ID: 907196667

View in Genome Browser
Species Human (GRCh38)
Location 1:52692751-52692773
Sequence CAGTGATAGCTGCTACAAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907196667_907196669 14 Left 907196667 1:52692751-52692773 CCAGTTTGTAGCAGCTATCACTG 0: 1
1: 0
2: 1
3: 8
4: 124
Right 907196669 1:52692788-52692810 ACAGTTAAACTTCAACACCTTGG 0: 1
1: 0
2: 1
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907196667 Original CRISPR CAGTGATAGCTGCTACAAAC TGG (reversed) Exonic
900305980 1:2008371-2008393 CAGTGAGAGCCCCTTCAAACTGG - Intergenic
900548669 1:3242608-3242630 CAGTGATGGCTGCTAGATTCAGG - Intronic
904561422 1:31400417-31400439 CAGTGATACCTGCTACAACATGG + Intergenic
907196667 1:52692751-52692773 CAGTGATAGCTGCTACAAACTGG - Exonic
914326950 1:146627670-146627692 CACTGATAGATGCTACAACATGG + Intergenic
915719807 1:157976524-157976546 CAGTGATAACTACTACAAACAGG + Intergenic
917367821 1:174252804-174252826 CAGTCATAACTGCTACAACTGGG + Intronic
919064542 1:192677080-192677102 CAGTGATAGGTGCCAGATACTGG - Intergenic
920810183 1:209278025-209278047 CAGTGATAGCTGATTGATACAGG + Intergenic
921624825 1:217368073-217368095 CAGTGGTAGCCTCTGCAAACAGG + Intergenic
1069347981 10:67492596-67492618 CAGTGATAACTGCTATGAAGAGG + Intronic
1070822447 10:79368339-79368361 TACTGATACCTGCTACAACCTGG + Intergenic
1072938769 10:99739188-99739210 TAGTGAGAGCTTCTTCAAACTGG + Intronic
1075702973 10:124481285-124481307 TAGTGACAGCTACTACAAAAAGG - Intronic
1077451012 11:2645551-2645573 CAGTGGCAGCAGCTATAAACAGG + Intronic
1078977487 11:16495231-16495253 CAGTGGTAGCAGCTATAGACAGG - Intronic
1079068316 11:17318671-17318693 CAGTGAGAGTTTCTTCAAACTGG - Intronic
1082079990 11:48005504-48005526 CAGTGATACCTGCTCCAACATGG - Intronic
1084082870 11:66840433-66840455 CAGTGATAACTGATGCAAGCAGG - Intronic
1089114155 11:116080661-116080683 GAATGAAAGCTGCTTCAAACAGG - Intergenic
1089508682 11:118981694-118981716 CAGAATTGGCTGCTACAAACGGG - Intergenic
1093372867 12:18385864-18385886 CAGTGATTGTAGATACAAACGGG - Intronic
1093769202 12:22999626-22999648 TACTGATACCTGCTACAACCTGG - Intergenic
1094354202 12:29560273-29560295 CAGTGAGTGCTCTTACAAACAGG - Intronic
1094554936 12:31489732-31489754 CTGAGATAGGTGCTACAAAAAGG + Intronic
1096577522 12:52562685-52562707 CAGTGATATGTGCTACAATGTGG - Intergenic
1098032795 12:66271692-66271714 CAGTGATAAATGCTACAAAAGGG - Intergenic
1100162935 12:91882152-91882174 CAGTGACAGGTGCTAGAAACAGG + Intergenic
1105631464 13:22173586-22173608 CAGTGGTAACTGCTACAAAATGG - Intergenic
1106529833 13:30579818-30579840 CATTGATAGTTGATACTAACTGG + Intronic
1109926246 13:69143642-69143664 AAGTGTTAGGTGCTACAAAATGG - Intergenic
1112784655 13:102938530-102938552 CAGAGCTAGCTTCTCCAAACAGG - Intergenic
1115576972 14:34720953-34720975 TAGTGATACATACTACAAACTGG - Intergenic
1116891686 14:50274944-50274966 CAATGATGGTTGCTACAGACTGG + Intronic
1120277966 14:82401402-82401424 AGGTGATAGATGCTATAAACTGG + Intergenic
1121474139 14:94179377-94179399 TACTGATAGCTGCTACAACATGG - Intronic
1124515511 15:30364225-30364247 CAAAGATAACTGCAACAAACAGG + Intronic
1124727410 15:32166499-32166521 CAAAGATAACTGCAACAAACAGG - Intronic
1125146060 15:36469982-36470004 CAGGCAGAGCTGCTACAAGCAGG + Intergenic
