ID: 907207831

View in Genome Browser
Species Human (GRCh38)
Location 1:52790209-52790231
Sequence ATCTACTTTCTTTAATTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 394}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907207831 Original CRISPR ATCTACTTTCTTTAATTTAG TGG Intronic
901584089 1:10272785-10272807 AACTATTTTTTTTAAATTAGGGG + Intronic
901864852 1:12098690-12098712 ACCTCCTTTCTTAATTTTAGAGG - Intronic
902596330 1:17511991-17512013 ATCTAGGTTCTTTAATTTCCAGG - Intergenic
904507425 1:30969633-30969655 ATCTACTTTTTTTTTTTTGGTGG + Intronic
905088226 1:35403933-35403955 ATCTAAGTTGTTTAATTTATTGG + Intronic
906397496 1:45479613-45479635 TTCTATTTTATTTAATTCAGAGG + Intronic
907146722 1:52240800-52240822 AGCAACTTCCTTTAATTTATTGG + Intronic
907207831 1:52790209-52790231 ATCTACTTTCTTTAATTTAGTGG + Intronic
907312008 1:53544215-53544237 ATCTATTTTCTGTAAATTATTGG - Intronic
907801856 1:57775027-57775049 ATCTAAGTTCTTGAATTTATTGG + Intronic
908130233 1:61068046-61068068 ATAAACTTTCTTGAATTTTGTGG + Intronic
908143799 1:61216354-61216376 ATGTTTTTTTTTTAATTTAGGGG - Intronic
908411977 1:63875794-63875816 AACTACTGTCTGGAATTTAGAGG + Intronic
908613906 1:65895678-65895700 ATTTACCTTCTTTAAATAAGTGG + Intronic
909965945 1:81910415-81910437 ATCTACTTTCTATAATAAACTGG - Intronic
910161588 1:84278109-84278131 ATCAACTGTCTAGAATTTAGAGG + Intergenic
911015836 1:93331325-93331347 ATTTACTTTATTTAATTTTATGG + Intergenic
911292385 1:96072831-96072853 ATTTACTTTCTATACTTCAGAGG + Intergenic
912252108 1:108021860-108021882 ATTTCCTTGGTTTAATTTAGAGG - Intergenic
913105548 1:115610573-115610595 ATCTACTGTTTTTAGTTTTGAGG + Intergenic
914894834 1:151660162-151660184 ATTAACTTTCTTAAATTTAGAGG + Intronic
915009897 1:152675827-152675849 ATCTACGTACTTTTATCTAGAGG + Intronic
917028875 1:170668355-170668377 ATCTGGTTTCGCTAATTTAGAGG - Intronic
918091664 1:181300476-181300498 ATTTTATTTCTTTAATTTGGGGG + Intergenic
918939215 1:190969736-190969758 ATATACTTTTATTGATTTAGGGG + Intergenic
919492024 1:198215918-198215940 ATCTCTTTTCTTTAATCTAGTGG - Intronic
920090203 1:203447299-203447321 AGCTCCCTTCTTTAATTTAGAGG + Intergenic
920150116 1:203899679-203899701 AACTACTTTCATTAGTTTTGTGG + Intergenic
920724588 1:208422145-208422167 ATCAACTCTCTATAATTCAGTGG - Intergenic
921822681 1:219635499-219635521 ATAAACTTTCCATAATTTAGAGG - Intergenic
921935532 1:220792573-220792595 ATATACTTTTTTGAATTTGGTGG + Intronic
921943270 1:220865428-220865450 ATCTATTTTGTTTAATTTGTTGG + Intergenic
923936927 1:238771914-238771936 ATCTTCTTTCTTTTATTACGTGG + Intergenic
924870681 1:248041007-248041029 TTCTACTTAATTTAAATTAGAGG - Intronic
1063067526 10:2624209-2624231 TTCTATTTTCTTTAATTTTGGGG + Intergenic
1063691274 10:8289753-8289775 AGCTATTTGCTTTAATTAAGAGG + Intergenic
1063741469 10:8826188-8826210 ATCAATATTCTTTAATTTAGTGG - Intergenic
1063743683 10:8855196-8855218 ATCTACTTTTTTTCTTTTTGAGG - Intergenic
1064683033 10:17830764-17830786 ATGTACTTTCTTTAAGTGAAAGG + Intronic
1064689303 10:17897688-17897710 ATCTATGTTCTTTAATTTGTGGG + Intronic
1065478346 10:26165334-26165356 CTCTACTATTTTTAATTTATTGG - Intronic
1066220361 10:33332134-33332156 GTCTTCTTTTTTTAATTTATGGG - Intronic
1067883113 10:50064353-50064375 ATTTACTTTTTTTATTTTTGAGG + Intergenic
1068199947 10:53770717-53770739 ATCTACATTATTTAATTCATAGG + Intergenic
1068627467 10:59264678-59264700 GTCTCCTTTCTTTAGCTTAGAGG - Intronic
1068860540 10:61843416-61843438 ATGAACTCACTTTAATTTAGGGG + Intergenic
1069293963 10:66820284-66820306 ATCCACTTTCTGTACTTTATAGG - Intronic
1069376370 10:67797210-67797232 ATTTACTTTCTTTCCTTTAAAGG - Exonic
1071011754 10:80948370-80948392 ATCTTCTTACTTTATTTTACAGG - Intergenic
1073713760 10:106077589-106077611 AACTTTTTTCTTCAATTTAGAGG - Intergenic
1074496343 10:113983172-113983194 AGCTACTTTATTTAATAAAGAGG + Intergenic
