ID: 907193536

View in Genome Browser
Species Human (GRCh38)
Location 1:52668214-52668236
Sequence AATAGCTGGGGAAAGTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907193529_907193536 23 Left 907193529 1:52668168-52668190 CCTGGTTGGAATTGATTGCAACA 0: 1
1: 0
2: 0
3: 25
4: 596
Right 907193536 1:52668214-52668236 AATAGCTGGGGAAAGTCTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 193
907193528_907193536 28 Left 907193528 1:52668163-52668185 CCTCTCCTGGTTGGAATTGATTG 0: 1
1: 0
2: 0
3: 7
4: 161
Right 907193536 1:52668214-52668236 AATAGCTGGGGAAAGTCTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907193536 Original CRISPR AATAGCTGGGGAAAGTCTGA AGG Intronic
902658475 1:17885612-17885634 GATAGCTGAGCAAAGGCTGAAGG - Intergenic
903916479 1:26768245-26768267 TAAAGCTAGGGAAAGTCTGTGGG + Intronic
905467260 1:38164637-38164659 AAAGGCAGGAGAAAGTCTGAAGG - Intergenic
905664959 1:39757888-39757910 AAAAGTTGCTGAAAGTCTGATGG + Exonic
907193536 1:52668214-52668236 AATAGCTGGGGAAAGTCTGAAGG + Intronic
907220417 1:52903375-52903397 AATAGCATGGGAAAGGGTGAGGG - Intronic
907446429 1:54510966-54510988 AATAGCTGGGGATAGGTAGAAGG + Intergenic
915020955 1:152777920-152777942 AATAGATGGGGAGAGAGTGAGGG - Intronic
916026565 1:160838313-160838335 GATAGATGGGGAAGGGCTGAGGG + Intronic
917337019 1:173934872-173934894 AAGAACTCTGGAAAGTCTGATGG + Exonic
919390480 1:196977816-196977838 AATAGCTGAGGATAATTTGAAGG + Intronic
919509512 1:198443851-198443873 AATCACTGTGGAAAATCTGAAGG + Intergenic
919638631 1:200028682-200028704 AAAAACTGGGGAAAGGCAGAAGG - Intronic
919825219 1:201498720-201498742 AATAGCTGAGGAATGAATGAAGG + Intronic
920181507 1:204134725-204134747 ACAAGCTGGGGAAATTCTGGAGG + Intronic
922748587 1:228060445-228060467 CCTACCTGGGGAAAGCCTGAAGG + Exonic
922850559 1:228730191-228730213 AATTGCTGGGGAAGTTCAGAGGG + Intergenic
924175532 1:241387726-241387748 AAAAGCTGGAGTAAGTGTGATGG - Intergenic
1065183983 10:23155026-23155048 AGTAGAGGGGGAAAGACTGAAGG + Intergenic
1067248525 10:44566995-44567017 AATAGCTTGGGTGAGTCTGAAGG - Intergenic
1068995610 10:63199580-63199602 AAAATCTAGGAAAAGTCTGAAGG - Intronic
1069750221 10:70740752-70740774 AATAGGTGGTGTATGTCTGAAGG + Intronic
1070422085 10:76247096-76247118 GATAGCTGGGGCAAGAGTGAAGG - Intronic
1072307959 10:94125975-94125997 AAGAGCTGGGGTAATTCAGATGG - Intronic
1072308482 10:94131364-94131386 AAGATGTGGGGAAAGTGTGAGGG - Intronic
1072857554 10:98965274-98965296 AATAGCTCAGGAAAGTATAAAGG + Intronic
1074199931 10:111225587-111225609 AATCCCAGGGGAGAGTCTGAAGG + Intergenic