1126358018 15:47816756-47816778 CAGTGATTGCTGCTGCCAAAGGG - Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1128971173 15:72107750-72107772 CAGTGGGAGCTTCTTCAAACAGG - Intronic
1134831115 16:17323722-17323744 CAGAGAAAGCAGCTACACACTGG - Intronic
1134892312 16:17852006-17852028 CAGTGATGCCTGCTACCAGCTGG - Intergenic
1137259629 16:46814207-46814229 AAGTGATAGCTGCTATAGAACGG + Intronic
1138250870 16:55500899-55500921 TAGTGAAAGCTTCTACAAGCAGG - Intronic
1140006610 16:71083270-71083292 CACTGATAGATGCTACAACATGG - Intronic
1140549231 16:75846142-75846164 CATTGATAGATGCCACAACCAGG - Intergenic
1144153970 17:12480096-12480118 CAGAGAGAGCTGCTACAATAAGG + Intergenic
1147478589 17:40737785-40737807 CAGTGTAAGCTGTTGCAAACAGG - Intergenic
1147668932 17:42165661-42165683 CAGGGATATCTGCTCCAATCAGG + Exonic
1149421145 17:56511540-56511562 CAGTCATAGGTGCCACCAACAGG - Intronic
1149456987 17:56796377-56796399 CAGTGATCCCTGCTACAACATGG + Intronic
1157084187 18:44561500-44561522 CAGTGAGAGCTCCTTTAAACTGG + Intergenic
1157172643 18:45422241-45422263 CTGTAATAGCTGCTGCAAACAGG - Intronic
1157272206 18:46284604-46284626 TAGTAATAGCTGCCACATACTGG - Intergenic
1160403270 18:78627431-78627453 CACTGTTAGCTGCTAAACACTGG + Intergenic
1163976351 19:20856729-20856751 CATTCACAGCTGCTACAAAGAGG + Intronic
1165991446 19:39817242-39817264 CGGTAATAACTGCTACAGACCGG + Intergenic
1166608678 19:44168844-44168866 CATCAATAGCTGCTAAAAACTGG - Intronic
925796593 2:7551896-7551918 TAGTGATAGATGCAACAAAATGG - Intergenic
927017469 2:18980082-18980104 AAGTGATTACTGCTACAAAGTGG + Intergenic
934922037 2:98352168-98352190 CAGTGATACATGCTACAACATGG - Intronic
938880079 2:135576684-135576706 CAGTGATACATGCTACAATGTGG + Intronic
941852800 2:170201016-170201038 CAGTGGATGCTGCTAGAAACAGG - Intronic
942100742 2:172580787-172580809 TACTGATAAATGCTACAAACTGG + Intronic
942557196 2:177184131-177184153 CAATGCTAGCTGCTAAACACAGG - Intergenic
942686114 2:178533768-178533790 CAGTTATAGTTACTCCAAACCGG + Exonic
948022817 2:234750411-234750433 CAGTGGAAGCTTCTTCAAACTGG - Intergenic
1169408353 20:5345206-5345228 CAGTGAAAGCTAATACAAAGAGG + Intergenic
1171000315 20:21408293-21408315 TAGTGATTGCTTCTAGAAACAGG - Intergenic
1173160790 20:40650929-40650951 CAGTGATAACTGTAATAAACCGG - Intergenic
1175043558 20:56079632-56079654 CACTGATACCTGCTACAACCTGG - Intergenic
1176153006 20:63602689-63602711 CAGTGAGAGCTGCTCCAAAAAGG - Intronic
1176311078 21:5149753-5149775 CAGTGGCAGCTGCTGAAAACGGG + Intronic
1179309078 21:40181013-40181035 TAGTGGTAGTTGCTACAGACAGG - Intronic
1179845973 21:44112282-44112304 CAGTGGCAGCTGCTGAAAACGGG - Intronic
1182786702 22:32913815-32913837 CAGTGAGACCTGCCACAAAACGG - Intronic
1183140080 22:35929532-35929554 CAGTGATACATACTACAACCTGG + Intronic
1183277524 22:36908755-36908777 CAGTGACAGCTCCTTCAAATGGG - Intergenic
1185261092 22:49863909-49863931 CAGTGAGAGCCCCTACAAGCTGG + Intronic
952185657 3:30965599-30965621 CAGTGATAGGTGGTAAAAATAGG + Intergenic
960441645 3:117696085-117696107 TTGTGATAGCTGCTGCAAGCTGG - Intergenic
961395536 3:126585952-126585974 GAGTGGTAGCTGCTAAAGACTGG + Intronic
966170523 3:177075041-177075063 CTGTGATAGCTACAACAAACTGG + Intronic
968224225 3:196963110-196963132 TAGTGATACCTGCTACAACACGG - Intronic
973339647 4:48990963-48990985 CACTGATACATGCTACAACCTGG + Intronic