1074991776 10:118715097-118715119 TTCTACCTTTTTTAATTTAAAGG - Intronic
1075842055 10:125513146-125513168 TTCTTCTTTCTTTAATGAAGGGG + Intergenic
1076055745 10:127371105-127371127 ATGTACTATCTCCAATTTAGTGG + Intronic
1077748537 11:4936749-4936771 ATCTCCATTGTTTATTTTAGTGG - Intronic
1079794412 11:24781808-24781830 ATCTAATTTTTTTAATGTATTGG - Intronic
1080358709 11:31486945-31486967 ATATGCTTTCTTTTCTTTAGAGG - Intronic
1080952508 11:37051627-37051649 CTCTACTTTCTTGACTTCAGTGG - Intergenic
1081046914 11:38286025-38286047 TTCTAGGTTATTTAATTTAGTGG - Intergenic
1081288066 11:41296689-41296711 ATGTACTTTCTTTAGTTTCTTGG - Intronic
1082213572 11:49537168-49537190 ATCTTCTCTCAGTAATTTAGAGG + Intergenic
1082681418 11:56176417-56176439 ATCTTCTTTCTTGAATTCTGAGG - Intergenic
1082682780 11:56198101-56198123 ACATAATTTCTTTAATTAAGAGG + Intergenic
1083092876 11:60219038-60219060 ATCTCCTTGGTTTAATGTAGAGG + Intronic
1085825034 11:79838117-79838139 ATCTAATTTTTTAAATTTTGGGG - Intergenic
1086486753 11:87312256-87312278 TTGTACTTGCTTTAATTTAGTGG + Intronic
1087088335 11:94242529-94242551 ATCTACCTTCTTTATTTAATGGG - Intergenic
1087190222 11:95246444-95246466 ATTTATTTTATTTTATTTAGCGG - Intergenic
1087824630 11:102751176-102751198 ATCTAGTTTCTTTTATTTCTAGG - Intergenic
1088145655 11:106673170-106673192 ACCTGCTTTCTTCATTTTAGAGG - Intergenic
1089588486 11:119524823-119524845 ATCCACTTTCTTGGAATTAGAGG + Intergenic
1090558890 11:127907594-127907616 ATATATTATCTTTAATTTACTGG + Intergenic
1090864626 11:130688297-130688319 ATCTACTCTCTTTATTTGAAAGG - Intronic
1092560474 12:9608048-9608070 ATCTACTTTCCTTAATTAACTGG + Intergenic
1092609289 12:10154571-10154593 ATCTAAGTTGTTTAATTTATTGG - Intergenic
1092615142 12:10210185-10210207 ACTTAGTTTCTTTAATTTTGTGG - Intergenic
1093556685 12:20484212-20484234 AACTACTTTGTTTAACTCAGAGG - Intronic
1093622375 12:21307244-21307266 ATCAACTTTCTTTGATTTTTAGG + Intronic
1094047242 12:26180526-26180548 ATCGAATTTCTTAAATGTAGTGG - Intronic
1094317876 12:29151810-29151832 TTCTACTTTCTTTATTTTCAAGG + Intronic
1094359186 12:29611625-29611647 ATGAACTTTCTTTATTTTTGTGG + Intronic
1095542241 12:43323964-43323986 ATCTCTTTTTTTAAATTTAGTGG + Intergenic
1095553957 12:43477512-43477534 ATCTAGTTTCTTTATGTTAAGGG - Intronic
1095642071 12:44496577-44496599 ATATACTTTCTTTAATCCATAGG - Intergenic
1095756538 12:45773615-45773637 ATCTAAGTTATTTAATTTATTGG - Intronic
1096421446 12:51461874-51461896 ATCAGCTTTCTTTGATTGAGAGG + Intronic
1096425675 12:51500658-51500680 AATTATTTTCTTTAAATTAGTGG + Intronic
1096597634 12:52706837-52706859 TACTATTTTCTTTATTTTAGAGG - Intergenic
1097471124 12:59993489-59993511 ATCAAATTTGTTTAATTTGGGGG - Intergenic
1097947352 12:65385584-65385606 AGCTATTTTATTTAATTTTGTGG - Intronic
1098810014 12:75075727-75075749 GTATAGTTTCTTTTATTTAGAGG - Intronic
1099264191 12:80423839-80423861 ATCTACTTCCTGCATTTTAGAGG + Intronic
1101235127 12:102780927-102780949 CTCTACTTTCTTTTTTTTGGGGG - Intergenic
1101313317 12:103604616-103604638 ATCTACATTCTCAAATTTATTGG + Intronic
1101546187 12:105715321-105715343 AAATACTTTCCTCAATTTAGAGG - Intergenic
1103126463 12:118427108-118427130 CTCTAATTTCTTTATTCTAGTGG + Intergenic
1103448193 12:121008637-121008659 CTCTACTTTCTCCAATTGAGGGG + Intronic
1103614662 12:122144582-122144604 CTCTATTTTCTTTTATTTAGAGG - Exonic
1104325179 12:127789101-127789123 ATCTCCTTTGTTTAATTCATTGG + Intergenic
1104341259 12:127951434-127951456 AGCTAATTTATTTATTTTAGAGG - Intergenic
1106017215 13:25881112-25881134 ATTTACTTTCTTTTGTTTGGGGG + Intronic
1106554166 13:30795982-30796004 ATCTTATTTATTTATTTTAGGGG - Intergenic
1106879877 13:34117438-34117460 CTCTTCTTTCTTTATTTTTGAGG + Intergenic
1107864468 13:44690291-44690313 GTCTTCTTTCTTTGATTGAGTGG - Intergenic
1108312030 13:49203157-49203179 ATTTACTTTCTCTATTTTGGGGG - Exonic
1109162064 13:58987878-58987900 ATCTGCTTTCCTTCATTTAGTGG - Intergenic
