ID: 907214908

View in Genome Browser
Species Human (GRCh38)
Location 1:52854478-52854500
Sequence GCAGATGTTGACCAAAGTGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907214908_907214913 30 Left 907214908 1:52854478-52854500 CCTACACTTTGGTCAACATCTGC 0: 1
1: 0
2: 2
3: 12
4: 154
Right 907214913 1:52854531-52854553 TTGTGTTCTGAAAGACCTGATGG 0: 1
1: 0
2: 3
3: 17
4: 245
907214908_907214910 2 Left 907214908 1:52854478-52854500 CCTACACTTTGGTCAACATCTGC 0: 1
1: 0
2: 2
3: 12
4: 154
Right 907214910 1:52854503-52854525 GAATGTCCTGATTGCTAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907214908 Original CRISPR GCAGATGTTGACCAAAGTGT AGG (reversed) Exonic
900890652 1:5447450-5447472 GCAGATGGTAACCAGAGAGTGGG - Intergenic
907214908 1:52854478-52854500 GCAGATGTTGACCAAAGTGTAGG - Exonic
916858301 1:168774768-168774790 GCAGAGGATGAGAAAAGTGTGGG - Intergenic
919069572 1:192736692-192736714 GCTGATGTTGAAGAAAGTGATGG - Intergenic
919101522 1:193102931-193102953 ACAGCTGTTGACTAAAGCGTGGG - Intronic
921127762 1:212193180-212193202 GGAGATGTTGGCCAAAGGGTAGG - Intergenic
921271357 1:213473297-213473319 GCAGATTTTGCACAAAGTGCTGG - Intergenic
923507060 1:234613003-234613025 GCAGATGCTGGGCCAAGTGTCGG + Intergenic
924419416 1:243893998-243894020 GGAGATGTTGGTCAAAGGGTAGG + Intergenic
1063514404 10:6680695-6680717 GCACGTGTTGACCAACGTATGGG - Intergenic
1065704113 10:28455716-28455738 GCAAATATTGACCAAACTGAAGG - Intergenic
1066335240 10:34470137-34470159 GCTGTTGTTGACCAGCGTGTGGG + Exonic
1067511671 10:46900396-46900418 ACAGAAATTGACCAAAGTTTGGG + Intergenic
1067650575 10:48151429-48151451 ACAGAAATTGACCAAAGTTTGGG - Intergenic
1068957161 10:62828447-62828469 GCATAGGATGACCAAAGGGTGGG - Intronic
1073769763 10:106723262-106723284 GAAAACGTTGACCAAACTGTTGG - Intronic
1076491097 10:130862162-130862184 GCAGATGGTGTCCCCAGTGTGGG - Intergenic
1083484806 11:62976689-62976711 GGAAATGGTGACCCAAGTGTGGG - Exonic
1087767597 11:102173092-102173114 GGAGAGGATGACCAAAGTGGTGG + Intronic
1090621348 11:128563760-128563782 GCAGATGGTGACAAAACTGTTGG - Intronic
1091314144 11:134598838-134598860 GGAGATATTGACAAATGTGTGGG - Intergenic
1091704203 12:2682698-2682720 GCTGAGGCTGACCCAAGTGTGGG + Intronic
1095221787 12:39624779-39624801 GGAGAGGTTGACCAAGTTGTTGG - Intergenic
1095938351 12:47709373-47709395 GCAGAGGTTGACCACACTGGGGG - Intergenic
1097496008 12:60335622-60335644 GAAGATGTTGATCAAAGTGGAGG + Intergenic
1099738109 12:86596791-86596813 GCATATTTTGACCAAAATGGGGG + Intronic
1099918631 12:88928441-88928463 GCAAATGTTGACCAAGATATAGG - Intergenic
1100095109 12:91024343-91024365 GAAGATGTGGAAGAAAGTGTGGG + Intergenic
1101240866 12:102838441-102838463 GCAGATGTTGACTAAAGGCTTGG - Exonic
1104064460 12:125295670-125295692 ACAGATGTTGCCCAAAGCGTAGG + Intronic
1107326896 13:39253867-39253889 GCAGCTGTTGACCAAGGCTTTGG + Intergenic
1107726119 13:43301077-43301099 GCAAATGATGAAGAAAGTGTTGG + Intronic
1111451372 13:88422551-88422573 GCATATCTTTTCCAAAGTGTAGG - Intergenic
1111902521 13:94217269-94217291 GCTCATGTTTACAAAAGTGTTGG - Intronic
1112372415 13:98805341-98805363 GCAGTTGTTGATCCAAGTGGTGG - Intronic