1082039463 11:47673004-47673026 AATAGCTGGGGAGACTATGAAGG + Intronic
1084838499 11:71825263-71825285 AATTGCTTGAGAAAATCTGAAGG + Intergenic
1085697614 11:78718527-78718549 CATAGCTGGGAAGAGTCAGAAGG - Intronic
1086822547 11:91452292-91452314 AAAAGGTGTGGAAAGCCTGAGGG + Intergenic
1089042462 11:115465455-115465477 AATACCTGGGGAAAGGTTGTGGG - Intronic
1092178297 12:6426338-6426360 ATCAGCTGGTGAAAATCTGAAGG - Intergenic
1094618055 12:32054187-32054209 ACATGCTGGGGAAAGCCTGAGGG + Intergenic
1096459892 12:51816296-51816318 GATAGCTGGGCAAAGTATGGAGG - Intergenic
1097263190 12:57731097-57731119 AATTGCTGGGCCAAGTCTGATGG - Intronic
1098499257 12:71171410-71171432 AATAACTGGGGAAACTGTGGTGG - Intronic
1098604015 12:72367906-72367928 AATAGCTCTGGCAAGTCAGAAGG + Intronic
1099251923 12:80266773-80266795 AATAGCTAAGGAATCTCTGATGG + Intronic
1099965446 12:89440459-89440481 AATGGCTGGGGGAAGGATGAAGG + Intronic
1100377835 12:94033881-94033903 AACAGCTGGTCAAAGTCTGTAGG + Intergenic
1100664181 12:96732922-96732944 GAGAGCTGGGGAAAGAATGAAGG - Intronic
1101640435 12:106582786-106582808 AATAGAAGGGGGAAGTCGGAGGG + Intronic
1101974161 12:109340845-109340867 AATGGTTGGGGAAAGTCTTAAGG + Intergenic
1105990934 13:25620079-25620101 AATAGCTAGGGATTTTCTGAAGG + Intronic
1106703994 13:32261046-32261068 AGCAGCTGGGCAAAGTCTGATGG - Intronic
1107566515 13:41610874-41610896 AACAGCTGGGGAATGTCCGAGGG + Intronic
1107790500 13:43997521-43997543 AATTGCTGTAGAAAGCCTGAAGG - Intergenic
1107951181 13:45463832-45463854 ATTGTCTGGGTAAAGTCTGAAGG - Intergenic
1108131004 13:47300375-47300397 AATAGCTGAGGACAGTGTGGAGG + Intergenic
1111132445 13:83995044-83995066 AATAGCTGGAGGAATTCTTAAGG + Intergenic
1111701891 13:91700448-91700470 AATATCTTGTGAAAGTCTGAAGG + Intronic
1111953164 13:94726950-94726972 AACAGCTGGAGAAATTCTGTAGG + Intergenic
1111975792 13:94966263-94966285 AATAGGTTGGGAAACTTTGAAGG - Intergenic
1112633355 13:101186107-101186129 AACAGCTGGAGATAGTCTGTGGG - Intronic
1113354976 13:109570359-109570381 AAAAGCTGGAGAAACTCTGTGGG - Intergenic
1114061723 14:19024303-19024325 AAAAAATGGGGAAACTCTGAAGG - Intergenic
1114100538 14:19375703-19375725 AAAAAATGGGGAAACTCTGAAGG + Intergenic
1114157432 14:20120594-20120616 AATAGCTGGGGACCTTGTGACGG - Intergenic
1114314486 14:21496828-21496850 AATAGCAGAGGAAAGGGTGAAGG + Exonic
1115479412 14:33846489-33846511 GATAACTGGGGACAGTCTCATGG - Intergenic
1117480887 14:56143449-56143471 ATCAGCTGGTGAAAGTCTAAGGG - Intronic
1119997206 14:79266328-79266350 TATAGCTGGAGAAAATCAGAAGG - Intronic
1120262432 14:82203194-82203216 AATATTAGGGGTAAGTCTGAAGG - Intergenic