1109933515 13:69247765-69247787 ATGTTCTTTCTTTTATTTATGGG + Intergenic
1110379137 13:74829655-74829677 CTTTACTTCTTTTAATTTAGGGG - Intergenic
1110696191 13:78493586-78493608 ATTTAACTTTTTTAATTTAGAGG + Intergenic
1111532218 13:89552692-89552714 ATCTAATTTTTTTAATTGAGAGG - Intergenic
1111737428 13:92159905-92159927 ATGTTCTTTTTTTAATTGAGAGG + Intronic
1112068374 13:95819091-95819113 ATCTACTTTGTGTGATTTTGGGG - Intronic
1112137658 13:96600270-96600292 ATCTCTTTTCTTAAATTTAGTGG + Intronic
1113102886 13:106739156-106739178 CTCTGCTTTCTTTGCTTTAGTGG - Intergenic
1115141713 14:30179185-30179207 ATTTTCTTTCTTTATTTTACTGG - Intronic
1115454529 14:33586716-33586738 ACCTACTTTATTTTATTTACTGG - Intronic
1115737968 14:36355401-36355423 ATCTTCTTTCTTATATGTAGGGG + Intergenic
1115871080 14:37803281-37803303 ATCCACTTTCTTTATTTCTGTGG + Intronic
1115875993 14:37862852-37862874 ATCTACTTTCTTTAAAATGTAGG + Intronic
1116249979 14:42469183-42469205 ACCTACCTTCTTAAATTTTGAGG - Intergenic
1116987467 14:51236677-51236699 GTCTTCTTTCTTTTATTTATTGG - Intergenic
1117688437 14:58279799-58279821 ATCTACTTTGTTTTAATTACTGG - Intronic
1117820934 14:59648353-59648375 CTCTTCTTTCTTTATTTTAATGG - Intronic
1118866806 14:69710836-69710858 ATTTACTTTCTTTAAATTAGGGG + Intronic
1119564628 14:75618101-75618123 TTCTCCTTGCTTTAAATTAGAGG - Intronic
1120455869 14:84729915-84729937 ATCTACTTTATTAATTTTAATGG + Intergenic
1120596793 14:86449764-86449786 ATCTACCTTGTTTGTTTTAGGGG + Intergenic
1121179165 14:91915375-91915397 ATATAATTTCTTAAAGTTAGGGG - Intronic
1122063486 14:99155232-99155254 CTCAAATTTCTTTAATTTTGAGG - Intergenic
1124917393 15:33989395-33989417 ACCTCCTTGCTTTAATCTAGGGG - Intronic
1125239630 15:37558729-37558751 ATCTGCATTCTTTAATTTTGGGG - Intergenic
1125826567 15:42681596-42681618 ACCTACTTTCTTTAATCTGCTGG - Exonic
1126832843 15:52626589-52626611 ATATATTTTCATTAATTTACAGG + Intronic
1126995400 15:54437501-54437523 ATCTAGTTTGTTTATTTTTGAGG + Intronic
1128024436 15:64423004-64423026 AGGTACTTTATTTAATTTGGTGG + Intronic
1129916718 15:79280701-79280723 ATCTACCTTTTTTAATGTATTGG - Intergenic
1131445076 15:92492024-92492046 ACCTAGTTTCTTTATTTTATTGG + Intronic
1131500306 15:92957164-92957186 ATCTATATTCATTAATTTGGAGG + Intronic
1131773674 15:95769902-95769924 TTCTACTTTCTTATATTTTGTGG + Intergenic
1132183081 15:99776830-99776852 ATCTACTTTTTTTTTTTTTGAGG - Intergenic
1135215168 16:20559985-20560007 ACTTACTTTTTTTAATTTTGTGG + Intronic
1137737774 16:50737689-50737711 ATCCACTTTCTTTATTAAAGGGG + Intergenic
1140708683 16:77656132-77656154 ATCTGCTTTCTTTGATCTATTGG - Intergenic
1142824051 17:2496570-2496592 TTCTACTTTATTTGATTTAGGGG + Intronic
1143347468 17:6260547-6260569 AACTTCCTTCTTCAATTTAGGGG + Intergenic
1145213393 17:21033250-21033272 ATCTACTTGAATTAATTTATAGG - Intronic
1145283845 17:21488981-21489003 AACTATTTTTTGTAATTTAGAGG - Intergenic
1145393600 17:22476515-22476537 AACTATTTTTTGTAATTTAGAGG + Intergenic
1147173654 17:38637121-38637143 ATCTTTTTTCTTTTAATTAGAGG - Intergenic
1147779412 17:42929561-42929583 ATCAACTTTTTTTTATTTTGAGG + Intergenic
1147787398 17:42989211-42989233 ATTTACTTTCACAAATTTAGAGG + Intronic
1149256271 17:54830677-54830699 ATCTCCTTTAATTAATTTAATGG - Intergenic
1149282854 17:55127828-55127850 ATAAACTTTTTTTAATTTAAAGG + Intronic
1150194706 17:63285213-63285235 ATTTACTTTTTTTTAATTAGGGG + Intronic
1150486466 17:65547113-65547135 AAAAACTTTCTTTTATTTAGAGG - Intronic
1150749702 17:67849120-67849142 ATCCATTTTCTTTAAAGTAGTGG + Intronic
1152320496 17:79606359-79606381 ATCCACCATCTTTAATTTAGGGG - Intergenic
1153488712 18:5628290-5628312 TTCTACTTTCATTCATTTAGTGG + Intronic
1153567837 18:6437429-6437451 ATCTAGTGTATTTATTTTAGTGG + Intergenic
1154080928 18:11255868-11255890 ATTTCCTTTCTTTGATTTTGTGG - Intergenic
1155195980 18:23475040-23475062 CTTTACTTCTTTTAATTTAGGGG - Exonic
