ID: 907193816

View in Genome Browser
Species Human (GRCh38)
Location 1:52670141-52670163
Sequence GTGTATAAACATATTTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 8, 3: 50, 4: 517}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907193816_907193817 18 Left 907193816 1:52670141-52670163 CCTAGAAAAATATGTTTATACAC 0: 1
1: 0
2: 8
3: 50
4: 517
Right 907193817 1:52670182-52670204 TCCATATATTCAGTGACTCATGG 0: 1
1: 0
2: 0
3: 18
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907193816 Original CRISPR GTGTATAAACATATTTTTCT AGG (reversed) Intergenic
900881083 1:5381830-5381852 GTGGGTAAAGATATTTATCTTGG + Intergenic
906844084 1:49171836-49171858 GTATATCAACAAATTTCTCTTGG - Intronic
907193816 1:52670141-52670163 GTGTATAAACATATTTTTCTAGG - Intergenic
907720757 1:56969885-56969907 GTGTGTATATACATTTTTCTGGG + Intergenic
908115838 1:60939399-60939421 ATTTATCAACATTTTTTTCTAGG + Intronic
908907358 1:69031226-69031248 GTCTATAAATATTTATTTCTGGG - Intergenic
909005108 1:70266559-70266581 GTCTATAAAAATATCTTGCTGGG + Intronic
909372981 1:74908160-74908182 TTGTATATAAATATTTCTCTTGG + Intergenic
910300704 1:85704278-85704300 GTGTGTGAACATGTGTTTCTAGG - Intronic
911281022 1:95929116-95929138 GTCTAAAAACATATTTTTTTAGG - Intergenic
911393924 1:97281668-97281690 GTATATTTACTTATTTTTCTGGG - Intronic
911518788 1:98903454-98903476 ATGTATAATCATATTTGTCTTGG + Intronic
911749830 1:101483410-101483432 GTTTATAGACATTTTGTTCTTGG - Intergenic
911949124 1:104149633-104149655 GTGAATACACATAGTTTTTTTGG - Intergenic
912228234 1:107761087-107761109 GTGTATGAAAATTATTTTCTTGG + Intronic
912461916 1:109840084-109840106 ATATATAAACATATGTATCTAGG + Intergenic
912566868 1:110593636-110593658 GTATATAAATATATATTACTGGG - Intronic
912890673 1:113526357-113526379 GTGTATAGACATATTAATGTAGG + Intronic
913323031 1:117603226-117603248 GTATATATATATTTTTTTCTTGG - Intergenic
913433684 1:118824786-118824808 AGGTATGAATATATTTTTCTTGG + Intergenic
913571899 1:120129028-120129050 GTGTATGCACATATATTTGTAGG + Intergenic
914292818 1:146290651-146290673 GTGTATGCACATATATTTGTAGG + Intergenic
914553862 1:148741434-148741456 GTGTATGCACATATATTTGTAGG + Intergenic
914946788 1:152073805-152073827 GTGTAGAAACTTTTTTTTCAGGG - Intergenic
916003793 1:160641156-160641178 GAGCGTATACATATTTTTCTGGG + Intronic
918268424 1:182870155-182870177 GTGATAAAACTTATTTTTCTTGG - Intronic
918575423 1:186053152-186053174 GATTATAAACAAATTTTCCTGGG + Intronic
918907660 1:190519099-190519121 GTGTATACACACATTATCCTAGG - Intergenic
919094665 1:193016882-193016904 ATGTAAAAACATTTTTTTTTAGG - Intronic
919100269 1:193087976-193087998 GAGTATAAGCTTGTTTTTCTAGG - Intronic
919195120 1:194274364-194274386 TTCTTTAAACAAATTTTTCTTGG + Intergenic
919341037 1:196306890-196306912 AAGTATATACGTATTTTTCTAGG + Intronic
919434745 1:197544153-197544175 GTATATAAACATTTTTGTGTAGG + Intronic
919553230 1:199018985-199019007 GTGTATATATATATTTATTTTGG + Intergenic
919563880 1:199159502-199159524 TTGTATGAACATTTATTTCTTGG + Intergenic
921523174 1:216182842-216182864 GTGTGCAAACATGTTTTTATTGG - Intronic
921577243 1:216850379-216850401 TAGTATAAACATATTATTTTTGG + Intronic
922032788 1:221820096-221820118 TTCTAGAAACATATTTATCTAGG + Intergenic
922073942 1:222223547-222223569 ATGCATAAACTCATTTTTCTTGG + Intergenic
922247371 1:223813610-223813632 GTGTCTAGACAAATTTTTCTAGG - Intronic
923495948 1:234524955-234524977 GGGTATGTACATATTTTTCTGGG + Intergenic
1063123365 10:3120180-3120202 GTCTTAAAACATACTTTTCTGGG - Intronic
1063569781 10:7204568-7204590 GTGTTTTAACATATTTTTGTAGG - Intronic
1064207143 10:13334021-13334043 GTGTAAAAACCTTCTTTTCTGGG - Intronic
1064842499 10:19610584-19610606 GTGTATATGCATACTTATCTGGG + Intronic
1065205330 10:23351932-23351954 GTCTCTACACATATTTTTTTGGG + Intergenic
1065208450 10:23379469-23379491 GTATTTGAACATATTTCTCTGGG - Intergenic
1065348385 10:24771885-24771907 GTATATTAACACCTTTTTCTAGG + Intergenic
1067371759 10:45690532-45690554 GTGTATAAAAATACATTTTTTGG + Intergenic
1067388022 10:45835617-45835639 GTGTATAAAAATACATTTTTTGG - Intronic
1067418099 10:46121663-46121685 GTGTATAAAAATACATTTTTTGG + Intergenic
1067446243 10:46348984-46349006 GTGTATAAAAATACATTTTTTGG + Intergenic
1067503458 10:46828226-46828248 GTGTATAAAAATACATTTTTTGG + Intergenic
1067591135 10:47511787-47511809 GTGTATAAAAATACATTTTTTGG - Intronic
1067638254 10:48019879-48019901 GTGTATAAAAATACATTTTTTGG - Intergenic
1067875241 10:50000482-50000504 GTGTATAAAAATACATTTTTTGG + Intronic
1068249285 10:54416122-54416144 GTGTATATATATATTTAGCTTGG - Intronic
1068459108 10:57303194-57303216 GTGCATAAAAATATTTTGCTAGG + Intergenic
1068790547 10:61026091-61026113 ATGTATAAATATCTTTCTCTAGG - Intergenic
1070134858 10:73684305-73684327 GTGTATAAAAATACATTTTTTGG - Intronic
1070260863 10:74853990-74854012 GTTTATAAACTTCCTTTTCTTGG + Intronic
1071904967 10:90162838-90162860 GTATATAAAAATAATTTTTTGGG + Intergenic
1071909565 10:90215929-90215951 ATATATAAAAATATTTATCTGGG + Intergenic
1071999345 10:91178724-91178746 GAGTTTAAACATAATTTTCATGG + Intronic
1072016095 10:91348227-91348249 GTATATGAATACATTTTTCTTGG - Intergenic
