ID: 907190290

View in Genome Browser
Species Human (GRCh38)
Location 1:52642273-52642295
Sequence TGGTGCTGCTGAGCGGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907190278_907190290 20 Left 907190278 1:52642230-52642252 CCCTGGGGTGGGAGCAGGTGAGG 0: 1
1: 0
2: 8
3: 58
4: 602
Right 907190290 1:52642273-52642295 TGGTGCTGCTGAGCGGGGTCAGG 0: 1
1: 0
2: 1
3: 21
4: 237
907190280_907190290 19 Left 907190280 1:52642231-52642253 CCTGGGGTGGGAGCAGGTGAGGA 0: 1
1: 0
2: 8
3: 80
4: 640
Right 907190290 1:52642273-52642295 TGGTGCTGCTGAGCGGGGTCAGG 0: 1
1: 0
2: 1
3: 21
4: 237
907190276_907190290 26 Left 907190276 1:52642224-52642246 CCAGGTCCCTGGGGTGGGAGCAG 0: 1
1: 3
2: 7
3: 84
4: 535
Right 907190290 1:52642273-52642295 TGGTGCTGCTGAGCGGGGTCAGG 0: 1
1: 0
2: 1
3: 21
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907190290 Original CRISPR TGGTGCTGCTGAGCGGGGTC AGG Intronic
900106293 1:982528-982550 GGGTGCAGCTGAGCGGAGCCAGG - Intergenic
900527396 1:3135905-3135927 TGGGGCTGCAGAGCGGGGCAGGG + Intronic
900685168 1:3943697-3943719 TGGGGCTGCTGAGCCTGGACCGG - Intergenic
900942717 1:5811405-5811427 TGGTGCTGATGGGCGGGGGGTGG - Intergenic
901077921 1:6566985-6567007 GGGTGCTGGGGAGAGGGGTCAGG + Intronic
902378919 1:16043581-16043603 GGGTGCTGCTGGACGGGGGCTGG - Intergenic
902498227 1:16889585-16889607 TGGTCCTGCCGGGCGGGCTCTGG + Intronic
902510648 1:16965324-16965346 TGGTGCTCCTGGTCGGGGTGGGG + Intronic
903341827 1:22659531-22659553 CGGTGCAGCTGAGCTGGGCCTGG - Exonic
903786424 1:25864161-25864183 TGGTGCTGCTGTGTGGAGCCTGG - Intronic
904094530 1:27966725-27966747 TGGTACTGCTGCTCTGGGTCTGG + Exonic
904884609 1:33726647-33726669 TGGTGCCGCTGGGCGAAGTCAGG + Exonic
906660860 1:47580645-47580667 TGGTGCAGCTCAGCAGGGACAGG - Intergenic
906661817 1:47588311-47588333 TGGAGCCGCTGAGCAGGCTCCGG - Intergenic
907190290 1:52642273-52642295 TGGTGCTGCTGAGCGGGGTCAGG + Intronic
910679040 1:89843775-89843797 TGGTCCAGGTGCGCGGGGTCGGG + Exonic
910802788 1:91162381-91162403 TGGGGCTGCTGTGCGGTGTGTGG + Intergenic
911715805 1:101131497-101131519 TGGTGGTGTTGAGGGGGGTATGG - Intergenic
915331453 1:155115225-155115247 TGGGGCTGCTGTGCTGGGACTGG + Intergenic
915902374 1:159855970-159855992 TGCTGCTGCTGCGGGGGCTCCGG - Exonic
917443287 1:175085343-175085365 TAGTGCTGGGGAGAGGGGTCTGG + Intronic
919764190 1:201115638-201115660 GGGTGCTGCGGAACGGGGTGCGG - Exonic
922753445 1:228081830-228081852 TTGTGCTGCTGTGAGGGGTTGGG - Intergenic
922994410 1:229944471-229944493 GGGAGCTGCTGAGCGGTGCCAGG + Intergenic
923460560 1:234206224-234206246 TGGAGCAGCAGAGCTGGGTCAGG + Intronic
924666182 1:246074177-246074199 TGGTGCTACTGACCTGGGCCAGG - Intronic
1063092484 10:2879604-2879626 TGGTTTTGCTGAGCTGGGTTTGG + Intergenic