1155482129 18:26300506-26300528 GTTTCCTTTCTTTAATTTATTGG + Intronic
1155744227 18:29331598-29331620 ATTTACTTTGTGGAATTTAGGGG - Intergenic
1155780280 18:29823523-29823545 ATCTACTTTATTTATTCTATGGG - Intergenic
1155859152 18:30874808-30874830 ATTTATTTTCTCTAATTGAGTGG + Intergenic
1156674828 18:39514851-39514873 ATCCACTTTATTTAATATGGGGG + Intergenic
1156807686 18:41206037-41206059 AACTTCTTTATTTATTTTAGAGG - Intergenic
1157894856 18:51456303-51456325 AAATACTTAATTTAATTTAGTGG - Intergenic
1158026637 18:52905773-52905795 ATCTACTTTGTTTATTTTACAGG + Intronic
1158026706 18:52906829-52906851 ATCTACTTTGTTTATTTTACAGG + Intronic
1159367711 18:67491065-67491087 TTTACCTTTCTTTAATTTAGAGG + Intergenic
1159510113 18:69387006-69387028 ATCCACTTTCTTTATTCTAGAGG - Intergenic
1159593008 18:70355153-70355175 TTCCACTTTCTGTCATTTAGTGG - Intergenic
1159725944 18:71959198-71959220 ATATATGTTTTTTAATTTAGTGG - Intergenic
1162232278 19:9277391-9277413 CCCTATTTTCTTTATTTTAGAGG + Intergenic
1163024509 19:14502645-14502667 TTCTACTTTCTTCAACTTTGGGG + Intergenic
1164661824 19:29980139-29980161 CTCTATTTTCTTGATTTTAGAGG + Intronic
1164702493 19:30295806-30295828 ATGTTCATTCTTTAATTGAGGGG + Intronic
925010593 2:482611-482633 ATCTATTTTGTTTATTTTAGAGG + Intergenic
925255313 2:2480559-2480581 GTATACTTTCTTTAAATTATTGG + Intergenic
925956736 2:8973593-8973615 AGCTAATTTCTTTAATCTATCGG + Intronic
926200632 2:10794098-10794120 ATCTGCTTTCTTCAGTTTAAAGG + Intronic
926506541 2:13722465-13722487 ATCTACTTTACTTAATTAAATGG + Intergenic
926817363 2:16813294-16813316 ATTTACTTTCTTACAGTTAGAGG + Intergenic
927686102 2:25171817-25171839 ATCTAAATTCTTTAATTTATTGG + Intergenic
928512370 2:32013502-32013524 ATGAATTTTCCTTAATTTAGGGG - Intronic
928712300 2:34020733-34020755 ATCAACTTTCTATAATTCTGTGG - Intergenic
929329763 2:40667600-40667622 ATCTACTACTTTTAATTTAGAGG + Intergenic
929629079 2:43440270-43440292 ATCTATTTTCTTCCATTTAATGG + Intronic
930448367 2:51503087-51503109 ATATACTTTTTTTACATTAGTGG + Intergenic
931521980 2:63107914-63107936 ATATATATTCTTAAATTTAGAGG + Intergenic
932079688 2:68701362-68701384 ATCTATTTTATTTTATTTATTGG - Intronic
932503811 2:72209381-72209403 ATCTTCTTTCTTAAATTTTCAGG + Intronic
933012200 2:77080572-77080594 ATCTACTTTATCTAAATTAATGG + Intronic
933696389 2:85221790-85221812 TTTTACTTTATTTTATTTAGGGG - Intronic
935608139 2:104991280-104991302 ATCTGCTTTCTTAAATTTGTAGG + Intergenic
935875440 2:107501501-107501523 AACAACTTTCTTTCATTTATAGG + Intergenic
936793580 2:116181138-116181160 ATCTATTTGGTTTAATTTATAGG + Intergenic
937535755 2:122884807-122884829 ATTTACTTTCTTTAGCTTTGTGG + Intergenic
937785472 2:125889787-125889809 ATCTCCTTGGTTTAATGTAGAGG - Intergenic
938095777 2:128462157-128462179 ATCTACTTTGTCAAATTAAGTGG - Intergenic
939266331 2:139878387-139878409 TTCTACTTACTTTATTTTATAGG - Intergenic
939347531 2:140986090-140986112 GTTTATTTTCTTCAATTTAGTGG + Intronic
940660173 2:156535508-156535530 ATCTGCTTGCTTTAATTTCTTGG + Intronic
940827711 2:158432474-158432496 ATCTACATTGTTGAATTTTGTGG - Intronic
942125432 2:172820179-172820201 ATCTACTTTCCTGAATACAGTGG - Intronic
942179207 2:173363969-173363991 ATCTAATTTCTTTATTTGTGTGG + Intronic
942428786 2:175887250-175887272 ATCTATTTTTTTTAATTCTGTGG + Intergenic
942496466 2:176545326-176545348 ATATCCTTTCTTTAATTAAATGG + Intergenic
943590504 2:189790625-189790647 ACCTACTTTCTATGGTTTAGCGG + Intronic
944997409 2:205309497-205309519 ATCTATTTTATTTAAACTAGGGG + Intronic
945674272 2:212836677-212836699 ATTTACTTACTTTTTTTTAGTGG + Intergenic
945688418 2:213001962-213001984 TTTTACTTACTTTAATTTACTGG - Intronic
947232953 2:227906873-227906895 TTTTTCTTTCTTTAATGTAGTGG + Intronic
947284755 2:228501612-228501634 ATCTACTTTTATTCATTTAGGGG - Intergenic
948774047 2:240271688-240271710 ATTTAATTTCTTTAATATATAGG + Intergenic