1122030531 14:98908368-98908390 AATAGGTGGGGAAGGAGTGAGGG - Intergenic
1122692344 14:103537365-103537387 AATTGCCAGGGAAAATCTGAGGG - Intergenic
1122981482 14:105194163-105194185 CAGAGCTGGGGAGAGACTGACGG - Intergenic
1126871721 15:52996473-52996495 AATAATTGGGTAAAGTGTGAAGG + Intergenic
1127664430 15:61131490-61131512 ACTTCCTGGGGAAAGACTGAGGG + Intronic
1128303371 15:66581385-66581407 ACTGGCTGAGGAAAGCCTGAGGG - Intergenic
1128397491 15:67243131-67243153 AATAATTGGGGAAAGTCAGTGGG + Intronic
1129250934 15:74308634-74308656 AAGAGCTGGCTAAAGGCTGAAGG - Intronic
1129267976 15:74404187-74404209 ATTCGCTGGGGAAAGACTAAGGG + Intergenic
1130985959 15:88844689-88844711 AAGAGTAGGGGAAAGTTTGATGG + Intronic
1131224822 15:90615792-90615814 AAATGCTGGGAAAAGTTTGAAGG - Intronic
1134374737 16:13661351-13661373 AAAAGCTGAGGAAAGGGTGAGGG - Intergenic
1135237355 16:20770142-20770164 CATAGTTGGAGAAATTCTGAGGG - Exonic
1135793706 16:25422053-25422075 ATTAGCTGGGTACAGCCTGAGGG - Intergenic
1137731765 16:50694982-50695004 GATAGCTGGGCAAAGTCATAAGG + Intronic
1138229835 16:55328806-55328828 CACAGCTGGGGACAGGCTGACGG + Exonic
1139270973 16:65682220-65682242 AATAGCTTGAGAAATTCTGATGG + Intergenic
1139476476 16:67205082-67205104 AATGGCAGGGGGAAGTCTGAGGG - Intergenic
1141826460 16:86484188-86484210 GATTGCTGGAGAAAGGCTGATGG - Intergenic
1142389429 16:89789159-89789181 CAGAGCTGGGGAGAGCCTGAGGG + Intronic
1145080323 17:19889527-19889549 GATAGCTGGGGAGAGTTAGAGGG + Intergenic
1145203065 17:20964271-20964293 AAAAACTGGTGAAAGTCAGATGG + Intergenic
1149179852 17:53922241-53922263 AATAGCAGTGGAAAGACAGAAGG + Intergenic
1150657971 17:67053087-67053109 AAAAGCTATGGAAAGTCTGTGGG - Intronic
1153488001 18:5620847-5620869 TATGGGTGGGGAAAGTTTGATGG - Intronic
1156676196 18:39529706-39529728 AGCAGATGGGGAAAGTCAGAAGG - Intergenic
1157813050 18:50711307-50711329 AATAGCTGACGAAAGTCCCAAGG + Intronic
1158808597 18:61004851-61004873 AATGGATGGGGAAAGCCTTAGGG + Intergenic
1162459073 19:10803621-10803643 AACAGCTGGGGTAAGTGGGAAGG - Intronic
1162801878 19:13115854-13115876 AATCCCTGCGGAAAGGCTGAAGG + Intronic
1163327841 19:16616715-16616737 ACTACCTGGGGAAAGTCTTAAGG + Intronic
1164511186 19:28898539-28898561 GCTAGCTGGGGATAGGCTGAGGG + Intergenic
925710658 2:6736511-6736533 AGTAGATGGGTAAAGTCTGTTGG - Intergenic
925732393 2:6928673-6928695 AAAATCTGGGGCAACTCTGAAGG - Intronic
928809773 2:35208852-35208874 AATGTCTGAGGAAAGTGTGAAGG - Intergenic
929380963 2:41353220-41353242 CATAGCTGGAGAATGTTTGAGGG - Intergenic
