ID: 907222131

View in Genome Browser
Species Human (GRCh38)
Location 1:52914847-52914869
Sequence GTGGGTGATCCGAGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907222131 Original CRISPR GTGGGTGATCCGAGGGATGC AGG (reversed) Intronic
900885083 1:5409424-5409446 GTGGGTGACGGGAGGCATGCAGG + Intergenic
904301123 1:29555598-29555620 CTGGGTAATCCGAGGCTTGCTGG + Intergenic
905868454 1:41389178-41389200 GTGGGTGTTCCCAGGGAGGGGGG + Intergenic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
906806362 1:48782667-48782689 GTGGGTGATAGGAGGTATGAAGG - Intronic
907222131 1:52914847-52914869 GTGGGTGATCCGAGGGATGCAGG - Intronic
909482128 1:76137441-76137463 GCAGGTGATCCAAGGGATGGTGG + Intronic
909923801 1:81414536-81414558 GTGGGTGGTGCAAGGGAGGCTGG + Intronic
924265121 1:242273897-242273919 CTGGGAGAGCCGAGGAATGCTGG + Intronic
1062963654 10:1591934-1591956 GTGGGTGAGGTGAAGGATGCCGG - Intronic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1065331094 10:24600623-24600645 GTGGGTGTTCAAAGGAATGCTGG - Intronic
1069618657 10:69822612-69822634 GTGGGTGGACTGATGGATGCGGG - Intronic
1069872877 10:71543797-71543819 GTGGAGGATCCCAGGGCTGCTGG + Intronic
1072318865 10:94229400-94229422 GTGGGTGATCCAAGAGAGGGAGG + Intronic
1073462870 10:103676642-103676664 GTGGGTGGACAGAGGGGTGCTGG + Intronic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1076131665 10:128017934-128017956 GTGTGTGATGCGAAGCATGCAGG - Intronic
1076696790 10:132251050-132251072 GGGGGTGACCCCAGGGATGGTGG - Intronic
1077187777 11:1243158-1243180 GTGGGTGGTCCCCGGGATGGAGG - Exonic
1077188198 11:1244829-1244851 GTGGGTGGTCCCCGGGATGGAGG - Exonic
1077188733 11:1246929-1246951 GTGGGTGGTCCCCGGGATGGAGG - Exonic
1077189722 11:1250799-1250821 GTGGGTGGTCCCCGGGATGGAGG - Exonic
1077853608 11:6099782-6099804 GTGGGAGATCAGAGGGCAGCAGG - Intergenic
1077991415 11:7415433-7415455 GTGGGAGATTGGAGGTATGCAGG + Intronic
1081962811 11:47150785-47150807 GTGGGGGAGTCGAGGGAGGCAGG + Intronic
1082838148 11:57666993-57667015 TTGGGTGAGGTGAGGGATGCGGG + Intergenic
1083436382 11:62646381-62646403 GTGGTAGATCCGAGCGACGCTGG - Intronic
1084284046 11:68120631-68120653 CTGGGTAATCCAAGGGAAGCGGG - Intronic
1084596383 11:70119268-70119290 GTGGGTGAGTGGATGGATGCTGG + Intronic
1084596472 11:70119693-70119715 GTGGGTGAATAGATGGATGCCGG + Intronic
1084900642 11:72307612-72307634 GTGGGTATTGAGAGGGATGCAGG - Intronic
1090359201 11:126160937-126160959 GCGGGTGAGATGAGGGATGCTGG - Intergenic
1090522602 11:127495347-127495369 GTGGGTGCTATGAGGGTTGCTGG + Intergenic
1092204197 12:6605966-6605988 GTGGGTCCTCGGAGGAATGCAGG - Intronic
1092605103 12:10110097-10110119 GTGTTTCATCCCAGGGATGCAGG + Intronic
1094537880 12:31337964-31337986 GTGGGTGTGCAGAGCGATGCTGG - Intergenic
1100559749 12:95736283-95736305 GTGGTTGATCAGAGCCATGCAGG + Intronic
1104986765 12:132601570-132601592 GTGGGTGAGCTGAGGTTTGCAGG - Intergenic