1169952439 20:11060320-11060342 ATCCTCTGCCTTTAATTTAGGGG - Intergenic
1170260092 20:14395355-14395377 ATCTAATTTGTCAAATTTAGGGG + Intronic
1170416019 20:16143277-16143299 ATCTTCCTTCTTAAATTTGGGGG - Intergenic
1170898990 20:20441809-20441831 TTTTTCTTTTTTTAATTTAGAGG + Intronic
1175042037 20:56061981-56062003 ATCTAATTTGTTAAATTTAATGG - Intergenic
1175713298 20:61238631-61238653 ATTTACTTTTTTCTATTTAGTGG - Intergenic
1177652219 21:23972146-23972168 TTCTACATTTTTTAATTTATTGG + Intergenic
1177944801 21:27454742-27454764 ATATACTTTCTTTTATTCACTGG - Intergenic
1178313257 21:31547450-31547472 AGCTAATTGCTTTAATTTTGAGG - Intronic
1181503768 22:23337030-23337052 ATCTAAGTTCTTGAATTTACTGG + Intergenic
1181654395 22:24283860-24283882 ATCTAGGTTCTTGAATTTACTGG + Intronic
1181708764 22:24667250-24667272 ATCTAAGTTCTTGAATTTACTGG + Intergenic
1181837501 22:25622891-25622913 ACATAGTTTCTGTAATTTAGGGG + Intronic
1182590877 22:31378633-31378655 AGCTATTTTTTTTATTTTAGTGG - Intergenic
1182652421 22:31862907-31862929 TTTTACTTTCTTTTTTTTAGAGG + Intronic
1182932267 22:34186354-34186376 CTTTTCTTTCTTTAATTGAGTGG - Intergenic
1183695049 22:39416944-39416966 ATCTACTTTCTTGACATTACTGG + Intronic
1183810914 22:40256492-40256514 TTCTACGTTTTTTAATTTATTGG + Intronic
949838940 3:8299686-8299708 ATTTAGTTTCTTTAATTTTGGGG + Intergenic
949974726 3:9445643-9445665 GTCTACTTCCTTTAAGATAGAGG - Exonic
951075791 3:18390708-18390730 ATCTTCATTCTTTATTTTACTGG + Intronic
951490062 3:23260503-23260525 ATCTAATTTCTATAATTTAATGG + Intronic
951509068 3:23480908-23480930 AACTGCCTTCTTTGATTTAGGGG + Intronic
951982684 3:28582923-28582945 ATCAACTTGCTTCAATTTACAGG - Intergenic
952439683 3:33313165-33313187 ATCTAACTTCTTAAATTTATTGG - Intronic
953836297 3:46348525-46348547 ATCTAGGTTATTTAATTTATTGG + Intergenic
954058915 3:48053054-48053076 ATCTACATTCATTCATTAAGTGG + Intronic
955572194 3:60319852-60319874 ATCATCTTTCTTTAATTTCATGG + Intronic
955771806 3:62392114-62392136 ATCATCTTTCTCTAATTTACTGG + Intergenic
957678560 3:83403445-83403467 ATCTACTTACTTTAAATTACAGG + Intergenic
958147613 3:89646683-89646705 ATATACTTTCTTTAATATTTTGG - Intergenic
958831230 3:99092372-99092394 ATCTAATTTATTTAATCAAGAGG - Intergenic
959176317 3:102916216-102916238 ATCTAATTTTGTTAATTTTGTGG + Intergenic
959956787 3:112248692-112248714 ATCTGCTTTCTTCATTTTTGTGG - Intronic
960411119 3:117325962-117325984 TTCTACTTACTTTCATTTTGTGG + Intergenic
960644225 3:119860844-119860866 ATGTACTTTATTTTATTTGGGGG + Intronic
960774000 3:121228066-121228088 AACTACTTTCTTTAATAGAATGG + Intronic
960813384 3:121647789-121647811 ATCTGCTTTCTATCAATTAGAGG + Intronic
962366050 3:134783075-134783097 AACAACTTAATTTAATTTAGTGG - Intronic
962460072 3:135603377-135603399 ATATGCTTTCTTTAATTAATTGG + Intergenic
962511877 3:136109793-136109815 ATCTGCTTTCCTTCTTTTAGTGG - Intronic
962648613 3:137465262-137465284 ATCTCCTTTATATAATTTTGGGG + Intergenic
962912667 3:139868393-139868415 ATCTACTTTCTGTCATTCTGTGG - Intergenic
963558187 3:146823945-146823967 ATCTAATCTCTCTAACTTAGTGG - Intergenic
963580273 3:147117410-147117432 ATGTAATTTATTTAAATTAGGGG + Intergenic
964029762 3:152123980-152124002 ATTTTCTTTCTTTAATTTTTTGG - Intergenic
964831031 3:160884794-160884816 ATCTGTTTTATTTTATTTAGTGG - Intronic
965043156 3:163536737-163536759 ATCTACTTTCATTTTTTGAGAGG + Intergenic
965272232 3:166632555-166632577 ATCTACATACCTTAATTTGGGGG + Intergenic
965353412 3:167644090-167644112 CTCTACTGTCTTTATTTTACAGG - Intronic
966262015 3:177989778-177989800 TACTACTTTCTTTAATTTATGGG + Intergenic
966311512 3:178599580-178599602 ATTTACTTTCTTTAAAAAAGTGG + Intronic
967389619 3:188942815-188942837 ATCTACTCTCCTGAATTTAGTGG + Intergenic
967542084 3:190679778-190679800 AGTTACTTTTTTTAATTTTGGGG - Intergenic
968192718 3:196682147-196682169 CCCTCCTTTCTTTAATTTACAGG - Intronic