1072116352 10:92373957-92373979 GTGGAGAAATATACTTTTCTGGG - Intergenic
1072440507 10:95449944-95449966 GTATCTAAAAATATTTTTCTTGG - Intronic
1073417223 10:103394629-103394651 GTGTATAAAGTTATTTTTAATGG - Intronic
1073609833 10:104932155-104932177 TTGTAAAAAGTTATTTTTCTTGG + Intronic
1074481357 10:113824350-113824372 GTCTATAAAACTATTTTGCTTGG + Intergenic
1074991778 10:118715197-118715219 GTGTATATATATATTTTTAGTGG - Intronic
1075224611 10:120616147-120616169 GTGTATAAACATATATATTGTGG + Intergenic
1076054301 10:127358761-127358783 GTGTATACAGAGATTTTTCTGGG + Intronic
1077231958 11:1461732-1461754 TTTTATAAACTTTTTTTTCTTGG + Exonic
1078113583 11:8422659-8422681 TTGTATAACTATATTTTTCTAGG + Intronic
1078416111 11:11167145-11167167 GTGTATACAAATTTTTTTCTTGG - Intergenic
1078691054 11:13581015-13581037 GTTTATAAACTTCTTGTTCTTGG - Intergenic
1079715577 11:23739454-23739476 TTGTACATATATATTTTTCTAGG + Intergenic
1080909873 11:36585087-36585109 GTGAATACACACATTTTTTTTGG + Intronic
1081134556 11:39423203-39423225 TTGTAAAAACATATATTTCTAGG - Intergenic
1081139180 11:39476391-39476413 GTATATATATATATTTTTTTTGG + Intergenic
1081146963 11:39573359-39573381 GGATAAAAACATATTTTTCTGGG + Intergenic
1082230453 11:49759252-49759274 GAGAATAAAAATATTTTTCAAGG + Intergenic
1086057334 11:82662318-82662340 GTGTATATATATATATTTTTTGG - Intergenic
1086213667 11:84351102-84351124 CTGGAGAAACATATTTTTCCTGG - Intronic
1086619598 11:88869710-88869732 GAGAATAAAAATATTTTTCAAGG - Intronic
1086983504 11:93224320-93224342 ATGTATATACATATTTATATAGG - Intergenic
1087358501 11:97125719-97125741 GTATACACACATATATTTCTGGG - Intergenic
1087971179 11:104486659-104486681 GTGTAAAATCCTATCTTTCTAGG + Intergenic
1088364802 11:109029526-109029548 GTGAATAAGGATATTTTTGTTGG + Intergenic
1088572820 11:111240269-111240291 GTGTATATACATATGTGTATGGG - Intergenic
1088589034 11:111386590-111386612 GTGTATATACATATTTTCCTTGG + Intronic
1089236081 11:117026944-117026966 GGGTAAAAACATATTATTCAAGG + Intronic
1090090397 11:123691802-123691824 GTTTATAAATATAATTATCTGGG - Intergenic
1090148577 11:124356894-124356916 GTCTATTAACTTATTTTTTTAGG + Intergenic
1090438438 11:126706472-126706494 ATGTATAAATATATGTCTCTAGG + Intronic
1090542526 11:127723870-127723892 GCTTATAAACATATGTTTATGGG + Intergenic
1090738382 11:129632889-129632911 TTGTATAAACATGTTTTTGATGG + Intergenic
1091527657 12:1320197-1320219 ATATGTAAGCATATTTTTCTAGG + Intronic
1092554793 12:9545867-9545889 GATTATATACTTATTTTTCTTGG + Intergenic
1093115141 12:15200102-15200124 GTAAATAAACATTTCTTTCTTGG - Intronic
1093636468 12:21476446-21476468 GTATATATACATGGTTTTCTGGG - Intronic
1093869511 12:24270999-24271021 ATATATACACATATTTCTCTAGG + Intergenic
1094042235 12:26130250-26130272 TTGCATAAACATGTTTTTCTTGG - Intronic
1094186786 12:27652128-27652150 CTTAATAAAAATATTTTTCTGGG + Intronic
1094236302 12:28170628-28170650 TTTTATAATCATATCTTTCTTGG - Intronic
1094517308 12:31144763-31144785 GATTATATACGTATTTTTCTTGG - Intergenic
1094636768 12:32234064-32234086 GTTTTTAAAAATATTTTTGTTGG - Intronic
1095523987 12:43103465-43103487 TTGTCCTAACATATTTTTCTTGG + Intergenic
1097392946 12:59038126-59038148 GTGAATAAAAACATTTTTATTGG + Intergenic
1097403118 12:59153936-59153958 GTGCATAAGAACATTTTTCTGGG + Intergenic
1097512053 12:60555938-60555960 GTCTATAAACAAAGTTTTATTGG - Intergenic
1097535031 12:60857739-60857761 GTAAATAAACATATTTATGTGGG - Intergenic
1098243723 12:68493915-68493937 GTGTCAAAACATCTTTTTTTTGG - Intergenic
1098746702 12:74246093-74246115 ATGAATAAATATTTTTTTCTAGG - Intergenic
1099248684 12:80225006-80225028 GTGTATATACATATATATATGGG - Intronic
1099517860 12:83621081-83621103 CTGTACAAAGATACTTTTCTTGG - Intergenic
1099748717 12:86742958-86742980 ATACATAAACACATTTTTCTTGG - Intronic
1099796167 12:87402756-87402778 GTGTATATACAAATATTTGTAGG + Intergenic
1100461575 12:94804879-94804901 GTGTATAGAAACATTTTGCTGGG + Intergenic
1100659800 12:96684588-96684610 ATATAAAAAAATATTTTTCTAGG + Intronic
1101138885 12:101774261-101774283 CTGAATTAACATTTTTTTCTTGG - Intronic
1102127966 12:110501343-110501365 GTGAATATACACATTTTTCTGGG - Intronic
1102749938 12:115283882-115283904 GTGTATATATATATATATCTGGG - Intergenic
1103029286 12:117599657-117599679 ATGTTTAGAGATATTTTTCTTGG - Intronic
1103218328 12:119221372-119221394 GTGTATATATATATTTTTTATGG - Intergenic
1104359578 12:128119793-128119815 GTGTGTACACATATATTTATGGG + Intergenic
1104359588 12:128120091-128120113 GTGTGTACACATATGTTTATGGG + Intergenic
1104402586 12:128488969-128488991 GTGGATAAAAACTTTTTTCTTGG - Intronic
1105057829 12:133119241-133119263 ATCAATTAACATATTTTTCTTGG + Exonic
1105312618 13:19226395-19226417 GTGTATATATATATTTTTTGAGG - Intergenic
1105315574 13:19258538-19258560 GTGAAACAACACATTTTTCTTGG - Intergenic
1105769217 13:23592403-23592425 GCAGATAAACATACTTTTCTAGG + Intronic
1106726535 13:32491928-32491950 GTGAATAAATATACTTTTTTCGG - Intronic
1106749229 13:32741873-32741895 CAGTATAAACCTGTTTTTCTCGG + Intronic
1107215688 13:37915870-37915892 GTCTGTAAACATATTTATATTGG + Intergenic
1107273940 13:38655301-38655323 GTGTATAGACATCTAGTTCTTGG + Intergenic