1066167947 10:32808323-32808345 TGGTGCTGCTGACAGGTTTCTGG - Intronic
1067064316 10:43095134-43095156 TGGGGCTGCTGTGCAGGCTCAGG + Intronic
1067155954 10:43781634-43781656 TGGTGCTGATGTGTGGGGGCTGG + Intergenic
1067192941 10:44087650-44087672 TAGAGCTGCTGAGTGGGTTCAGG - Intergenic
1069729856 10:70603487-70603509 GGGTGCTGGTGAGAGTGGTCTGG + Intergenic
1069909286 10:71749876-71749898 TGGCTCTGCTGAGCTGGGCCTGG - Exonic
1069932448 10:71891865-71891887 TGGTGCTGCTGGGAGGGTACAGG - Intergenic
1072799597 10:98383965-98383987 TGGGGCTGGTTAGAGGGGTCCGG + Intronic
1075588033 10:123671394-123671416 TGGTGTGGCTGAGCGGGGGAGGG - Intronic
1077254304 11:1573508-1573530 AGGGGATGCTGAGCGGGGTTTGG + Intergenic
1077566240 11:3302408-3302430 TGGCGCTGCTGGGCAAGGTCAGG + Intergenic
1078660745 11:13283614-13283636 TGGTGCGGCTGAGTGAGGTAAGG - Intronic
1080440450 11:32289418-32289440 TGGTGCTGCCGAGGTGGTTCAGG - Intergenic
1083457315 11:62787529-62787551 TGCGGCTGCGGGGCGGGGTCAGG + Intronic
1084209381 11:67614051-67614073 TGGTGCTTCTGAACAGGCTCAGG + Intergenic
1084438370 11:69157083-69157105 TTGTGCTGCTGAGCTGTGTTTGG + Intergenic
1085515783 11:77111111-77111133 GGATGCTGCTGAGTAGGGTCTGG + Intronic
1087015594 11:93551555-93551577 TGCTGCAGCTGAGGGGAGTCAGG - Intergenic
1087919748 11:103852983-103853005 TGATGCTGCTCAGAAGGGTCAGG - Intergenic
1088455855 11:110032396-110032418 TTGTGCTGCTGATCGGACTCTGG + Intergenic
1089126415 11:116179636-116179658 TGGGGCTGCTGAGCAGAGCCTGG + Intergenic
1089426638 11:118382416-118382438 TGGTGCGGCTGGGCGGGGGGTGG - Intronic
1089453769 11:118613889-118613911 TGGTGCAGGTGAGTGGGATCAGG + Exonic
1089499409 11:118923702-118923724 TGTTGCTCCTGAGTGGGGTGGGG - Intronic
1089928773 11:122287533-122287555 AGGTGCTGCTGAGGGGGGCCTGG + Intergenic
1090125630 11:124080418-124080440 TGGTGCTGCTGAGCTCTGTCTGG + Intergenic
1091154814 11:133362611-133362633 TGGGGCTGAAGAGCGGGGGCTGG + Intronic
1091552534 12:1547444-1547466 TGGTGCTGCAGAGCTGGCTGAGG + Intronic
1092728967 12:11510526-11510548 TGATGCTGTTGAGTGGGGTCTGG - Intergenic
1095098999 12:38162300-38162322 TGGTGCTGGTGAGGTGTGTCTGG - Intergenic
1095857115 12:46872568-46872590 TGGTGGTGGTGAGCAGGGTTAGG - Intergenic
1096783097 12:54001935-54001957 TGGTGCTGCAGAGGGTGGTGAGG + Intronic
1097978833 12:65716177-65716199 TGGTGCTGCAGGGCAGGGGCAGG + Intergenic
1100397301 12:94196257-94196279 TGGGCCTGCTGGGAGGGGTCGGG + Intronic
1104185001 12:126422164-126422186 AGGTGCTTCTGAGCAGGGCCAGG + Intergenic
1104795054 12:131511535-131511557 AGGTGCTGCTGAGAGAGGCCTGG + Intergenic
1106497832 13:30296933-30296955 GTGTGCTGCTGGGCGGGCTCGGG - Intronic
1107039696 13:35935681-35935703 TGGAGCTCCTGAGAGGAGTCAGG + Intronic