969213407 4:5705442-5705464 ATTTACTCTCTTTAAATTAAAGG + Intronic
970473328 4:16398186-16398208 ATCTGCATTCTTTAATATGGTGG + Intergenic
970615906 4:17767890-17767912 ATTTGCATGCTTTAATTTAGGGG + Intronic
971652924 4:29302990-29303012 ATATACTTACATTAATTAAGAGG + Intergenic
972130007 4:35820902-35820924 AACTAATTTCTTTATTTTAAAGG - Intergenic
972446728 4:39151406-39151428 ATTTACTAACTTTAATTTATTGG + Intergenic
974698167 4:65401483-65401505 ATGTATTTTCTTGAATTTCGGGG - Intronic
974735980 4:65932983-65933005 ATCTCTTTTCCCTAATTTAGTGG - Intergenic
975405127 4:73980452-73980474 ATCTACGTTCTTTAGCTTATGGG - Intergenic
975733975 4:77364100-77364122 ATCTCCTTAGTTTAATATAGGGG - Intronic
975820799 4:78268432-78268454 ATTTATTTTCTTTATGTTAGAGG + Intronic
976664325 4:87573629-87573651 ATCTTTTTTATTTAATTTATTGG - Intergenic
976846905 4:89499284-89499306 CTTTACTTTCTTCATTTTAGGGG + Intergenic
976862209 4:89678887-89678909 ATGTACTTTCTTTAGTATAATGG - Intergenic
978011628 4:103692559-103692581 ACCAACTTTCTGTAATTAAGAGG + Intronic
978556504 4:109986557-109986579 TTTAACTTTCTTTAATTTATCGG + Intronic
978634498 4:110788208-110788230 ATCAAGTTTCTATAATTTTGTGG - Intergenic
978726445 4:111975312-111975334 TTCAATTTTCTTTAATTTATTGG + Intergenic
979893362 4:126129090-126129112 ATGTACTTTCTTGAATCTAAAGG - Intergenic
980178831 4:129379874-129379896 AAGTACTTTCTTTAAATTTGGGG - Intergenic
981490377 4:145333138-145333160 ATCTATTTTCTATAATGTTGAGG - Intergenic
981838839 4:149087478-149087500 ATGTTCTTTCTTTTATTTTGGGG + Intergenic
981871906 4:149497093-149497115 CTCTCCTTTCTTTAATGTATGGG + Intergenic
981954808 4:150457076-150457098 AAATAGTTTTTTTAATTTAGAGG - Intronic
983353733 4:166629286-166629308 ATGTACTTTCTTCACTTAAGAGG - Intergenic
983743288 4:171162478-171162500 GTCGAATTTCTTTACTTTAGAGG - Intergenic
984050600 4:174860261-174860283 ATCTACTTTGTTTAATTACCAGG + Intronic
986471234 5:8078155-8078177 ATCTACTTTGTTGAATATAAGGG - Intergenic
987047978 5:14125207-14125229 ATGGTCTTTCTTTAATTTAGTGG - Intergenic
987803196 5:22725192-22725214 ACCTGTTCTCTTTAATTTAGTGG + Intronic
988015329 5:25549995-25550017 AACTACTTGTTATAATTTAGGGG - Intergenic
988374785 5:30422232-30422254 ATCTACATTATTAAATTTAGGGG + Intergenic
988437889 5:31196707-31196729 CTGTACTTCCTCTAATTTAGGGG + Intronic
989002110 5:36772207-36772229 ATCCTCTTTCTTCATTTTAGAGG - Intergenic
990122248 5:52469731-52469753 ATCTACATACTTTAATTTCATGG - Intergenic
990142140 5:52717985-52718007 ATCTAGGTTATTAAATTTAGGGG + Intergenic
992047955 5:72915960-72915982 ATATATTTTTTTTAATTGAGAGG + Exonic
992857108 5:80873094-80873116 ATCTCCTTTCTTTATTTCACAGG + Exonic
992961855 5:81963798-81963820 ATATACATTTTTTAATTTAAGGG - Intergenic
993237943 5:85339068-85339090 ATCTTTTTTCTTCAATGTAGAGG + Intergenic
993664276 5:90675853-90675875 ATCTACTTTATCTAATTAATTGG + Intronic
994104587 5:95932570-95932592 ATATAGTTTCATTATTTTAGAGG - Intronic
994887531 5:105583341-105583363 TTCTATTTTCTTTTATTTTGAGG - Intergenic
996652825 5:125901737-125901759 AACTAGTTTATTTAATTAAGTGG + Intergenic
996707951 5:126515803-126515825 CTCTATTCTCTTAAATTTAGTGG - Intergenic
997104087 5:130998322-130998344 ATATACTATTTTTAATTTGGGGG + Intergenic
997908022 5:137839748-137839770 TTCTACTTTATTTTATTTACTGG + Intergenic
998493182 5:142564725-142564747 AACTACATTTTTTAGTTTAGGGG - Intergenic
998993066 5:147840036-147840058 ATCTGATCTCTTTAATTTAGAGG - Intergenic
1000302183 5:159966114-159966136 GTTTTCTTTCTTTAATTGAGTGG - Intronic
1000736544 5:164909059-164909081 TTCTACTTTATTTAATTTAAAGG + Intergenic
1000755974 5:165160376-165160398 ATCTACTTACTTTACTGTGGAGG - Intergenic
1000800185 5:165716027-165716049 AGCAACTTTCTATAAATTAGTGG - Intergenic
1000913138 5:167046345-167046367 ATCTACTTGCTTTGATTAAATGG + Intergenic
1001027862 5:168239208-168239230 ATCAAATTTCTTTAATTATGAGG - Intronic
1002288803 5:178184301-178184323 ATCTACTTGGTTTAACTTAAAGG - Intergenic