932731680 2:74226272-74226294 AATGCCTGGGGAAAGCCTGAGGG - Intronic
934033528 2:88068489-88068511 AATATCTGAGGAAAGACAGAGGG - Intronic
936076939 2:109407503-109407525 AAGTGCTGGGGAAAAGCTGAAGG + Intronic
936970683 2:118173670-118173692 AATAACTGGAGAAATTCTGGGGG + Intergenic
937873679 2:126804376-126804398 AGTAGACGGGGAAAGTCAGAAGG + Intergenic
937992496 2:127672442-127672464 AAGAGCTGTGGCAAGTCTGAGGG - Intronic
939455378 2:142428057-142428079 AATAGCTGGAATATGTCTGAGGG + Intergenic
941453429 2:165687585-165687607 AATAGTTGTGAAGAGTCTGATGG + Exonic
943375466 2:187071334-187071356 AATAACTGTGAAAAGTTTGAGGG + Intergenic
944566498 2:200996798-200996820 TATATATGGGGAAAGTCTTAAGG - Intronic
945123509 2:206484072-206484094 AAGAGCTGGGTAGAGACTGAAGG + Intronic
947842370 2:233216184-233216206 GATAGCTGGGGAAAGGTGGAGGG + Intronic
1169680504 20:8207482-8207504 AAACACTGTGGAAAGTCTGAAGG + Intronic
1169729957 20:8776072-8776094 AGTTGCTGGAGAAAGTCAGAAGG - Intronic
1172054674 20:32145874-32145896 AATAGCTGAGGAAAGTGTGAAGG + Intronic
1173125176 20:40330030-40330052 AAGAGCTGGGGACAGAATGAGGG + Intergenic
1174000555 20:47371445-47371467 CATTGCTGGGGAGAGTTTGATGG - Intergenic
1175430787 20:58901600-58901622 AAGAGCTGGGGAAGTTCAGAGGG - Intronic
1179269676 21:39841003-39841025 AATTGCTGGGGAAGGTTTGGAGG - Intergenic
1180127539 21:45802574-45802596 AAGAGATGGGGACAGGCTGACGG + Intronic
1181117398 22:20641258-20641280 AATGGCTGGGGAACGCCAGAAGG - Intergenic
1183197200 22:36361647-36361669 AATAGCTTGGGACAGGCTGGAGG + Intronic
951785024 3:26408609-26408631 AAAAGCTGGGGAAAATGGGATGG + Intergenic
952395925 3:32920833-32920855 AAAATCTGGGGCAAGTCTGAGGG - Intergenic
952936642 3:38403730-38403752 GATAACTGGGGAAAGTTTTAGGG + Intronic
953078549 3:39593892-39593914 AAGGGCTGGGGAAAGTGTGTAGG + Intergenic
954505378 3:51066209-51066231 AAGAACGGGGGAAATTCTGAAGG + Intronic
957532267 3:81455627-81455649 GATTGCTGGGTTAAGTCTGAGGG - Intergenic
957884569 3:86269483-86269505 AATGGCAGAGCAAAGTCTGAAGG - Intergenic
957930157 3:86867179-86867201 AATAGCTGGGCAAATTGTCATGG - Intergenic
960642151 3:119835870-119835892 AGTACCTGGGGAAAGGATGAGGG + Intronic
962551075 3:136492625-136492647 AATATCTGGGGGCAGTCTTAGGG - Intronic
962819510 3:139034519-139034541 AATAGAAGGGGAAACTGTGAGGG - Intronic
962823700 3:139079477-139079499 CATAACAGGGGAAACTCTGAAGG - Intronic
964218324 3:154314426-154314448 AATTACTGAGGAAACTCTGAGGG - Intronic
969251466 4:5971159-5971181 GATGGCTGGGGAGACTCTGATGG - Intronic
969625674 4:8304132-8304154 AAGAGCTGGGCAAAGGCTCAGGG + Intronic
975421394 4:74168101-74168123 AATAACTGGTGAAAATATGAAGG - Intronic