1107518278 13:41153308-41153330 GTATATAGAATTATTTTTCTTGG - Intergenic
1107676732 13:42805575-42805597 GAGTAAAAACAAATTTTTTTTGG - Intergenic
1108895331 13:55320043-55320065 GTGTAAATACATATATTTATAGG + Intergenic
1109195507 13:59373855-59373877 GAATATAATCAAATTTTTCTTGG + Intergenic
1109269545 13:60239008-60239030 TTTTTTAAAAATATTTTTCTAGG - Intergenic
1109550424 13:63890772-63890794 GTGTATATATATATATATCTGGG + Intergenic
1109593394 13:64516897-64516919 GTAAATAAACAAATGTTTCTGGG - Intergenic
1109729243 13:66389199-66389221 GTGTTTAAAAATATCTTTATGGG + Intronic
1110064917 13:71091714-71091736 GTTTGTAAATATATTTTTGTTGG - Intergenic
1110446517 13:75589073-75589095 TAGCATTAACATATTTTTCTTGG + Intronic
1110951707 13:81501244-81501266 ATTTATTTACATATTTTTCTGGG + Intergenic
1111378950 13:87420393-87420415 GGGTATATACATATTTATATTGG + Intergenic
1112052800 13:95660459-95660481 GTCTATAGAAATATTTATCTTGG + Intergenic
1112251754 13:97787543-97787565 ACCTATAAACATATTTATCTGGG + Intergenic
1112255508 13:97826951-97826973 GATTATTCACATATTTTTCTGGG - Intergenic
1112658251 13:101475540-101475562 GAGTATTGACATATTTCTCTAGG - Intronic
1112660706 13:101504141-101504163 CTTTATAAACATATATTTCCAGG + Intronic
1113140248 13:107139757-107139779 GTGTATAAATAATTTTTTGTTGG - Intergenic
1113362822 13:109646849-109646871 GTGTGTAACTGTATTTTTCTAGG + Intergenic
1114276234 14:21147693-21147715 GTATATAGACATAGTTTTGTGGG - Intergenic
1114950743 14:27749781-27749803 ATGTATTAACATATTTATATAGG - Intergenic
1115741019 14:36388492-36388514 GTGTTTACACATATTTTTTAGGG + Intergenic
1116037795 14:39649291-39649313 GTGTCTAAGACTATTTTTCTTGG + Intergenic
1116155552 14:41199811-41199833 TTGTATTAATATATTTTTCAAGG - Intergenic
1116155556 14:41199870-41199892 TTGTATTAATATATTTTTCAAGG - Intergenic
1116242859 14:42368571-42368593 ATGTACAAAGATGTTTTTCTTGG + Intergenic
1116265114 14:42678265-42678287 TTCTATAAACAGATTTTTTTAGG - Intergenic
1116272599 14:42791009-42791031 GTGTATAAACACATAATTTTGGG + Intergenic
1118820976 14:69345746-69345768 GTGTATAAGCATATTTTCCTGGG + Intronic
1119118706 14:72052803-72052825 GTTTAAAAACATACTTTTGTGGG - Intronic
1119601713 14:75981134-75981156 GTGTCTAAACAGGTTTTGCTGGG + Exonic
1119682219 14:76601325-76601347 GAGTAACAACATATTGTTCTGGG + Intergenic
1119816223 14:77570815-77570837 GTGTAAAAGCAGATTTTGCTAGG - Intronic
1120459815 14:84780512-84780534 CTGGGTAAACATTTTTTTCTGGG + Intergenic
1120488321 14:85144271-85144293 CTGTATAAACCTATATCTCTTGG + Intergenic
1120589373 14:86357030-86357052 GTCTAGAAACATATTTTCCATGG - Intergenic
1122563544 14:102634694-102634716 GTGTATATATATATATTTTTTGG + Intronic
1122767300 14:104081344-104081366 GTGTGTAAACACAGTTTTCTTGG - Intergenic
1124468347 15:29960996-29961018 GTCTTTAAAAATATTTGTCTTGG + Intronic
1126106665 15:45151297-45151319 GCTTATAAACATCTTTTCCTTGG + Intronic
1126267092 15:46767729-46767751 ATGTATAGATATATTTATCTTGG + Intergenic
1126321730 15:47431295-47431317 GTTTCTAAACATATTTTATTTGG - Intronic
1126398439 15:48244050-48244072 GTGCATAAACTTTTTCTTCTAGG - Intronic
1126872764 15:53007470-53007492 GTATTTAAAACTATTTTTCTGGG - Intergenic
1127529781 15:59832624-59832646 ATGAACAAACAGATTTTTCTTGG + Intergenic
1127719314 15:61684176-61684198 GTCTATCAACATTTTCTTCTAGG - Intergenic
1127854247 15:62941613-62941635 GTGGACATGCATATTTTTCTGGG + Intergenic
1128269498 15:66296088-66296110 GTGTATAAACATCTATATCTTGG - Intronic
1128773976 15:70304712-70304734 GTATATATACATATTTGTATAGG - Intergenic
1129485989 15:75872483-75872505 GTGAATAAAGATATTGGTCTAGG + Intronic
1129590595 15:76911529-76911551 GTGTATAAGTTTCTTTTTCTTGG - Intergenic
1130236957 15:82144497-82144519 GTGCACAAACATGGTTTTCTAGG - Intronic
1130544676 15:84846202-84846224 GAGTATTAACATCTTTGTCTTGG - Intronic
1130828482 15:87574370-87574392 TTGTGTAAATATATTTTACTGGG - Intergenic
1130949832 15:88577117-88577139 GTGTATACACGTAGTTTTATTGG - Intergenic
1131655860 15:94457960-94457982 GTGACTGAACAGATTTTTCTGGG + Intronic
1131685394 15:94762113-94762135 ATTTATAAACACATTTTTTTTGG + Intergenic
1131708247 15:95022385-95022407 AGTTTTAAACATATTTTTCTAGG + Intergenic
1132252490 15:100344362-100344384 GTTTATACACATTTTTTTTTCGG - Intergenic
1135476467 16:22780479-22780501 ATGTAAATACATTTTTTTCTGGG + Intergenic
1136121780 16:28141321-28141343 GTGTAGAAACTTATTTTTACAGG - Intronic
1137749160 16:50845871-50845893 GTTTAAAAATATATTTTTTTGGG + Intergenic
1137849113 16:51720940-51720962 CTGTGTGAAGATATTTTTCTTGG - Intergenic
1138212512 16:55175257-55175279 GTCAATAAACATGTATTTCTGGG - Intergenic
1138322941 16:56133906-56133928 GTGTAAATAAATATTTTTCATGG + Intergenic
1138802178 16:60046943-60046965 ATGCATAAACAGATTTTGCTTGG + Intergenic
1138906741 16:61345229-61345251 GGGTATAAATATATTTATGTTGG - Intergenic
1139035366 16:62939572-62939594 ATGCATAAATATATTTTTTTCGG + Intergenic
1140845718 16:78885438-78885460 CTGTCTAAACATCTTATTCTGGG + Intronic
1144280545 17:13721884-13721906 GTGTAAGAACATATCGTTCTTGG + Intergenic
1146279181 17:31534012-31534034 GTTTGTAAAAATATTCTTCTGGG + Exonic
1146569067 17:33937650-33937672 TGGTATAAACATATTTTTAATGG + Intronic