1002352289 5:178591524-178591546 ATCTCCTTCCCTTAATTCAGAGG + Intergenic
1002977791 6:2101559-2101581 ATATACTTTCTCTCATTTCGTGG - Intronic
1003576235 6:7298022-7298044 ATGAACTGTCTTTAATTCAGAGG + Intronic
1003683385 6:8277806-8277828 TTCTATTTCCTTTATTTTAGTGG + Intergenic
1003739334 6:8917598-8917620 ATCTAATTTCTGTAATATCGAGG - Intergenic
1003826381 6:9957269-9957291 TTCCAATTTCTTTAATTTAGAGG - Intronic
1004137447 6:12981417-12981439 GTCTACTTCATTTAATTTAAAGG - Intronic
1004187975 6:13438036-13438058 ATTTCATTTATTTAATTTAGTGG + Intronic
1004708168 6:18143802-18143824 ATATATTTTCTTTAATTTAGAGG + Intronic
1007328858 6:41087872-41087894 ATCTTCTTTCTTTTTTTTAATGG - Intronic
1008287053 6:49666582-49666604 ATCTAAATTCTACAATTTAGAGG + Intergenic
1008828532 6:55729728-55729750 TTCTTCTTTCTTTTATTTTGTGG + Intergenic
1009711865 6:67333169-67333191 ACATACTTTATTTAAGTTAGTGG + Intergenic
1009758039 6:67966142-67966164 GTATAATTTCCTTAATTTAGGGG - Intergenic
1009991232 6:70845466-70845488 TTCTATTTTCCTTAATTCAGAGG + Intronic
1010170788 6:72972757-72972779 TTTTACTCTTTTTAATTTAGTGG - Intronic
1012795359 6:103753004-103753026 ATCTCTTTTCTTTAATTCACTGG + Intergenic
1014086972 6:117357659-117357681 AACTACTTACTATAATATAGTGG + Intronic
1014370918 6:120606618-120606640 CTCTTCTTTCTTTAATATACAGG - Intergenic
1014853704 6:126373176-126373198 ATCTAATTTCTTTAGGTTACTGG - Intergenic
1015297473 6:131614069-131614091 ATCAACTTTCATTGAATTAGAGG - Intronic
1016551837 6:145289835-145289857 ATCTCTTTTCTTTAACTTATTGG - Intergenic
1017069027 6:150556482-150556504 AACTACTTTCTGTAAGTTAAAGG - Intergenic
1017141403 6:151193441-151193463 TTCTGCTTTCTCTAATTTAATGG - Intergenic
1017635589 6:156439928-156439950 ATTTACTTTCTTTATTTGAAAGG - Intergenic
1017932192 6:158966582-158966604 ATCTAAGTTATTTAATTTGGTGG + Intergenic
1020481401 7:8666566-8666588 TTCCAATTTCTTTAATTTATTGG + Intronic
1021802542 7:24321788-24321810 ATCCATTTACTGTAATTTAGTGG - Intergenic
1022228274 7:28386214-28386236 TTCAAATTTCTTTAATTGAGTGG + Intronic
1023678305 7:42654582-42654604 ATCTATTTTATTTAAATTAAAGG - Intergenic
1023685672 7:42732552-42732574 ATCTATATTTTTTCATTTAGAGG + Intergenic
1023997106 7:45166584-45166606 ATATATTTTCTTTCATTCAGTGG + Intronic
1024456988 7:49619801-49619823 ATCTAATTTATCTAATTTAATGG - Intergenic
1027559794 7:79714494-79714516 ATCTAGTTTCTTTAAGTTTTTGG + Intergenic
1027724959 7:81792592-81792614 AGTTACTTTCTTAAATTCAGAGG + Intergenic
1028619946 7:92814307-92814329 TTCCACATTCCTTAATTTAGAGG - Intronic
1028952903 7:96656670-96656692 ATCTACATTTATTAATTTAGTGG + Intronic
1028974452 7:96896278-96896300 ATGTATTTTCTTTCTTTTAGTGG + Intergenic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1030669854 7:112324418-112324440 GTCAACTTGCTTTAATTTATGGG - Intronic
1030781348 7:113604062-113604084 ATCTACCTTCTTTATTTTAAAGG - Intergenic
1031223470 7:119003349-119003371 ATCTAAGTTATTTAATTTATTGG + Intergenic
1031276196 7:119726700-119726722 ATGTACATTGTTTAATTTAGGGG + Intergenic
1031885068 7:127237922-127237944 ATCAATTTGCTTTAATTTAAAGG + Intronic
1032741053 7:134739674-134739696 ATCTAATTTCTTCTATTTAGTGG - Intergenic
1033077557 7:138263796-138263818 AAATATTTTCTTTAATTTTGTGG + Intergenic
1033606357 7:142930876-142930898 ATCTACTGTCTTTAACCAAGGGG + Intronic
1037255950 8:16953835-16953857 ATCTGTTTACTTTAATTTTGTGG - Intergenic
1038353170 8:26799773-26799795 ATTTAGTTTGTTTAATTTACTGG - Intronic
1039208448 8:35183961-35183983 ACATACTTCATTTAATTTAGGGG + Intergenic
1039931404 8:41993734-41993756 ATCAGTTTTCTTTAATTTATTGG + Intronic
1040480667 8:47823315-47823337 ATATACTTTTATTTATTTAGAGG - Intronic
1041252172 8:55945320-55945342 ATCTATTTTATGTGATTTAGAGG - Intronic
1041931291 8:63289776-63289798 GTGTACTTTCTTTTGTTTAGTGG + Intergenic
1043184776 8:77133661-77133683 ATTTTCTTTCTTTAATTAAATGG - Intergenic