1112909925 13:104469135-104469157 TGGTTCTTCTGAGGGGGGTGAGG + Intergenic
1113842359 13:113367345-113367367 TGGTGCTGCAGAGCTGGCTGGGG + Intergenic
1117483267 14:56169545-56169567 TGTTGCTGCTGCGTGGGGTGTGG + Intronic
1117648652 14:57879601-57879623 TGGTGGTGTTGAAAGGGGTCAGG - Intronic
1119190581 14:72679463-72679485 TGGAGCTGCTCAGCTGGGGCTGG - Intronic
1121341468 14:93107645-93107667 GGGGGATGCGGAGCGGGGTCTGG + Intronic
1122159103 14:99769881-99769903 GGGTTCTGCTGAGCTTGGTCTGG + Intronic
1122848990 14:104516537-104516559 GGGTGCTGCTGAGAGGGGCCAGG - Intronic
1122883863 14:104701962-104701984 TGGTGCAGCAGTGCGGGGACTGG - Intronic
1123063064 14:105603026-105603048 GGGTTCAGCTGAGCGGGGTTGGG - Intergenic
1123706040 15:22951708-22951730 TGTGGGTGCTGCGCGGGGTCAGG - Intronic
1124004627 15:25785927-25785949 TGGTGGGGCTGTGCGGGGTCCGG + Intronic
1128606492 15:69040073-69040095 GGGTCCTGCTGGGCTGGGTCTGG - Intronic
1129681769 15:77662256-77662278 TGGGGCAGCTGAGCAGGGTGGGG - Intronic
1129803981 15:78438649-78438671 TGGTGTTGCTGACGGGGGCCAGG - Intronic
1130273553 15:82464817-82464839 TGGAGGTGGTGAGCGGGGTGTGG + Intergenic
1130465904 15:84192188-84192210 TGGAGGTGGTGAGCGGGGTGTGG + Intergenic
1130498361 15:84481348-84481370 TGGAGGTGGTGAGCGGGGTGTGG - Intergenic
1130588193 15:85196784-85196806 TGGAGGTGGTGAGCGGGGTGTGG + Intergenic
1132744774 16:1432062-1432084 TGGCGCTGCTGAGCCGGAGCTGG - Intergenic
1133031343 16:3012739-3012761 TGCTGCGGCTGAGTGGGGACAGG - Exonic
1134509343 16:14833910-14833932 TGCTGCTGCTGAGCGGCGTGGGG + Exonic
1134697048 16:16232725-16232747 TGCTGCTGCTGAGCGGCGTGGGG + Exonic
1134974795 16:18561960-18561982 TGCTGCTGCTGAGCGGCGTGGGG - Exonic
1135042156 16:19125823-19125845 TGGTTCTGCTGATCTGGGCCAGG - Intronic
1136115717 16:28093087-28093109 TGGAGGTGCTGAGTGGGGGCAGG - Intergenic
1138027032 16:53530211-53530233 TGGTGCTGCTGAGTGAGGAAAGG + Intergenic
1139547978 16:67658602-67658624 AGGTCCTGCAGAGCCGGGTCTGG + Exonic
1140497326 16:75400528-75400550 AGGTGCTGCTGAAGGGGATCTGG - Intronic
1141393239 16:83681780-83681802 TGGGGCTGCAGAGAGGGGCCAGG + Intronic
1142187240 16:88700451-88700473 TGGTGCGGCTGAGCAGGCTGTGG - Intronic
1142603892 17:1071251-1071273 TGGTGCTGATGTGCAGCGTCTGG - Intronic
1142767798 17:2075473-2075495 TGCTGCTGTCGGGCGGGGTCAGG - Intronic
1143171731 17:4934250-4934272 TCCTGCTGCTGAGCTGGGTTGGG + Exonic
1144667981 17:17115035-17115057 TGGTGCTGCAGTGCGTGGGCTGG - Intronic
1144852047 17:18248810-18248832 TGGTGCTGCTCAGTGTGGCCTGG + Exonic
1145991648 17:29082614-29082636 TGTGGCTGCTGAGTGGGGACAGG - Intronic
1147563326 17:41522049-41522071 TGTGGCTGCGGGGCGGGGTCTGG - Exonic
1147965162 17:44190734-44190756 TGGTGCTGTTGGGTGTGGTCTGG + Exonic