1146875838 17:36410114-36410136 GTGTAATAAGATCTTTTTCTTGG + Intronic
1147063549 17:37902755-37902777 GTGTAATAAGATCTTTTTCTTGG - Intergenic
1148505523 17:48124100-48124122 TTTTATAAACATAATTTTATTGG + Intergenic
1149532829 17:57409136-57409158 GCATATTAACATTTTTTTCTGGG - Intronic
1150441531 17:65195483-65195505 ATGTATATATATATTTTTATTGG + Intronic
1150826227 17:68478151-68478173 TTGTTTAAAAACATTTTTCTTGG + Intergenic
1153037556 18:778649-778671 GTCTCTAAATTTATTTTTCTAGG - Intronic
1153484265 18:5580304-5580326 GTGTCTATACATATTTGTATGGG - Intronic
1156032272 18:32726321-32726343 TACTATTAACATATTTTTCTTGG + Intronic
1156609438 18:38708965-38708987 GTCTATAACCACATTTTTCTGGG + Intergenic
1156881907 18:42090596-42090618 GTGAATAAGCACATTTTTTTGGG + Intergenic
1157029146 18:43883478-43883500 GTATATAATCATATATTTCATGG + Intergenic
1157508062 18:48245542-48245564 GAGTAAAAACATATTTTTTAAGG + Intronic
1157884237 18:51351000-51351022 GTCTATAAACATTTTTTTTTTGG + Intergenic
1158245398 18:55426703-55426725 GGGTATTGAAATATTTTTCTGGG - Intronic
1158635939 18:59158054-59158076 GTGTATATATATATATTTTTTGG + Intronic
1159018684 18:63124740-63124762 GTGTGTAACCACATTTGTCTGGG + Exonic
1161100060 19:2417017-2417039 TTGTATAAACAAAGTTTTATTGG + Intronic
1161727536 19:5938719-5938741 GTGATTAAACATATTTATCTAGG + Intronic
1164297800 19:23929770-23929792 GTGTATTAACATATTTATGCAGG + Intronic
1167868888 19:52350994-52351016 CTGTATAAATATATTTCTTTTGG - Intronic
925505640 2:4560215-4560237 GGGCATAAACATATACTTCTAGG - Intergenic
926478199 2:13354830-13354852 GTATAAAAACATAACTTTCTCGG + Intergenic
927526307 2:23744447-23744469 GTCTATAAACATTGTTTTGTGGG - Intergenic
928223822 2:29429968-29429990 GTCTATAAAAAAATTTTTCAGGG + Intronic
928736098 2:34290911-34290933 GTGTATCAAGATATTGTTCAGGG + Intergenic
929050569 2:37833311-37833333 GTCTAAAAACATATATTTCAGGG - Intergenic
929372108 2:41238195-41238217 TTGTGTAAAAATATTTTTTTAGG + Intergenic
930336119 2:50047919-50047941 GTATATGAATATATTTATCTCGG + Intronic
930374391 2:50546529-50546551 GAGTATAAACATAATTTTTCAGG - Intronic
930507002 2:52295079-52295101 ATGTATAAAAAAATTATTCTTGG + Intergenic
930862431 2:56088839-56088861 GTGAATAAGCATATTGTTTTTGG - Intergenic
931011467 2:57920091-57920113 GTGTTTAAAAATATTTTTTCAGG - Intronic
931128634 2:59306192-59306214 GTCCATAAACATATCTATCTGGG + Intergenic
931286389 2:60835466-60835488 ATATAAAAACAGATTTTTCTGGG + Intergenic
931466757 2:62495371-62495393 ATATTTAAACACATTTTTCTAGG + Intergenic
931683056 2:64768619-64768641 TTTTGTAAACAGATTTTTCTGGG + Intergenic
932690600 2:73909912-73909934 ATTTATAAAAATATTATTCTTGG + Intronic
932851663 2:75193495-75193517 GAGTATTCTCATATTTTTCTGGG + Intronic
932903750 2:75728305-75728327 GTGGATAAAAATACTTTTTTTGG + Intergenic
933848201 2:86343079-86343101 GTGGATAACCATGTTTTTATTGG + Intergenic
934119245 2:88824196-88824218 GTGTATAGGTACATTTTTCTTGG - Intergenic
935651264 2:105384232-105384254 TTTTATAATTATATTTTTCTCGG + Intronic
936095983 2:109530523-109530545 GTGTCTATACATATCTATCTTGG + Intergenic
937704685 2:124906236-124906258 GAGTATTATCAGATTTTTCTAGG + Intronic
938748581 2:134306020-134306042 GTATAGAAACTTTTTTTTCTGGG + Intronic
939112358 2:138023767-138023789 AGATATAAACATATTTTTCTTGG - Intergenic
939435486 2:142171622-142171644 GTGTATATATATATATTGCTTGG - Intergenic
939723134 2:145680019-145680041 GTGTATAAACATTTTCCTTTAGG - Intergenic
939750111 2:146033699-146033721 GATTATTGACATATTTTTCTTGG + Intergenic
940953033 2:159698219-159698241 TAGTATAAAAATATTTTACTAGG + Intergenic
942117241 2:172740010-172740032 GTCTATAAACAAAGTTTTATTGG + Intronic
942238589 2:173937608-173937630 CTTTTTAAACATTTTTTTCTCGG - Intronic
942526117 2:176854715-176854737 GCACATATACATATTTTTCTGGG + Intergenic
942933966 2:181531397-181531419 TTGTATTAACATAATCTTCTGGG - Intronic
943524353 2:188997678-188997700 GTGTATCATTATACTTTTCTAGG + Exonic
943861788 2:192874598-192874620 GTGGATATAGATATGTTTCTAGG + Intergenic
943937071 2:193933402-193933424 GTGTATATACATATGTATCATGG + Intergenic
944369941 2:198970834-198970856 GTGGTTGAAGATATTTTTCTGGG - Intergenic
944396166 2:199269214-199269236 ATGTATAAAGATATATTTATAGG - Intergenic
944440219 2:199735400-199735422 GTGCATAAAAATATTTTACAGGG + Intergenic
944552295 2:200855628-200855650 GTGTATATATATAATTTTTTGGG - Intronic
944802185 2:203247297-203247319 CTGTATATATATATTGTTCTTGG + Intronic
945148532 2:206763996-206764018 GTGTTCAAAAATATTCTTCTGGG + Intronic
946724498 2:222648680-222648702 GTGCATAAGCTTATTTTTCAGGG - Intronic
947220362 2:227785931-227785953 ATGTATAGCTATATTTTTCTTGG - Intergenic
1169544506 20:6636897-6636919 GTGTGTACACATATTTTTCTGGG + Intergenic
1169662654 20:7997607-7997629 GTGTATAAACTAATTTTAGTTGG - Intronic
1171073433 20:22098443-22098465 GTTTTTAAAAGTATTTTTCTTGG - Intergenic
1171792461 20:29540046-29540068 TTGTTCAAAAATATTTTTCTTGG - Intergenic
1172905335 20:38364875-38364897 TTGTGCTAACATATTTTTCTTGG - Intronic
1173871560 20:46345243-46345265 GTGCATTTACATGTTTTTCTGGG - Intergenic
1175626874 20:60496014-60496036 TTTTTAAAACATATTTTTCTTGG + Intergenic