977114468 4:93005733-93005755 CACTGATACCTGCTACAATGTGG + Intronic
977498281 4:97804021-97804043 CAGAGATAACTGCTACAGATAGG - Intronic
979016174 4:115436707-115436729 CAATTATAGCTGCTTTAAACTGG - Intergenic
979118760 4:116865532-116865554 AAGTAATAGCTTCTAGAAACTGG - Intergenic
982168046 4:152633295-152633317 CAGTAAGAGCTGCTACACTCTGG - Intronic
987147453 5:15006014-15006036 CAGAGATGCCTGCTGCAAACAGG + Intergenic
990801573 5:59610064-59610086 CATTCATAGCTGGAACAAACTGG + Intronic
991026977 5:62040336-62040358 TAGTGATTGTTGCTACTAACAGG - Intergenic
993633838 5:90320112-90320134 CAGTGGTAGTTGTTACATACTGG - Intergenic
994191384 5:96873316-96873338 CACTGATAGGTGCTAGAAAGAGG + Exonic
995133105 5:108650866-108650888 CAGGAATAGCTGCTATAAAAAGG + Intergenic
995206393 5:109486119-109486141 ATGTGAAAGCTGCTACACACGGG - Intergenic
996223445 5:120960970-120960992 CAGTGATAGCAGCTCCAGGCAGG + Intergenic
996534619 5:124564631-124564653 CAGTGATTACTTCTACAAAGCGG + Intergenic
999410309 5:151344453-151344475 GAGTGTTAGCTGCTAAAACCAGG - Intronic
999812275 5:155139014-155139036 CAGTGCTATCTGCTGAAAACAGG + Intergenic
1002323271 5:178388376-178388398 CAGGGATACCTGCTTCCAACAGG - Intronic
1002985879 6:2190705-2190727 CAGTGATAGGTGCTGCCAAGTGG - Intronic
1003732625 6:8843002-8843024 CAGATATAGCAGCTACAAAATGG - Intergenic
1004884221 6:20036421-20036443 CAGTGATATCTGTGAGAAACAGG - Intergenic
1007719626 6:43877395-43877417 CAGTGATAGGTGCTGCACAGTGG - Intergenic
1015455889 6:133425668-133425690 CAGTCATAGCGGCAACAAAGTGG - Intronic
1016914084 6:149228518-149228540 CTGTGACAGCTGCTACCCACTGG + Intronic
1017095769 6:150804092-150804114 CAGAGATACCTGCAACAAAATGG - Intronic
1021281049 7:18718579-18718601 CAGTGATACATGCTACAACATGG - Intronic
1021467609 7:20963155-20963177 CAGTAAAAGCTGTTACAAAACGG + Intergenic
1021625708 7:22591149-22591171 CCGTGATACCTGGTACAAAAAGG - Intronic
1021761156 7:23904234-23904256 CAGTATTAGCTCCTAGAAACTGG - Intergenic
1022277449 7:28869503-28869525 CACTGATAGCATCTAAAAACGGG + Intergenic
1027938372 7:84637658-84637680 CACTGCTGGCTGCTGCAAACAGG - Intergenic
1031628306 7:124016007-124016029 CAGTGATTGCTGGTAAATACCGG + Intergenic
1037394515 8:18427964-18427986 CAGTGATAGCTCTTTGAAACTGG + Intergenic
1040346290 8:46500866-46500888 CAGAGACAGATGCTACAAAACGG + Intergenic
1042435792 8:68763243-68763265 CAGTGATATCTTCTGCAAGCAGG + Intronic
1043479757 8:80641134-80641156 TAGTTATAGCTGCTCCAAGCTGG + Exonic
1055850131 9:80617040-80617062 CAGTGATACATGCTACAACATGG + Intergenic
1057735693 9:97657640-97657662 TAGTGGTAGCTGCTAAAAGCAGG - Intronic
1059285285 9:113166879-113166901 CAGGGATTGATGCTACAGACAGG + Intronic
1060448352 9:123713155-123713177 AAGTTATAGCTGCTACCAGCAGG + Intronic
1185768997 X:2750523-2750545 CCGTGACATCTGCTACAAAGTGG - Intergenic
1188562801 X:31488960-31488982 CAGTGATAGGTTCTAGAAAGAGG - Intronic
1192810911 X:74546660-74546682 CAGTCATGGCTGGTAAAAACTGG - Intergenic
1194489089 X:94525081-94525103 CAGTGACAGCATCTAAAAACAGG - Intergenic
1196557813 X:117110962-117110984 CACTGATAGCTGCTAAAATATGG - Intergenic
1201480999 Y:14439497-14439519 CAGTGGTAGCTTCTCCAAATTGG + Intergenic
1202339697 Y:23850319-23850341 CAGTGAGAGCTACTTCAAAAGGG - Intergenic
1202531069 Y:25819763-25819785 CAGTGAGAGCTACTTCAAAAGGG + Intergenic