1151577106 17:74958420-74958442 TGCTGCTTCTGAGCGGGGAGCGG - Exonic
1152336876 17:79703693-79703715 CGGTGGTGGTGAGAGGGGTCAGG + Intergenic
1152535892 17:80950159-80950181 TGGTGCTGCAGAGGGGCCTCTGG - Intronic
1153329974 18:3863726-3863748 TGGTGGGGCTGAGCGGGCCCTGG - Intronic
1157316491 18:46594168-46594190 TGGAGCTGCTTGGCGGGGTTGGG + Intronic
1160722760 19:604613-604635 GGGTTGTGCTGGGCGGGGTCAGG + Intronic
1160722772 19:604656-604678 GGGTTGTGCTGGGCGGGGTCAGG + Intronic
1161720135 19:5897855-5897877 TGGTGAAGCTGGGCGGGCTCTGG - Intronic
1162567546 19:11452764-11452786 TGGGGCCGCTGAGTGGGGTGGGG + Exonic
1162800765 19:13109415-13109437 TGGTGCTGCTCAGCTGGTCCAGG + Exonic
1163157236 19:15446135-15446157 TGTGGCTGCTGAGGGGGGCCAGG - Intronic
1163416977 19:17192816-17192838 TGCTGCTGCAGAGCTGGTTCCGG + Exonic
1163601544 19:18252130-18252152 TGGGGCTCCAGTGCGGGGTCAGG + Exonic
1165093410 19:33397925-33397947 TGGGGCTGCTGAGTTGGGCCAGG + Intronic
1166873001 19:45882288-45882310 TGGGTCTGCAGAGCTGGGTCAGG + Intergenic
1166898564 19:46040294-46040316 TGGAGCCGCAGAGCCGGGTCTGG + Exonic
1167358196 19:49016679-49016701 TGCTGCTGCTGAGCATGGGCGGG - Exonic
1167359694 19:49023568-49023590 TGCTGCTGCTGAGCATGGGCGGG - Exonic
1167361437 19:49032517-49032539 TGCTGCTGCTGAGCATGGGCGGG + Exonic
1167362216 19:49036268-49036290 TGCTGCTGCTGAGCATGGGCGGG - Exonic
1167363867 19:49044590-49044612 TGCTGCTGCTGAGCATGGGCGGG + Exonic
1167364631 19:49048337-49048359 TGCTGCTGCTGAGCATGGGCGGG - Exonic
1167365916 19:49054973-49054995 TGCTGCTGCTGAGCATGGGCGGG - Exonic
1167426356 19:49431652-49431674 TGGAGCTGGTGGGCGTGGTCAGG - Intronic
925669688 2:6297633-6297655 AGGGGCTGCTGGGCTGGGTCAGG + Intergenic
925985491 2:9211737-9211759 TGTTGCTGCTAGGAGGGGTCTGG - Intronic
926165973 2:10522368-10522390 TGGGGGAGCTGAGCAGGGTCGGG - Intergenic
927238895 2:20902520-20902542 TGGGGCTGCTGGGTGGGGTGAGG + Intergenic
927515078 2:23667608-23667630 TGGTGACGCTGAGCAGGGCCTGG - Intronic
928192532 2:29185986-29186008 TGGTGGTGCTGAGAAGGGGCAGG + Intronic
932344166 2:70984941-70984963 TCGTGCTCCGGAGTGGGGTCTGG - Exonic
933043390 2:77499422-77499444 TGGTGTAGCTGGGCAGGGTCAGG - Intronic
936045998 2:109188388-109188410 GGCTGCTGCTCAGCGGGGTCTGG + Intronic
937906347 2:127054707-127054729 AGGGGCTGCTGGGAGGGGTCAGG - Intronic
938065609 2:128280500-128280522 TGGTGCTGCGGCACTGGGTCAGG - Intronic
938120710 2:128631317-128631339 TGATGCTGCTGGGTGGGGCCAGG - Intergenic
944271306 2:197786788-197786810 TGGAGGTGCTCAGCGGGGCCGGG - Intergenic
946144099 2:217715695-217715717 TGGTTCTGCTGACCTGGGCCAGG - Intronic
946647125 2:221849583-221849605 AGGTGCTGCTGAGGCGGGCCAGG - Intergenic