1112799713 13:103097012-103097034 GCGGATGGAGATCAAAGTGTGGG - Intergenic
1112808878 13:103194254-103194276 CCAGATGTTGACCCACCTGTGGG + Intergenic
1113427810 13:110223966-110223988 CCAAAAGTTAACCAAAGTGTTGG - Intronic
1114052797 14:18935776-18935798 TTAGATCTTGACCAAAGTTTTGG - Intergenic
1114109761 14:19466150-19466172 TTAGATCTTGACCAAAGTTTTGG + Intergenic
1114994233 14:28327970-28327992 GCAGATGTTTATCAATGTCTGGG + Intergenic
1118540178 14:66814366-66814388 GCAGGTGTTCACCATAGTGGTGG - Intronic
1120623188 14:86791462-86791484 GATGGTGTTGACCAAAATGTTGG + Intergenic
1125455624 15:39856108-39856130 CCAGATGTTGACCAGAGAGGTGG - Intronic
1126514371 15:49519032-49519054 GGAGAAGTTGGCCAAAGTGAAGG + Intronic
1128448687 15:67787798-67787820 TCACATGTTGACCTAACTGTAGG + Intronic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1132508739 16:325909-325931 GCAGATGCTGACCACAGAGAGGG + Intronic
1137843122 16:51659240-51659262 GTAAATGTTGACTAAAATGTTGG + Intergenic
1137884773 16:52091074-52091096 GCAACTGTTTTCCAAAGTGTCGG - Intergenic
1138546782 16:57724410-57724432 GCAGATGTTCATCATGGTGTTGG + Intronic
1139818381 16:69696828-69696850 ACAGCTGTTGGCCAAAGTGAAGG + Exonic
1141117695 16:81324528-81324550 GGAGATGGTGAGCAAAGGGTGGG + Intronic
1141491785 16:84378785-84378807 GCAGAGATTGAGCAAAGTGCAGG + Intronic
1143125355 17:4638387-4638409 GCAGTTGTTGAGCAAGTTGTGGG + Intronic
1143403149 17:6658722-6658744 GCAGTTGTTGAGCAAGTTGTGGG - Intergenic
1145042286 17:19585781-19585803 TCAGATGGTGACCTAAGTCTGGG - Intergenic
1150847475 17:68674423-68674445 TCGGATGTTGACCAAAATCTGGG - Intergenic
1153463811 18:5366575-5366597 GCAGATGTTTACCAAAGCTTTGG + Intergenic
1156575798 18:38313698-38313720 CCAGATATTGAGCACAGTGTGGG + Intergenic
1157759645 18:50251642-50251664 GCAGATGTTCTCCAAACTCTGGG - Exonic
1157794995 18:50565204-50565226 GCAGATGTTAACAGAAGTATAGG - Intronic
1158602773 18:58869110-58869132 GCCATTGTTGACCAAAATGTTGG + Intronic
1159336567 18:67075795-67075817 GCTGATGTTTACAAAACTGTAGG - Intergenic
1159446462 18:68546325-68546347 GCAGATGTTTATCAATGTCTAGG - Intergenic
1159738029 18:72128118-72128140 ACACATGTTGACTAAAGTTTTGG + Intergenic
1159760572 18:72420430-72420452 GAAGAAGTTGACCAAAATGAAGG - Intergenic
1163955843 19:20638784-20638806 GCAAATATTGACAAAAGTGAAGG + Intronic
1164410223 19:27996395-27996417 TCAGATCTTGACCAAATTTTGGG - Intergenic
1165250641 19:34531118-34531140 GGAGATATTGACAAAAGTATAGG - Intergenic
1167000076 19:46740653-46740675 GCAGGTATTGACCAAGGTGTAGG - Intronic
924994345 2:343200-343222 GGAGCTATTGTCCAAAGTGTTGG + Intergenic
927414259 2:22860948-22860970 GCAGTTGGTGTCCAAAGTGAGGG - Intergenic
929228260 2:39533014-39533036 GCAGATATTAAACCAAGTGTGGG + Intergenic
929976421 2:46639741-46639763 GTAGACATTGGCCAAAGTGTGGG + Intergenic
930730864 2:54725906-54725928 GCAGATGTTGGTCATTGTGTGGG - Intronic
930905779 2:56565454-56565476 GCAGATATTGAACTAAGTTTAGG - Intergenic
933301160 2:80542964-80542986 GCAGATGTTAACCAATGTTATGG - Intronic
933827359 2:86174825-86174847 GGAGAAGTTGACCAAATTATGGG - Intronic