1043656105 8:82668374-82668396 ATAAAATTTGTTTAATTTAGGGG - Intergenic
1044285465 8:90407176-90407198 TTTTAGTATCTTTAATTTAGAGG + Intergenic
1044285467 8:90407261-90407283 TTTTAGTATCTTTAATTTAGAGG + Intergenic
1045141629 8:99291491-99291513 TTCTATTTACTTTAATTTATTGG + Intronic
1045913650 8:107440380-107440402 ATCCAATTTCTTTAGTTTATAGG + Intronic
1046198299 8:110891073-110891095 AGCTAATTTCTTTAATTTCTAGG + Intergenic
1048095973 8:131294705-131294727 ATGTACTTTCTTGAATTTGATGG - Intergenic
1050074613 9:1850438-1850460 ATCTGCTTTCTCTAATAAAGAGG - Intergenic
1050133232 9:2434675-2434697 ATCTATTTTCTTTGGTTTTGTGG + Intergenic
1050489025 9:6167555-6167577 ATATATTTTCTTTAATTTTTTGG - Intergenic
1051268186 9:15329227-15329249 GTCTTTTTTTTTTAATTTAGGGG - Intergenic
1051396083 9:16622565-16622587 ATACACTTTCTTGGATTTAGTGG - Intronic
1052276156 9:26678968-26678990 ATCTCCTTTCTTTGACTTATTGG + Intergenic
1052546201 9:29883430-29883452 AAATACTTTCTTTCATTTTGTGG - Intergenic
1053034331 9:34810896-34810918 ATCTCCTATCTTTCCTTTAGAGG - Intergenic
1053050861 9:34959159-34959181 ATCTCCTATCTTTGCTTTAGAGG - Intronic
1053087248 9:35236177-35236199 ATCTACCCTCTTAAATTTTGAGG + Intronic
1053814157 9:41888074-41888096 ATCTAATTTCTGTCATTTTGGGG - Intergenic
1054616439 9:67299366-67299388 ATCTAATTTCTGTCATTTTGGGG + Intergenic
1055833915 9:80416919-80416941 ATGTACATTCTTTTGTTTAGGGG + Intergenic
1057737168 9:97673915-97673937 ATCTATTTTCTGTAACATAGTGG + Intergenic
1058048873 9:100386698-100386720 ATCCATTTTCTTTCATGTAGTGG - Intergenic
1058303598 9:103408092-103408114 ATCTACCTACTTTAATTTCTAGG - Intergenic
1058664600 9:107299301-107299323 AACTACTTTCATTACTTTAAAGG - Intronic
1059138061 9:111826255-111826277 GTCTTCTTACTGTAATTTAGAGG - Intergenic
1059453347 9:114384596-114384618 ATCTACTTACTTTCATTAAGTGG - Intronic
1060645210 9:125272826-125272848 GTTTACATTCTTTAATTTTGAGG + Intronic
1185928934 X:4180044-4180066 TTCTACTTTATTTATTTTTGGGG + Intergenic
1186159235 X:6759356-6759378 ATCTACTTTCTATAAATTCATGG - Intergenic
1186945115 X:14557624-14557646 ACCTTCTTTTTATAATTTAGTGG + Intronic
1188185413 X:27108459-27108481 ATCTACTTTTTTTAAAGTTGGGG + Intergenic
1188233592 X:27698180-27698202 ATAAACTTTCTTTAATATTGAGG + Intronic
1188871534 X:35379379-35379401 ATCTCTTTTCTTTGATTTAGTGG + Intergenic
1189108602 X:38263341-38263363 ATGTACTTTGTTTAAAATAGAGG + Intronic
1190338929 X:49280961-49280983 AGCTAAGTTCTTTCATTTAGAGG - Intronic
1190481242 X:50879001-50879023 TTCTACTTTCAGTAATATAGGGG + Intergenic
1191179768 X:57548465-57548487 TTCTATTTTGTTTCATTTAGAGG - Intergenic
1191582891 X:62784937-62784959 ATCTTCTTTCTATATTTTATTGG + Intergenic
1191636042 X:63378176-63378198 ATTTTCTTTCTTTAATTTTTGGG - Intergenic
1192303652 X:69934165-69934187 CTCTACTATCTGGAATTTAGAGG - Intronic
1194380653 X:93187159-93187181 ATCTACATTTTTGAATTTATTGG + Intergenic
1194726792 X:97408370-97408392 ATCTTCTTTTTTTAATTTAAAGG + Intronic
1194893710 X:99412996-99413018 ATCTCCTTTTTTTAATTTATTGG + Intergenic
1195077279 X:101339049-101339071 TTCTACTTTCTTGGCTTTAGTGG - Intergenic
1195590084 X:106614556-106614578 ATTTAATTTTTTTAATTTTGTGG + Intronic
1196529109 X:116762431-116762453 ATCTATTTCTTTTAATTGAGGGG - Intergenic
1197173014 X:123455408-123455430 AACTATTTCCTTTACTTTAGGGG + Intronic
1197456778 X:126686122-126686144 ATATACATTCTTTCATTTTGTGG + Intergenic
1199150295 X:144424706-144424728 ATCTATTTTCTTTCAGTTACTGG + Intergenic
1199228969 X:145412498-145412520 TACAACTTTCTTTACTTTAGGGG - Intergenic
1199908181 X:152257117-152257139 AGCTCATTTCTTTCATTTAGTGG - Intronic
1200530255 Y:4326187-4326209 AACTTCTTACTTTAATTTAAAGG + Intergenic
1201055159 Y:9981230-9981252 GTCTACTCTCTCTAAATTAGTGG - Intergenic
1201436611 Y:13965475-13965497 ATTTACTTTTCTTTATTTAGGGG - Intergenic
1202191228 Y:22248201-22248223 GTCTACTCTCTCTAACTTAGTGG + Intergenic