946832403 2:223740034-223740056 TGGGGCCGCTGAGCGGGGGTGGG + Intergenic
947250421 2:228096701-228096723 TGGTGCTGCTGGGTGCCGTCTGG + Intronic
947542805 2:230990427-230990449 TGCTGCTGATCAGCGGGCTCTGG + Intergenic
947672629 2:231948041-231948063 GGGTGCTGCTGAACGGGAACGGG + Intergenic
948467190 2:238158264-238158286 TGGTGGGGCTGAGCGGGGCCTGG - Intergenic
948703937 2:239777948-239777970 TCGTGCTGCTGAGCTGGCCCAGG + Intronic
948811010 2:240478455-240478477 TGTTCCTGCTCAGGGGGGTCTGG - Intergenic
948821757 2:240553387-240553409 TGGGGCTCCTGAGTGGGGACAGG - Intronic
948860311 2:240749775-240749797 TGGTGCTGCTCAGCCTGCTCCGG - Intronic
1169183889 20:3595437-3595459 TGGTGCTACTCAGCAGGGTTTGG + Intronic
1171419932 20:25011355-25011377 TGGGGCCACTGAGAGGGGTCCGG - Intronic
1172118509 20:32584855-32584877 CGCTGCTGCTGCGCGGGGGCTGG - Intronic
1175288929 20:57860298-57860320 AGGTGCTGCTGAGAGGGGTTTGG - Intergenic
1175831526 20:61967516-61967538 TGGTGCTGAGGGGCGGGGTGGGG - Intronic
1175965797 20:62659631-62659653 TGGGGAGGCAGAGCGGGGTCTGG + Intronic
1176080091 20:63268101-63268123 TGATGGTGCTGAGCGAGGTCTGG + Intronic
1176242396 20:64081113-64081135 TTGCGCTGCTGAGCGGGGGCGGG + Intronic
1176289252 21:5035541-5035563 TGGGGCTGCTGAGGGTGGTGGGG - Intronic
1176413562 21:6461825-6461847 AGGTGCTGCAGAGGTGGGTCAGG - Intergenic
1176447414 21:6831830-6831852 TGGTGTTGGTGGGCGGAGTCCGG + Intergenic
1176825582 21:13696856-13696878 TGGTGTTGGTGGGCGGAGTCCGG + Intergenic
1178092084 21:29174757-29174779 GGATGCTGCTGAGCTGGTTCGGG + Exonic
1179051436 21:37891867-37891889 TGGTGGTGCTGGGCTGGGTGTGG + Intronic
1179098632 21:38337197-38337219 TGGAACTGCTGAGTGGGGTGGGG - Intergenic
1179689060 21:43070148-43070170 AGGTGCTGCAGAGGTGGGTCAGG - Intronic
1179867983 21:44228063-44228085 TGGGGCTGCTGAGGGTGGTGGGG + Intronic
1179883412 21:44302865-44302887 TGGTGCTGTTGAGCAGGGGAGGG + Intronic
1180235796 21:46458795-46458817 TGGTGTTGCTGGGCGGGGCCGGG + Intergenic
1181731053 22:24847067-24847089 GGGTGCTGGAGAGCGAGGTCAGG - Intronic
1181768879 22:25111611-25111633 TGGGTCAGGTGAGCGGGGTCTGG + Intronic
1183654388 22:39176428-39176450 GGGTGCTGCTGTGCCGTGTCGGG - Intergenic
1183667612 22:39254518-39254540 TGGTGCTGCTGACCTGGGCTGGG + Intergenic
1184244970 22:43231244-43231266 TGGCAGTGCAGAGCGGGGTCAGG - Intronic
1184358021 22:43995646-43995668 GGGTGCCCCTGAGCCGGGTCTGG + Intronic
1184664356 22:45979270-45979292 GGGCGGGGCTGAGCGGGGTCCGG + Intergenic
1184773623 22:46612433-46612455 TGGTGGTGTTGAGCAGGCTCAGG + Intronic
1185394316 22:50578934-50578956 TGCTGCTGCTCAGCAGGGCCAGG + Exonic
954426446 3:50445861-50445883 AGGTGCTCCTGAGCAGGCTCTGG + Intronic
957592984 3:82224983-82225005 TGGTGCTCCTGAGCCGGGAAAGG - Intergenic