1178610940 21:34079347-34079369 GTATATAGACACAATTTTCTAGG + Intronic
1178973959 21:37206230-37206252 GTTTATCAACATTTTATTCTTGG - Intergenic
1179644049 21:42764833-42764855 GTATATATATATATTTTTTTGGG - Intronic
1179940207 21:44634078-44634100 ATGAAAAAACATATTTTTTTAGG - Intronic
1180738398 22:18035725-18035747 GTGTATACACATATGTTTGCTGG + Intergenic
1182680119 22:32072856-32072878 ATGAATAAACATTTTTTTATTGG + Intronic
1184055638 22:42046449-42046471 ATGAATAAAAAAATTTTTCTAGG + Intronic
1184082718 22:42235497-42235519 TTTTCTAAACATGTTTTTCTTGG - Intronic
1185293443 22:50040620-50040642 GTGTATAATCATATTTGTACAGG - Intronic
949569259 3:5276091-5276113 GGATATAGACATATCTTTCTAGG + Intergenic
949591470 3:5498536-5498558 ATATATACACATATTTTTTTTGG + Intergenic
949765750 3:7523911-7523933 GTCTCTCAACATAGTTTTCTGGG + Intronic
949855890 3:8460737-8460759 GTTTAAAAACATGTTTTTATTGG + Intergenic
950982629 3:17325116-17325138 TTGTGTAAACATATTTGTCTTGG - Intronic
950994191 3:17477722-17477744 GTGTATACACATTGCTTTCTAGG - Intronic
951267213 3:20582165-20582187 GTGTAAAAATTTCTTTTTCTTGG - Intergenic
951502225 3:23401680-23401702 ATGTATAAATATATATTTTTAGG + Intronic
951878623 3:27458217-27458239 GTGTATACAGATTTGTTTCTTGG + Intronic
951924388 3:27891566-27891588 GCGGAAAAACATATTTTTATTGG - Intergenic
952533238 3:34283853-34283875 GAGCATAAACATCTTTCTCTTGG + Intergenic
953022723 3:39125957-39125979 GTGTATAAAAATATGATCCTTGG - Intronic
953475072 3:43198640-43198662 GTGTATAAATATATTTTGGTTGG - Intergenic
953916606 3:46924504-46924526 GTGAATAAATACATTTATCTTGG - Intronic
954780096 3:53052357-53052379 GTTTATACACATTTTGTTCTTGG - Intronic
955070165 3:55566264-55566286 GTGTGTAAAAACATTTTTCATGG - Intronic
955520584 3:59771873-59771895 GTGTGTGCACACATTTTTCTAGG - Intronic
955896151 3:63702988-63703010 CTGTATAAACACATTATTATGGG - Intergenic
956147759 3:66208744-66208766 GTGTATATATATATTTATATGGG + Intronic
956547447 3:70419931-70419953 ATGTATAAAACTATTTTGCTGGG - Intergenic
957386897 3:79507632-79507654 GTGTATATCCACATTTTACTTGG + Intronic
957414732 3:79886658-79886680 GTAGAAAAAAATATTTTTCTCGG + Intergenic
957818721 3:85340589-85340611 GTATATACAATTATTTTTCTAGG + Intronic
958981003 3:100719434-100719456 GAATATATAAATATTTTTCTGGG + Intronic
959673982 3:109013689-109013711 GTATATCAACATATTTCTCAGGG - Intronic
960175805 3:114516364-114516386 CTCTATAAACATATATGTCTTGG + Intronic
961258295 3:125577336-125577358 GTTTTTAAAAATATTTTTCAAGG - Intronic
962077041 3:132093195-132093217 TTGTATAAACAAAGTTTTATTGG - Intronic
962656539 3:137549804-137549826 ATGTATCAACATCTATTTCTGGG + Intergenic
962747813 3:138410515-138410537 GTGTATACATATATTCTTCTGGG + Intergenic
962934825 3:140070272-140070294 GTGAAAAAGTATATTTTTCTAGG - Intronic
963344108 3:144072941-144072963 ATTTATAAGCATATTTTTCATGG + Intergenic
963508537 3:146218911-146218933 GTGGATAAAATTATTTTTGTGGG + Intronic
963937215 3:151067073-151067095 GGGTAAAAAAATATTTTGCTAGG - Intergenic
964957331 3:162377313-162377335 TTTTTTAAACATTTTTTTCTAGG + Intergenic
965214260 3:165840635-165840657 ATGTAGAAATATACTTTTCTGGG - Intergenic
965245413 3:166260693-166260715 GTGTATATATATATTTATCCAGG + Intergenic
966049572 3:175597979-175598001 GTGTATAGACATACATTTCTGGG + Intronic
966107599 3:176355913-176355935 GTGTGTACACAAATTTTTATAGG - Intergenic
966738966 3:183214295-183214317 GTGTATAAGGATCATTTTCTTGG - Intronic
967415598 3:189214667-189214689 GTGTTAAAACATAGATTTCTGGG - Intronic
967483116 3:189997927-189997949 GTGTTTAAACAACTTTTTCCAGG - Intronic
967819070 3:193824600-193824622 CTGTATAAACATAGTTTTCTTGG + Intergenic
968379860 4:83081-83103 GTATATACACACATTTTTCAGGG + Intronic
969223298 4:5775754-5775776 CTGTGTGTACATATTTTTCTTGG + Intronic
970114410 4:12677717-12677739 GTGTTTACATGTATTTTTCTTGG + Intergenic
970114918 4:12684191-12684213 AAGTATAAACATATTCTTCTAGG + Intergenic
970180981 4:13393462-13393484 GCTTATATATATATTTTTCTTGG - Intronic
970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG + Intronic
971334317 4:25708743-25708765 GTGGATAAACACATTATACTAGG - Intergenic
971547054 4:27899262-27899284 GTGTATATATATATTTATTTGGG - Intergenic
972010242 4:34170231-34170253 GTTTAAAAACATTTTTTTCTTGG + Intergenic
972107409 4:35506828-35506850 ATTTAAAAACATATTTTACTTGG + Intergenic
972180576 4:36459762-36459784 GTTTATATATATATTTTTGTTGG + Intergenic
972475000 4:39441858-39441880 GTGTCTATACATATATTTATTGG - Intronic
972706697 4:41551720-41551742 GTCTATAAACATAGTTTTATTGG + Intronic
972719864 4:41685217-41685239 GTCTATACACATATTTACCTGGG + Intronic
973184799 4:47313300-47313322 GTGTGTGAAAATATTTTTGTTGG - Intronic
973256798 4:48121684-48121706 ATGTACAGACATTTTTTTCTTGG - Intronic
974332013 4:60492575-60492597 GTTTATAAACTGATTTTTCAAGG + Intergenic
974718899 4:65710410-65710432 GTGAATTAACAGATTTTTGTTGG + Intergenic
974784092 4:66595032-66595054 GTGTATAAACACATTACTCTGGG - Intergenic
975288069 4:72643558-72643580 GTGTATAAAAACATTTTTTTGGG - Intergenic
975323528 4:73035326-73035348 GTATGTAAACATATTTGGCTAGG + Intergenic
975834278 4:78405337-78405359 GTCAATAAACATAGATTTCTAGG - Intronic
