ID: 907211830

View in Genome Browser
Species Human (GRCh38)
Location 1:52830334-52830356
Sequence ATGTCCTGGTAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907211827_907211830 2 Left 907211827 1:52830309-52830331 CCATGGAAAAAGGACCTAACAAA 0: 39
1: 40
2: 27
3: 29
4: 254
Right 907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG No data
907211825_907211830 18 Left 907211825 1:52830293-52830315 CCTCTTTTATTCTAAACCATGGA 0: 17
1: 21
2: 24
3: 47
4: 248
Right 907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907211830 Original CRISPR ATGTCCTGGTAGAAGAGTGA AGG Intergenic
No off target data available for this crispr