934116317 2:88798923-88798945 GCAGATGCTCCCCAAATTGTGGG + Intergenic
934219495 2:90069141-90069163 GCACATGAAGACCAGAGTGTGGG - Intergenic
934806718 2:97235369-97235391 GCAGATGCTCCCCAAATTGTGGG + Intronic
939869624 2:147512380-147512402 GCAGATGCAGACAAAAGTATTGG - Intergenic
943569082 2:189551242-189551264 TCTGATGTTGACAAAGGTGTAGG + Intergenic
943722083 2:191215628-191215650 GCAGATATTGCCCAAAGTGTTGG - Intergenic
945570173 2:211457582-211457604 GCAGTTGTTGACTCAAGTGAAGG - Intronic
948673133 2:239581440-239581462 GCAGATGATTCCCACAGTGTGGG - Intronic
1170402502 20:16003529-16003551 GCAGGTGTAGCCCAAAGTGAGGG + Intronic
1171178240 20:23071170-23071192 ACACATCTTGACCAAAGTGATGG + Intergenic
1173763155 20:45582431-45582453 AGAGATGTTGAACAGAGTGTGGG - Intergenic
1175768541 20:61607938-61607960 TCAGGTGTAGACCCAAGTGTTGG - Intronic
1176687691 21:9865884-9865906 GCAGGTGTTCACCACAGTATTGG + Intergenic
1177285521 21:19043465-19043487 TCACATGTTGACCAAAGCATCGG + Intergenic
1180471271 22:15658151-15658173 TTAGATCTTGACCAAAGTTTTGG - Intergenic
1181544721 22:23595644-23595666 GCAGATGGTGTGCAAAGTTTTGG + Intergenic
951450634 3:22834035-22834057 GCACATGGAGACCAAAGTCTTGG + Intergenic
954608507 3:51931911-51931933 GCAGATTTTGGCCAAAGTGGAGG + Intergenic
954700969 3:52450793-52450815 ACAGTGGTTGACCAAAGTGATGG + Intergenic
956087512 3:65628218-65628240 GCCAATGTTGGCCTAAGTGTGGG - Intronic
958172314 3:89953553-89953575 GCAGAGGTTTACCAAAGTTACGG + Intergenic
959090597 3:101898855-101898877 GCAGATGTTAACTACAGGGTTGG - Intergenic
962410194 3:135134593-135134615 CCAGCTGGTGACCACAGTGTTGG + Intronic
962948894 3:140199762-140199784 TCTGATGTTCTCCAAAGTGTGGG + Intronic
969319734 4:6404483-6404505 GCAAATGTTCAACCAAGTGTAGG - Intronic
970168683 4:13266601-13266623 GGAGATGTTGGCCAAAGTGTAGG - Intergenic
975511103 4:75194331-75194353 GCAGATGTTCACAGAAGTGGTGG - Intergenic
977178041 4:93839285-93839307 AGAGATGTTGAACAAAATGTTGG - Intergenic
978275876 4:106949085-106949107 GCAGATGTTGAAATATGTGTTGG - Intronic
979346772 4:119596575-119596597 GCAGAAGTTGACCAAATTACAGG - Exonic
980351046 4:131683700-131683722 GCAGGTGTTCACCACAGTATTGG + Intergenic
985854644 5:2415551-2415573 GCAGATGTTTCCCAAGGTTTAGG - Intergenic
986004325 5:3655580-3655602 GGAGATGTTGGTCAAAGGGTTGG - Intergenic
986102126 5:4622716-4622738 GGAGATTTAGACCAAACTGTTGG + Intergenic
987392256 5:17387164-17387186 GCCGAGGGTCACCAAAGTGTGGG - Intergenic
989205711 5:38807180-38807202 GGAGATGATGACCAGAGGGTTGG - Intergenic
994364679 5:98899648-98899670 GCAGATGGTGACCCAAATGCAGG - Exonic
996878992 5:128272100-128272122 GCAGATGTTGATGAATGTGATGG - Exonic
997699182 5:135884498-135884520 GCAGATGCTGACCTAGGTGGTGG + Intronic
998866319 5:146506678-146506700 GTAGATGGTCACCAAAGTCTAGG - Intronic
999778475 5:154829908-154829930 GCAGCTGTTGTCCCAAGTGAGGG + Intronic
1001114194 5:168925148-168925170 ACAGATGCTTACCAAATTGTTGG - Intronic
1003375707 6:5575250-5575272 GCTGATGTTGAACAAGGTGATGG - Intronic
1007830459 6:44634443-44634465 GCAGATGGGGACTAAAGTGGGGG + Intergenic
1011741616 6:90366466-90366488 GGAAATGTGGACCAAAATGTAGG - Intergenic