976586001 4:86797800-86797822 TTGTTTAAAAATATTTTTATGGG - Intronic
976809283 4:89083279-89083301 GTTTACAAACATATTTTTCCAGG - Intronic
977827833 4:101554469-101554491 TTGGATAAACATACTTTTTTGGG - Intronic
978396480 4:108285944-108285966 GTGTATGAGCACATTTTTCTAGG + Intergenic
978396766 4:108289052-108289074 GTGTAAAAACATCTTTAACTGGG + Intergenic
978564027 4:110063228-110063250 ATTTATATAGATATTTTTCTTGG + Intronic
978746347 4:112198795-112198817 GGGTATAATTATATTTATCTTGG - Intergenic
979228746 4:118322124-118322146 GATTTAAAACATATTTTTCTAGG - Intronic
979298402 4:119058421-119058443 CTTTATAAAAATATTTTCCTTGG + Exonic
979352791 4:119665158-119665180 GTATATAAAGATAGTTTTCTGGG - Intergenic
979521536 4:121673288-121673310 GTATATAAGCTTATTTTTTTAGG - Intronic
979735952 4:124084507-124084529 GAATATAATCATATTTTTCTTGG - Intergenic
979940930 4:126762192-126762214 ACCAATAAACATATTTTTCTAGG + Intergenic
980273404 4:130616215-130616237 GAATATAAACAAATTTTTCCAGG + Intergenic
980620718 4:135299302-135299324 ATATATAAAGATTTTTTTCTGGG + Intergenic
980635920 4:135502908-135502930 GTGTCTAATAATATTTTGCTGGG - Intergenic
980679922 4:136147095-136147117 GTGCAGAAACATATTTTCCTTGG - Intergenic
980836112 4:138194606-138194628 GTATATATAGACATTTTTCTTGG - Intronic
980858345 4:138467983-138468005 GTGTGTATATATATTTTTATTGG + Intergenic
981227293 4:142312372-142312394 GAGGATAAAGATATTTTCCTGGG - Intronic
981271388 4:142850321-142850343 GTGCATGCTCATATTTTTCTGGG - Intergenic
982936170 4:161479122-161479144 GTATCTAAACACATTTTTATAGG - Intronic
983162078 4:164428667-164428689 GTGTGTAAACATTTTTGCCTTGG - Intergenic
983176470 4:164594402-164594424 GTGTATACTAACATTTTTCTAGG + Intergenic
983450505 4:167905369-167905391 GTGTATATACATATATGTATAGG - Intergenic
983479784 4:168258843-168258865 GTATGAAAACATATTTTTGTGGG - Intronic
986099066 5:4588669-4588691 TTGTGAAAACATATTCTTCTTGG - Intergenic
986695304 5:10349943-10349965 GTGTTTAACCAATTTTTTCTGGG + Intergenic
986803683 5:11287457-11287479 TTATATAGACATATTTTTGTTGG + Intronic
986888395 5:12269015-12269037 GTATAGAAAGAAATTTTTCTAGG - Intergenic
987137474 5:14913257-14913279 CTGTCTAATCCTATTTTTCTCGG + Intergenic
987352027 5:17030687-17030709 ATGTATCAACATATTCTTTTGGG - Intergenic
988224393 5:28393592-28393614 GTTTGTAAAAGTATTTTTCTTGG - Intergenic
988435771 5:31173367-31173389 GTTTTTAAACATATTTTTATGGG + Intergenic
988446630 5:31293391-31293413 GATTATAATCATTTTTTTCTGGG - Intronic
989361105 5:40602190-40602212 GATTACAGACATATTTTTCTAGG - Intergenic
989411465 5:41124295-41124317 ATGAAAAAAGATATTTTTCTTGG + Intergenic
989522931 5:42422630-42422652 TTGTTTAAACATTTCTTTCTGGG + Intergenic
989524089 5:42433255-42433277 GTGTTTTAATTTATTTTTCTCGG + Intronic
991452892 5:66771487-66771509 GTGTGTAAATATATTTCTATCGG + Intronic
991578562 5:68130718-68130740 GTCTATAAACATTTTATTTTAGG - Intergenic
991800471 5:70357367-70357389 GTATATATACATTTTTTTTTCGG + Intergenic
991828129 5:70652674-70652696 GTATATATACATTTTTTTTTCGG - Intergenic
991892829 5:71356807-71356829 GTATATATACATTTTTTTTTCGG + Intergenic
992275074 5:75107333-75107355 GTGTAGAAAAATACCTTTCTGGG + Intronic
992419144 5:76584170-76584192 CTATATAAAAATATTTTTCTCGG - Intronic
993032517 5:82721724-82721746 ATGTGTAAAAATATTATTCTAGG - Intergenic
993599117 5:89898576-89898598 GTGTATAATCATATTATTCTTGG - Intergenic
994364196 5:98892769-98892791 GTGTATGAACTTTTTTTTTTAGG + Intronic
994604330 5:101947671-101947693 CTGTATACAGTTATTTTTCTTGG + Intergenic
994728803 5:103467759-103467781 GTGTAGAAATATGTTTTTATAGG - Intergenic
995020788 5:107365263-107365285 GTGCATAAACATATTGTTGGAGG + Intergenic
995103243 5:108342382-108342404 GTGTATTTAAAAATTTTTCTAGG - Intronic
995159496 5:108962016-108962038 GATGATAAACATATTTTTATGGG - Intronic
995608494 5:113884236-113884258 TTGTTTATACATAATTTTCTTGG + Intergenic
995738231 5:115326420-115326442 ATGTATACATGTATTTTTCTAGG - Intergenic
996042859 5:118835927-118835949 GTGTATAAATGTAATTTTATGGG - Intergenic
996128823 5:119756178-119756200 TTTTAAAAAAATATTTTTCTTGG + Intergenic
996497168 5:124172069-124172091 TTGTATAAACACATATTTCTGGG - Intergenic
997175633 5:131773605-131773627 GTGCATAAACACATTTTTCTAGG - Intronic
997207457 5:132058195-132058217 GTGTATATATATAATTTTTTTGG + Intergenic
997730408 5:136168309-136168331 GTGTATAAACCTTTTTCTGTAGG + Intronic
999814768 5:155164815-155164837 GTGTTTAAAAATATGTTCCTTGG + Intergenic
999943616 5:156571358-156571380 CTTTTTAAACATATTTTTTTTGG + Intronic
999979489 5:156944317-156944339 GTGTGCACACACATTTTTCTGGG - Intronic
1000034720 5:157436741-157436763 AAGTACAAAGATATTTTTCTAGG - Intronic
1000844786 5:166265873-166265895 GTCTATAAACAGATTATTCCCGG + Intergenic
1002375536 5:178786451-178786473 GTGTATAAATATATTTCCCCCGG + Intergenic
1003103020 6:3191929-3191951 GTATATATATATATTTTTTTTGG + Intergenic
1003239042 6:4326404-4326426 TTGTATTAACTAATTTTTCTGGG - Intergenic
1003354158 6:5350307-5350329 GTGTATAAAAAAATCTTGCTGGG - Intronic
1003750069 6:9045345-9045367 GTGTATTTACTTATTTTTCAAGG - Intergenic
1003754968 6:9107531-9107553 TTGAATAAATATATTTTCCTGGG - Intergenic