959981097 3:112518715-112518737 TGGTGCTGTTGAGCTGCATCAGG - Intergenic
961252680 3:125520135-125520157 TGGAGCTGCCGCTCGGGGTCCGG + Exonic
961743378 3:129047318-129047340 TGCTGCCGCTGAGCAGGGGCTGG + Intergenic
962301131 3:134244151-134244173 TGGTGGTGGTGATAGGGGTCAGG - Intronic
962688257 3:137868218-137868240 TGCTGCTGCTGCTGGGGGTCAGG - Intergenic
963273313 3:143306643-143306665 AGGTGCTGCTGACCTGGGTCAGG - Intronic
964544568 3:157819708-157819730 TGATGCTGCTGAGTGGTTTCTGG - Intergenic
967830259 3:193912602-193912624 TGGTGCTGCTGTGTGGAGTGAGG - Intergenic
967976043 3:195035374-195035396 GGGAGCTGCTGTGCGGGGTGTGG - Intergenic
969268218 4:6080062-6080084 TGATGCTGCTGAGCTGGGTCAGG - Intronic
975585057 4:75940878-75940900 TGCTGCTGCTGGCCGGGGCCGGG - Exonic
985865406 5:2510434-2510456 TGCTGCTGCTGAGTGGACTCGGG - Intergenic
986721632 5:10564469-10564491 TGGTGCTGCTGGCCGGGACCGGG + Exonic
990289523 5:54334294-54334316 TGGTGCTGGTAAGTGGGGACAGG - Intergenic
990333198 5:54747514-54747536 TGATGCTGCTGGGAGGGGTTGGG - Intergenic
991005983 5:61828472-61828494 AGTTTCTGCTGAGTGGGGTCAGG + Intergenic
991422191 5:66453124-66453146 TGGTGCTGCTGAGCTGCTCCAGG + Intergenic
992752672 5:79875364-79875386 TGGAGCTGGTGAGCGGCATCGGG - Intergenic
996085568 5:119301441-119301463 TGCTGCTGCTGAGAGAGGACTGG - Intronic
996329516 5:122312755-122312777 TGGTGCTGATGAGCGAGGGGCGG - Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
999281635 5:150370001-150370023 TGCGGCTGCTGAGAGGGTTCTGG + Intronic
1001555319 5:172632981-172633003 TCTTGGTGCTGGGCGGGGTCAGG - Intergenic
1002054422 5:176590478-176590500 TGGTGCTGGTGAGTGCGGGCAGG + Exonic
1002075750 5:176707540-176707562 TGGTGCTGCTGGACCGGGCCTGG + Intergenic
1009347127 6:62627518-62627540 TGGTTCTGCTGATCTGGGCCAGG + Intergenic
1012397904 6:98821155-98821177 TGGTGTTTCTGAGCGGGGCAGGG - Intergenic
1015504264 6:133965519-133965541 TGGTGGTGCTGAGGGGAGTGGGG - Intronic
1019294559 7:266971-266993 GGCTGCTGCTGTGTGGGGTCTGG + Intergenic
1019565201 7:1675618-1675640 TGGGGCCGAGGAGCGGGGTCTGG + Intergenic
1019617770 7:1973971-1973993 TGATGCTGCTGGGCGGGGACAGG + Intronic
1022811105 7:33869838-33869860 TGTGGCTGCTGAGCGAGGGCTGG + Intergenic
1026521711 7:71123541-71123563 GAGTCCTGCTGAGCAGGGTCAGG + Intergenic
1029306825 7:99625695-99625717 TGATGCTGCTGTGTGGGGTGAGG + Intronic
1032403222 7:131638103-131638125 TGGTGCTGATGAGCAGGGCGGGG + Intergenic
1032504638 7:132425932-132425954 TGGGGCCACTGAGCAGGGTCAGG - Intronic
1034850559 7:154489529-154489551 TTGTGATGCTGAGCAGGTTCTGG + Intronic
1036826961 8:11984632-11984654 TGGTGCAACTGAGAGGGATCTGG - Intergenic
1037131847 8:15415786-15415808 TGGTTCTGCTGAGCTGGGCATGG - Intergenic
1037646688 8:20798959-20798981 TGGTGTTGCTCACTGGGGTCTGG - Intergenic