1013044556 6:106471365-106471387 GCACATGTACACCAATGTGTGGG + Intergenic
1013318428 6:108963567-108963589 GCAGACGCTGAGCAAAGGGTTGG - Intronic
1014408664 6:121086009-121086031 GCAAAAGTACACCAAAGTGTAGG + Intronic
1016645259 6:146399645-146399667 GAAGATGTTGAGGAAAGTGTTGG - Exonic
1020547631 7:9553919-9553941 GAATATGTTGACAAAAGTGGAGG - Intergenic
1020795069 7:12668997-12669019 GAAAATGTTGGCCAAAGAGTTGG - Intergenic
1022210757 7:28206702-28206724 GCAGAGGTTGGACAAAATGTTGG - Intergenic
1022994923 7:35745532-35745554 TGAGATGTTCACCAAAGTGGAGG - Intergenic
1026527074 7:71163293-71163315 GGAGATGTTGTCCAGAGAGTTGG + Intronic
1030809221 7:113955249-113955271 GCAGGTGTTCACCACAGTGGTGG + Intronic
1031537984 7:122958730-122958752 ACACATGTAGACCAAAGGGTGGG - Intergenic
1031888955 7:127272217-127272239 TCTGTTGTTGACCAAAATGTTGG + Intergenic
1033009955 7:137610582-137610604 ATAGATGTTTAACAAAGTGTTGG + Intronic
1034086446 7:148326928-148326950 GCAGATGTGGGCCACAGTTTTGG + Intronic
1035005666 7:155658099-155658121 GCAAATGTTGACAAAAATGAAGG - Intronic
1035692671 8:1570553-1570575 TCACATGTTCACCACAGTGTAGG + Intronic
1036464002 8:8979244-8979266 GGGGATGTTGACAAAGGTGTGGG - Intergenic
1038871760 8:31503107-31503129 GCAGATGTTGTTCAATGTCTGGG + Intergenic
1041247113 8:55899022-55899044 CCATATATTGCCCAAAGTGTTGG + Intronic
1041344857 8:56886657-56886679 GCAGATGTTGAGGAAAGGATGGG + Intergenic
1042226662 8:66519860-66519882 GCAAATGCTGACCAACGTTTTGG + Intergenic
1043663403 8:82776155-82776177 GCAGATGTTCAACAAATGGTAGG - Intergenic
1043811047 8:84741219-84741241 GAAGATGATGACCACAGTGTTGG + Intronic
1044793566 8:95872713-95872735 GCAGCTGTTCACCACAGTGGTGG - Intergenic
1045146278 8:99347850-99347872 GCAGATGTGAACTACAGTGTGGG - Intronic
1046088325 8:109466815-109466837 GAAGATGATGACAAAAGTTTAGG - Intronic
1047109165 8:121769375-121769397 GTTCATGTTGACCAAAATGTTGG - Intergenic
1048835461 8:138514667-138514689 GCAGATGTTCACCTCAGGGTGGG + Intergenic
1049014484 8:139909997-139910019 GGAGATGTGGACCAAAGGCTTGG - Intronic
1051852656 9:21527791-21527813 GCAGGTGTTCACCACAGTGGTGG + Intergenic
1054169613 9:61826169-61826191 GCAGGTGTTCACCACAGTATTGG - Intergenic
1054667925 9:67754646-67754668 GCAGGTGTTCACCACAGTATTGG + Intergenic
1056235411 9:84588983-84589005 GCAGATGATGAATAAACTGTAGG + Intergenic
1056749892 9:89341097-89341119 GGAGATATAGACAAAAGTGTAGG + Intronic
1057164442 9:92914820-92914842 GCAGTTGTTGAGCAAGTTGTGGG - Intergenic
1060069509 9:120533953-120533975 GCTGATGGTGACCAAAGTGGAGG - Intronic
1060870942 9:127039712-127039734 GCAGATGTAGACCCATTTGTAGG + Intronic
1062246767 9:135572754-135572776 GCAGATGTTGGCTAAAGATTAGG - Intergenic
1203774518 EBV:65323-65345 GCAGATGTTGGCCAGATTGCAGG - Intergenic
1185639463 X:1578932-1578954 GCAGCTGATGACCAAAGTAAAGG - Intergenic
1188911253 X:35850500-35850522 GCAGATGTTGATGAAAGTGATGG + Intergenic
1189699017 X:43696913-43696935 CCATTTGTTGTCCAAAGTGTAGG - Intronic
1197149987 X:123209563-123209585 GCAAATCTTGATCAAAGTTTAGG - Intronic
1200670889 Y:6089359-6089381 GCAGATGTTGATGAGAATGTGGG - Intergenic
1200869191 Y:8078722-8078744 GCAAATGTTGTCCAAAGCTTTGG - Intergenic