1005087244 6:22019774-22019796 GTTTATTTACATATTTTCCTAGG + Intergenic
1005195268 6:23275696-23275718 GTGTACAAAGCCATTTTTCTTGG + Intergenic
1005790292 6:29293298-29293320 GTGAATCAAAATATATTTCTAGG - Intergenic
1006002888 6:30979897-30979919 GACTATAAATTTATTTTTCTTGG - Intergenic
1006490859 6:34386554-34386576 GTCTATAAATAAAGTTTTCTGGG + Intronic
1006686131 6:35835854-35835876 GAGTATAAGCAAATTATTCTCGG - Intronic
1007518712 6:42434554-42434576 GTGAATAAAGATTTTTTTCCAGG + Intronic
1007770809 6:44190738-44190760 TTGTATAAAAATATTTTACTGGG - Intergenic
1008880956 6:56379598-56379620 GTTTATGTACATATGTTTCTAGG - Intronic
1009376270 6:62974210-62974232 ATGTTTAAACATTTCTTTCTTGG - Intergenic
1009560171 6:65230446-65230468 TTGTATAAAAATAATCTTCTGGG - Intronic
1009626248 6:66141514-66141536 GTCTATCAACGTATTTCTCTTGG + Intergenic
1009734056 6:67652289-67652311 GTATATAAACATATCTTCTTAGG - Intergenic
1009819161 6:68777377-68777399 ATGTAGAAATATATTTTTTTTGG + Intronic
1010253932 6:73736511-73736533 GAGTATAAATATATTTTTTGGGG + Intronic
1010398350 6:75418723-75418745 GTTTATTTATATATTTTTCTTGG - Intronic
1010451320 6:76006456-76006478 GTGTATATACATATGTATATAGG + Intronic
1010568681 6:77451019-77451041 GTGCATTTACATATTTTTCTTGG - Intergenic
1010580252 6:77587688-77587710 GTGTATCAACATCTTTTTAAAGG + Intergenic
1010628167 6:78164527-78164549 GAATATTAACATTTTTTTCTGGG + Intergenic
1010892788 6:81335110-81335132 GAGTATAAACATGGTTCTCTAGG + Intergenic
1012110094 6:95219314-95219336 ATGTATATATATATTTTTGTTGG - Intergenic
1012124051 6:95404707-95404729 GGGTATATTCATATTTCTCTAGG + Intergenic
1012188930 6:96257037-96257059 CTGTCTAAACAGATTTTTATAGG - Intergenic
1012645172 6:101669753-101669775 GTGGATAAACATCTATTTTTTGG + Intronic
1012690973 6:102310166-102310188 ATGTATAAAAATAATATTCTTGG + Intergenic
1012801793 6:103839491-103839513 GTGAATAAGCATAATATTCTGGG - Intergenic
1013277444 6:108599308-108599330 ATGTATAAAAATATATTTCTTGG - Intronic
1014077675 6:117255027-117255049 GTTTATATACATCTGTTTCTAGG + Intergenic
1014106342 6:117567466-117567488 GTGTACAAAAATCATTTTCTAGG - Intronic
1014602137 6:123426493-123426515 GTGTCTATACATATTTTTAGAGG + Intronic
1014744320 6:125182168-125182190 ATTTATAAACATATATTACTTGG + Intronic
1015627333 6:135193453-135193475 GTAAATAAAAATATTTTTCTTGG - Intronic
1016047472 6:139495597-139495619 TGGTATAAACATTTTTTTCCAGG - Intergenic
1016193612 6:141303154-141303176 TTTTTTAAATATATTTTTCTTGG - Intergenic
1017505676 6:155066673-155066695 GTGTATATATATAATTTTTTTGG + Intronic
1018741426 6:166732150-166732172 TTGTATTAAAGTATTTTTCTTGG - Intronic
1018834927 6:167475829-167475851 CTTTCTAAAAATATTTTTCTTGG + Intergenic
1018984654 6:168627088-168627110 TTTTCTATACATATTTTTCTTGG - Intronic
1019774341 7:2903587-2903609 GTGTAGACACACACTTTTCTGGG - Intergenic
1019840068 7:3432577-3432599 GGGAAGAAACATATTTTGCTAGG + Intronic
1020470277 7:8526905-8526927 GTGCATAAACTTCTGTTTCTTGG + Intronic
1020553219 7:9634570-9634592 GTGTACATACATATATATCTTGG + Intergenic
1021038419 7:15830065-15830087 GTGTATAAAATCATTCTTCTGGG + Intergenic
1021074002 7:16278055-16278077 TAGTATAAAGATATCTTTCTTGG - Intronic
1021357235 7:19666287-19666309 CTGCATAAACAAATTTTTCTTGG + Intergenic
1021790388 7:24198778-24198800 GTGTAAAATTATATTTTACTTGG - Intergenic
1023230882 7:38027769-38027791 GTGTATTAACATTATTTCCTGGG - Intergenic
1023561327 7:41476058-41476080 ATGTAGAAACATTTTTTGCTCGG - Intergenic
1025281735 7:57630659-57630681 TTTTATAAACATAATTTCCTGGG + Intergenic
1025302994 7:57834858-57834880 TTTTATAAACATAATTTCCTGGG - Intergenic
1025579128 7:62688574-62688596 GTGTAAAAACACTGTTTTCTTGG + Intergenic
1026294968 7:69043399-69043421 GTGTATATATATATATTTATAGG - Intergenic
1027146313 7:75697202-75697224 GTGTATAAAGGTAAGTTTCTGGG + Intronic
1027399261 7:77790465-77790487 GTTTATACAAGTATTTTTCTTGG + Intergenic
1027454287 7:78368557-78368579 TTATATACACATATTTTTCTTGG - Intronic
1027594647 7:80158007-80158029 GCGTATAAAAATATTCTTCAGGG - Intronic
1028329285 7:89568668-89568690 GTATAGAATCATATTTTTCCAGG - Intergenic
1028871606 7:95776496-95776518 GTGCATAAATGTAGTTTTCTAGG + Intronic
1029890242 7:103921154-103921176 GTTTATAAACATTTTTGTCAAGG - Intronic
1030108041 7:106003381-106003403 TTCTATAACCATCTTTTTCTGGG + Intronic
1030153732 7:106431013-106431035 CTGTATAAACTTATTTCTCAGGG - Intergenic
1031247398 7:119332761-119332783 GTTTTTAAAAATTTTTTTCTGGG + Intergenic
1032377857 7:131441675-131441697 AAGTATAAACATCTTTATCTTGG - Intronic
1032794128 7:135263888-135263910 CTGCATAACCTTATTTTTCTTGG - Intergenic
1036282306 8:7411064-7411086 TTCTTTAAAGATATTTTTCTTGG - Intergenic
1036339162 8:7900506-7900528 TTCTTTAAAGATATTTTTCTTGG + Intergenic
1036733983 8:11291527-11291549 TTTTTAAAACATATTTTTCTTGG + Intronic
1037035045 8:14156167-14156189 TTATTTAAAAATATTTTTCTTGG + Intronic
1038094132 8:24288434-24288456 GTGTATAAAAATATATATTTAGG - Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1039642171 8:39235622-39235644 GTGTAAAAACAAATTTTACTGGG + Intronic
1041231140 8:55753506-55753528 GTGTATAAACATATTGTTTATGG - Intronic
1041328122 8:56691214-56691236 GTTTATTAAGATCTTTTTCTTGG + Intergenic