975539751 4:75496021-75496043 AATAGCTGAGTAAATTTTGAAGG - Intronic
976353862 4:84091782-84091804 AACAGATGGGGAAAATGTGAGGG - Intergenic
976473626 4:85457654-85457676 ATTAGCTGGGGAAGTTCTTAGGG + Intergenic
978771224 4:112458021-112458043 AATAGCAGAGGAAAGGGTGAAGG + Intergenic
979653702 4:123166675-123166697 ACTAGGTGAGGAAAGTCTGCTGG - Intronic
981573260 4:146176030-146176052 AATGGCTGGGAGAGGTCTGATGG + Exonic
981944542 4:150325904-150325926 AAGGGCAGGGGCAAGTCTGAAGG + Intronic
982839222 4:160161013-160161035 AATAGTAGGGGAAACTGTGAGGG + Intergenic
983054414 4:163084944-163084966 GCTAGCTGGGGAAAGACTGCAGG + Intergenic
983271324 4:165565538-165565560 AAGAGCTGGAGAAAGTCTAAGGG + Intergenic
983595416 4:169460742-169460764 CATTGCTGCAGAAAGTCTGATGG - Intronic
983759753 4:171391120-171391142 AAGAGTTGGGAGAAGTCTGAAGG - Intergenic
985330066 4:188822477-188822499 AATACCTGGGGAGACTGTGAGGG - Intergenic
988018596 5:25594618-25594640 AACAGCTCTGGAAAGTATGAAGG + Intergenic
988115459 5:26882920-26882942 AAGAGCTGAGAAAAGTCTGCTGG - Intronic
988938354 5:36114287-36114309 AGAAGCTGGGGATAGTTTGAAGG - Intronic
989556589 5:42803555-42803577 TAGACCTGGGGAAAATCTGAAGG + Intronic
989621056 5:43384669-43384691 GATAGCTGGAGATAGTCTGATGG + Intronic
989668442 5:43885313-43885335 AATATATGGGCAAAGTCTAACGG + Intergenic
990382631 5:55232051-55232073 AAAAGCTTGGGAAATTTTGAAGG + Intronic
990431138 5:55736882-55736904 AAGGGCTGGGGAAATACTGAGGG + Intronic
993545330 5:89204984-89205006 AATTCCTGTGGAAAGTTTGATGG - Intergenic
998268023 5:140681010-140681032 AAAAACTGGGGAATGTCTTAAGG + Intronic
999267303 5:150275264-150275286 CATAGCAGGGGAGAGTCTCAGGG - Intronic
1005275213 6:24209869-24209891 AAGAGCTGGGGAAAGTGTGGGGG - Intronic
1005290785 6:24376575-24376597 AATAACTGGGGAAATTTGGACGG + Intergenic
1006212123 6:32404913-32404935 AATATCTGGGGAAAGACACAGGG - Intronic
1007300392 6:40863598-40863620 GATAGCTGGGGAGAGGTTGAGGG + Intergenic
1007555497 6:42762283-42762305 CAGAGCTGGGCAAACTCTGAGGG + Intronic
1008869672 6:56258334-56258356 AGTAGCTGGGCAGAGGCTGAAGG - Intronic
1009026469 6:58006501-58006523 ATTTGCTGGGGAAATTTTGAAGG + Intergenic
1009202019 6:60757974-60757996 ATTTGCTGGGGAAATTTTGAAGG + Intergenic
1018757573 6:166863015-166863037 AATAGCTGGGGAGAGGCGGGGGG + Intronic
1019255020 7:44064-44086 AGTGTCTGGGGAAAGGCTGAGGG - Intergenic
1021757989 7:23874055-23874077 AATAGCTTTGGAAACACTGAGGG + Intergenic
1023010482 7:35920997-35921019 AAAAGCTTGGGAAAGCCAGAAGG - Intergenic
1023091688 7:36623824-36623846 AGAAGCTGGGAAAAGTCTGGTGG - Intronic