1041698843 8:60765642-60765664 TGCTGCTGCTGAGCTTGGTAGGG + Intronic
1044147300 8:88732950-88732972 TGATGCTGCTGAAGGGGGTTGGG + Intergenic
1046654006 8:116874070-116874092 TGGTGGGGCTGGGCGGGGTGGGG - Intronic
1048230576 8:132636583-132636605 TGCTGCAGCTGAGCCTGGTCAGG - Intronic
1048991591 8:139763699-139763721 AGGTGCTGGTAAGCGGGGACAGG + Intronic
1049331386 8:142055978-142056000 TGGAGCTGGTGAGAGGGGCCAGG - Intergenic
1050972304 9:11893234-11893256 TGGGGCTGCTGTGCGGGGTGGGG + Intergenic
1052894559 9:33735053-33735075 TGGTGCTGTTGAGCAGGGAATGG + Intergenic
1053046426 9:34922985-34923007 GGGTGCTGCTGGGCCGGGCCTGG + Intergenic
1053153848 9:35760242-35760264 TGGGGCTGATGGGCGGGGTGGGG + Intergenic
1053169397 9:35868037-35868059 TGTTGCTGCTGGGCGGGGTGAGG + Intergenic
1056762914 9:89427623-89427645 AGGTGCTGCTGACCGGGGGGTGG - Intronic
1057404865 9:94760263-94760285 TGTTGCTGCTGTGCCAGGTCTGG + Exonic
1057746932 9:97759887-97759909 TGGAGCTGCTAAGAGGGGCCAGG + Intergenic
1059740629 9:117146139-117146161 TAGAGCTGCTGAATGGGGTCGGG - Intronic
1060479126 9:124007829-124007851 TGGTGCTGGGGACTGGGGTCGGG - Intronic
1060789960 9:126479277-126479299 TAGTGCTGCTGAGATGGGCCGGG - Intronic
1061218618 9:129236205-129236227 TGCTGCTGCGGGGCGGGGTCAGG + Intergenic
1061968984 9:134033655-134033677 TGCTGCTGCTGAGCCTGGACGGG + Exonic
1062005275 9:134235664-134235686 TGGTACTGCTAGGCGGGGGCAGG + Intergenic
1062037962 9:134391087-134391109 TGGTGCTGCTCAGCGGGCCGTGG + Intronic
1062231934 9:135486705-135486727 TGGAGCAGCTGGGCGGGCTCCGG + Exonic
1203521777 Un_GL000213v1:52701-52723 TGGTGTTGGTGGGCGGAGTCCGG - Intergenic
1188074679 X:25760506-25760528 TGGTGCTGATGAGCCTGGTCAGG - Intergenic
1189047048 X:37604515-37604537 TAGTTCTGCTGAGCTGGGTCAGG + Intronic
1189567164 X:42254894-42254916 TGGTGCTGTTGAGGGGGGCGGGG + Intergenic
1190301068 X:49057873-49057895 TGGTGGTGGTGGGCGGGGTGAGG + Intronic
1191740915 X:64434542-64434564 TGGGGGTGTTGAGAGGGGTCTGG - Intergenic
1196948303 X:120850443-120850465 TGGTGCTGTTGGGCGGGGGGTGG - Intergenic
1199248256 X:145631477-145631499 TGGTGCTGCTCAGCTGGTCCAGG - Intergenic
1199374240 X:147088350-147088372 TGGTGGTGATGGGCGGGGTAGGG - Intergenic
1200154117 X:153966292-153966314 GGGTGCTGGAGAGCGGGGTGGGG - Intronic
1200177189 X:154125475-154125497 GGCTGCTGCGGAGCGGGGGCTGG - Intergenic
1201310727 Y:12596360-12596382 GGGTGCTGGGGAGAGGGGTCAGG + Intergenic
1201707806 Y:16956045-16956067 ATTTGCTGCTGAGAGGGGTCTGG - Intergenic
1201763007 Y:17559061-17559083 TGGTGCTGGTGAGGTGTGTCTGG + Intergenic
1201838545 Y:18346928-18346950 TGGTGCTGGTGAGGTGTGTCTGG - Intergenic
1201942571 Y:19475584-19475606 AGGTGCTGCGAAGAGGGGTCTGG + Intergenic