1041407066 8:57511246-57511268 GTGAATAAATATATCTTTTTTGG + Intergenic
1043199257 8:77342734-77342756 GTGTATGTACATATTTTCCATGG + Intergenic
1043317877 8:78943822-78943844 CAGTATAAACACATTTTTTTTGG + Intergenic
1043478552 8:80629004-80629026 GTATTTAAAAATATTTTTCCTGG + Exonic
1043811478 8:84747298-84747320 ATGAATAAAAATATTTTTATTGG + Intronic
1044435465 8:92157406-92157428 GATTAAAAACATATTTTGCTGGG - Intergenic
1045351446 8:101344376-101344398 GTGTATAGACATTCTCTTCTTGG + Intergenic
1045810284 8:106213488-106213510 GTATAAAATTATATTTTTCTTGG - Intergenic
1045828235 8:106426769-106426791 GTGTATGAACATTATTTGCTAGG + Intronic
1046091485 8:109508075-109508097 ATATATATACATATGTTTCTAGG + Exonic
1046724745 8:117662282-117662304 GTGTTTAAAAATATTTTCCCTGG - Intergenic
1046918772 8:119705236-119705258 TTGGTTAAACATTTTTTTCTGGG - Intergenic
1048160066 8:132010560-132010582 TTGTATATACATATTTTCCAAGG + Intronic
1050705932 9:8397437-8397459 CTGTATTAACATATTTTCCTAGG + Intronic
1050788421 9:9434700-9434722 TTGTATATACATATATTTCTGGG - Intronic
1051315924 9:15831831-15831853 GTTTGTAATCATATTTTTCCTGG + Intronic
1051676374 9:19562619-19562641 CTGTACATACATATTTTTTTAGG - Intronic
1052627182 9:30991442-30991464 GTTTATAAGCATATTTTAATTGG + Intergenic
1052671158 9:31559202-31559224 GTGTCTTCACATAGTTTTCTAGG - Intergenic
1053033837 9:34808030-34808052 TTGCAAAAACATATTTATCTGGG + Intergenic
1054909882 9:70444719-70444741 AGGTATAAAAAGATTTTTCTTGG - Intergenic
1055107712 9:72529516-72529538 GTGTATATACATATGTGTTTAGG + Intronic
1057730477 9:97603989-97604011 GCATTTAAAAATATTTTTCTAGG - Intronic
1058572301 9:106359569-106359591 GTGTTTAAACACCTATTTCTTGG + Intergenic
1059056314 9:110984639-110984661 GTGTTTGAACAAATTTTTCAGGG - Intronic
1060907828 9:127323756-127323778 GTGTATATATATATATTTATGGG - Intronic
1185454303 X:300706-300728 GTGTATATATATATTTTTTGAGG + Exonic
1185740326 X:2526817-2526839 GTGCATAGACACATATTTCTAGG + Intergenic
1185853615 X:3511877-3511899 GAAAATGAACATATTTTTCTTGG - Intergenic
1185913821 X:4012073-4012095 GTATATAGACTTATATTTCTGGG - Intergenic
1185962414 X:4559403-4559425 ATGTCTAAACATATTTTCTTGGG + Intergenic
1186328275 X:8504033-8504055 GTGTATAAACATATATTTCCAGG + Intergenic
1187335602 X:18378639-18378661 GTGCATACACATGTTTCTCTGGG - Intergenic
1188128795 X:26404473-26404495 GTGAATAAACATACTTCTCATGG - Intergenic
1188158091 X:26766836-26766858 TTTGATAAACATATTTTTGTGGG - Intergenic
1188179521 X:27036887-27036909 CAGTATGAATATATTTTTCTTGG - Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189485998 X:41432532-41432554 GTGTATATATATATTTTTTGAGG - Intergenic
1189752009 X:44231811-44231833 GTGTACAAACATGTTTATTTGGG - Intronic
1189860940 X:45271278-45271300 GTGAATAATCATTTTTATCTGGG + Intergenic
1189993761 X:46619409-46619431 GTACATATACATATTTTTTTTGG - Intronic
1190514496 X:51208764-51208786 GTGTTTAAACTGCTTTTTCTAGG - Intergenic
1191636046 X:63378220-63378242 TTGTATAAAAATAACTTTCTAGG - Intergenic
1192192685 X:69001818-69001840 ATGTTCAAACATCTTTTTCTTGG - Intergenic
1192546015 X:72015025-72015047 GTGTATAAAAATTTCTGTCTTGG + Intergenic
1193086810 X:77454346-77454368 AAGTATAAAAATATTTATCTGGG + Intronic
1193480393 X:82020329-82020351 GGGTATAAACATAGTTCTCCAGG + Intergenic
1194902024 X:99523756-99523778 ATGTATATACATAGTTTTCATGG - Intergenic
1194907945 X:99602192-99602214 GTATATGTACATTTTTTTCTTGG - Intergenic
1195444640 X:104938163-104938185 GGATATAAACATATTTATTTTGG + Intronic
1195611534 X:106872442-106872464 ATATATATAAATATTTTTCTGGG - Intronic
1195626806 X:107012264-107012286 GCATATAAACATATTTTTTTAGG + Intergenic
1195800781 X:108707176-108707198 GAGAATAAACATCTTTTTCTTGG + Intergenic
1196347449 X:114680585-114680607 GTGTTTGTACAGATTTTTCTTGG + Intronic
1196738145 X:118998959-118998981 GTGTATGAAAATACTTTTTTAGG - Intronic
1196888395 X:120269102-120269124 GGGGATCAATATATTTTTCTTGG - Intronic
1197619405 X:128730911-128730933 CTTTTTAACCATATTTTTCTTGG - Intergenic
1197634571 X:128900586-128900608 ATGTATTAAGATATATTTCTGGG - Intergenic
1197884064 X:131199827-131199849 TTTTATATACATATTTTTATTGG - Intergenic
1198012952 X:132577955-132577977 GTGTGTATACATATTTATGTAGG + Intergenic
1198064311 X:133081212-133081234 GTGAATAAAAATACTTTTCTGGG + Intronic
1198778887 X:140212963-140212985 GTGTATATACATATATGTATGGG - Intergenic
1198802881 X:140465437-140465459 ATGGATAAACATATTTTATTGGG + Intergenic
1199278469 X:145972936-145972958 GTGTGTAAACATATTGTTAAAGG + Intergenic
1199382560 X:147187479-147187501 ATGTCTACAAATATTTTTCTGGG + Intergenic
1199384779 X:147211002-147211024 ATGTCTACAAATATTTTTCTGGG + Intergenic
1199504486 X:148545995-148546017 CTCTATAAACATAATTTACTAGG - Intronic
1199564976 X:149206266-149206288 GTGCATAAACATATACTTCCAGG - Intergenic
1200759384 Y:7023652-7023674 GTCTATAAATAAAGTTTTCTTGG - Intronic
1200809832 Y:7472638-7472660 GAAAATGAACATATTTTTCTTGG + Intergenic
1200875637 Y:8151744-8151766 GAGTAAAAACCTGTTTTTCTGGG - Intergenic
1201433864 Y:13934733-13934755 GTGTATAAACATATATTTCCAGG - Intergenic
1201752900 Y:17453274-17453296 GTGTCTAAAAATATTTTCTTGGG + Intergenic