1023416891 7:39941743-39941765 AATAGGTTGGGAAAGTTTTAAGG - Intergenic
1023594823 7:41817707-41817729 TATCACTGGGGAAATTCTGAGGG + Intergenic
1024080343 7:45850576-45850598 AAAAGCTTGGGAAAGCCAGAAGG + Intergenic
1024565710 7:50678418-50678440 AATGGCTCTGGAAAGTATGAAGG - Intronic
1025124120 7:56331095-56331117 AAAAGCTTGGGAAAGCCAGAAGG - Intergenic
1025825592 7:65008065-65008087 AAAAGCTTGGGAAAGCCAGAAGG - Intergenic
1027759075 7:82254797-82254819 CATAGGTAGGGAAAGTCTAAAGG + Intronic
1028449189 7:90961729-90961751 AAGAACTGGGGACAGTCAGAAGG + Intronic
1029661409 7:101964701-101964723 GGTTGCTGGGGACAGTCTGAAGG - Intronic
1032948850 7:136884175-136884197 AAAAGCTGAAGAAAGTATGATGG + Intronic
1034475606 7:151279863-151279885 AATAGCTGGTGACAGTGGGAGGG - Intergenic
1035671669 8:1422771-1422793 GTTAGCAGGGGAAAGGCTGAGGG + Intergenic
1037565892 8:20118216-20118238 ACTTGCTGGGGACAGTTTGAAGG + Intergenic
1037799947 8:22027306-22027328 AATAGAACAGGAAAGTCTGAGGG - Intronic
1037916194 8:22774923-22774945 AAGAGCTGGGGAGAGACTGGAGG - Intronic
1037920376 8:22801516-22801538 AGTAGTTGGGGAAAGGGTGAGGG + Intronic
1038985881 8:32809832-32809854 AAGAGTTGGGGAGAGGCTGACGG + Intergenic
1040454258 8:47580098-47580120 ACTAGCTGGTTAGAGTCTGATGG - Intronic
1044230862 8:89776182-89776204 AATAAATGAGGTAAGTCTGAGGG + Intronic
1045133157 8:99180673-99180695 AATAGCTGGTGCAGGTCTCAAGG + Intronic
1050905318 9:10995941-10995963 CATAGATGGGAAAAGTCTAATGG - Intergenic
1051946973 9:22581092-22581114 AAATGGTGGGGAAAGGCTGAGGG + Intergenic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1058807035 9:108602706-108602728 ATTGGCAGGGGAAAGACTGAAGG + Intergenic
1058930477 9:109714331-109714353 AATAGTTGTGGAAATTGTGAAGG - Intronic
1058979049 9:110152367-110152389 AATAGCAGAGCAAAGTTTGAGGG + Intronic
1059906196 9:118989677-118989699 AAGGGCTGGGGAAGGTCTGATGG + Intergenic
1060411307 9:123402287-123402309 ACTTTCTGGGCAAAGTCTGAGGG + Intronic
1186584027 X:10852272-10852294 AATATCTGAGGAAAATGTGATGG - Intergenic
1187051364 X:15699272-15699294 AATAGCTGGAAAAATTCTAAAGG + Intronic
1187103413 X:16217903-16217925 GATAGCTGGGGAAAGGTAGAGGG + Intergenic
1193582022 X:83277042-83277064 AGTGGCTTGGGAAAGTCTCAGGG - Intergenic
1195582794 X:106527464-106527486 AATAACTGCTGAAAGTCTTATGG + Intergenic
1198575145 X:138002308-138002330 AAGAGCTGGGTAGGGTCTGAGGG + Intergenic
1199073316 X:143503231-143503253 GATAGCTGGGGAAAGGTAGAGGG + Intergenic
1199516922 X:148688357-148688379 ATTAGCTGGTAAAAGTATGATGG - Intronic
1199555506 X:149103954-149103976 AATAGCAGGGGGAAGTTTTATGG - Intergenic