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG No data
907189356_907189364 6 Left 907189356 1:52635366-52635388 CCCACCAGAGAATTCGGAGACTA 0: 1
1: 0
2: 1
3: 12
4: 90
Right 907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG No data
907189348_907189364 17 Left 907189348 1:52635355-52635377 CCACCCCCCACCCCACCAGAGAA 0: 1
1: 1
2: 39
3: 1693
4: 10874
Right 907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG No data
907189347_907189364 18 Left 907189347 1:52635354-52635376 CCCACCCCCCACCCCACCAGAGA 0: 1
1: 0
2: 45
3: 1544
4: 11192
Right 907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG No data
907189354_907189364 10 Left 907189354 1:52635362-52635384 CCACCCCACCAGAGAATTCGGAG 0: 1
1: 0
2: 0
3: 5
4: 77
Right 907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG No data
907189357_907189364 5 Left 907189357 1:52635367-52635389 CCACCAGAGAATTCGGAGACTAT No data
Right 907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG No data
907189351_907189364 12 Left 907189351 1:52635360-52635382 CCCCACCCCACCAGAGAATTCGG No data
Right 907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG No data
907189344_907189364 27 Left 907189344 1:52635345-52635367 CCCTCATTCCCCACCCCCCACCC 0: 1
1: 1
2: 42
3: 361
4: 2454
Right 907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG No data
907189349_907189364 14 Left 907189349 1:52635358-52635380 CCCCCCACCCCACCAGAGAATTC No data
Right 907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG No data
907189350_907189364 13 Left 907189350 1:52635359-52635381 CCCCCACCCCACCAGAGAATTCG 0: 1
1: 0
2: 0
3: 16
4: 153
Right 907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG No data
907189346_907189364 19 Left 907189346 1:52635353-52635375 CCCCACCCCCCACCCCACCAGAG 0: 1
1: 12
2: 1344
3: 10084
4: 10535
Right 907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG No data
907189345_907189364 26 Left 907189345 1:52635346-52635368 CCTCATTCCCCACCCCCCACCCC No data
Right 907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG No data
907189353_907189364 11 Left 907189353 1:52635361-52635383 CCCACCCCACCAGAGAATTCGGA No data
Right 907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG No data
907189355_907189364 7 Left 907189355 1:52635365-52635387 CCCCACCAGAGAATTCGGAGACT No data
Right 907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907189364 Original CRISPR CTCAAGGAATGGTGGCAGAT GGG Intronic
No off target data available for this crispr