ID: 907222084

View in Genome Browser
Species Human (GRCh38)
Location 1:52914506-52914528
Sequence CAGGATAAGCTGAGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907222077_907222084 9 Left 907222077 1:52914474-52914496 CCAGAACTGGAGGAGTTCAGGCA No data
Right 907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG No data
907222075_907222084 13 Left 907222075 1:52914470-52914492 CCTTCCAGAACTGGAGGAGTTCA 0: 1
1: 0
2: 2
3: 18
4: 139
Right 907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907222084 Original CRISPR CAGGATAAGCTGAGGCAGGA GGG Intronic
No off target data available for this crispr