1110512910 13:76374098-76374120 TTGGGTGATCGGACGGATGAGGG + Intergenic
1113850030 13:113412776-113412798 GTGGGTGAACCGAGTTCTGCGGG - Intergenic
1113850038 13:113412811-113412833 GTGGGTGAACCGAGTTCTGCGGG - Intergenic
1113850046 13:113412846-113412868 GTGGGTGAACCGAGCTCTGCGGG - Intergenic
1113850054 13:113412881-113412903 GTGGGTGAACCGAGCTCTGCGGG - Intergenic
1113850062 13:113412916-113412938 GTGGGTGAACCGAGTTCTGCGGG - Intergenic
1113850070 13:113412951-113412973 GTGGGTGAACCGAGCTCTGCGGG - Intergenic
1113850078 13:113412986-113413008 GTGGGTGAACCGAGCTCTGCGGG - Intergenic
1113850086 13:113413021-113413043 GTGGGTGAACCGAGCTCTGCGGG - Intergenic
1113850094 13:113413056-113413078 GTGGGTGAACCGAGCTCTGCGGG - Intergenic
1113850102 13:113413091-113413113 GTGGGTGAACCGAGCTCTGCGGG - Intergenic
1116717752 14:48449133-48449155 GTGGGTGGTACCAGGGATGCCGG + Intergenic
1123736932 15:23194696-23194718 GAGGGTGATACTAGGGGTGCTGG + Intergenic
1124287630 15:28417673-28417695 GAGGGTGATACTAGGGGTGCTGG + Intergenic
1124288151 15:28423374-28423396 GAGGGTGATACTAGGGGTGCTGG + Intergenic
1124295073 15:28493953-28493975 GAGGGTGATACTAGGGGTGCTGG - Intergenic
1125263683 15:37855029-37855051 GTGGGTGGTCCAAAGGATGGGGG - Intergenic
1125269403 15:37921639-37921661 GTGGCTGCTGTGAGGGATGCGGG + Intergenic
1126670860 15:51113864-51113886 GTGGCTGATCTGAGGGAGGCTGG - Intergenic
1128079003 15:64845235-64845257 ATGAGTGATCCAAGGGAGGCAGG + Intronic
1129894511 15:79093429-79093451 GTGGGTGGTCCCTGGGTTGCAGG + Intergenic
1132660365 16:1058329-1058351 GTGGGGGGTCCCAGGGAGGCCGG + Intergenic
1134861888 16:17567609-17567631 GGGGGGGATGGGAGGGATGCAGG + Intergenic
1136015885 16:27400851-27400873 GTGGTTGATTTGAGGGATCCTGG - Intergenic
1137585212 16:49660154-49660176 GTGGGGGCTCCCAGGGATCCAGG - Intronic
1138280750 16:55770761-55770783 GTGAGTGATGCGAGGGTTGTGGG + Intergenic
1139646521 16:68335187-68335209 GTGGGTGATCAGTGGGTTGTAGG + Intronic
1141750743 16:85956319-85956341 GTGGGGGATGCAAGGGATGGGGG - Intergenic
1142516751 17:435967-435989 GTGGTTCATCCCAGGAATGCAGG - Intergenic
1143374337 17:6458438-6458460 GTGGGTCATCCCAGTGATGGTGG - Intronic
1143862951 17:9904684-9904706 GTGGGTGGAGCGGGGGATGCGGG - Intronic
1145064656 17:19753912-19753934 GTGTTAGATCCCAGGGATGCTGG + Intergenic
1148251941 17:46089479-46089501 GTGGGAGATTGGAGGGATGGTGG - Intronic
1148776620 17:50099293-50099315 CTGGGAGAGCTGAGGGATGCAGG + Intronic
1151358196 17:73572490-73572512 CTGGGTGATAAGAGGGAGGCTGG - Intronic
1151495174 17:74454346-74454368 GTGGGTGACGCCAGGGAAGCAGG + Intergenic
1152336118 17:79701055-79701077 GTGGGGGAGAGGAGGGATGCAGG + Intergenic
1155418624 18:25629180-25629202 GTGGGAGATCCCAGTGATGGTGG - Intergenic
1155908709 18:31484206-31484228 ATGTGTGATTGGAGGGATGCTGG - Intergenic
1160341592 18:78094054-78094076 GTGAGTGATAAGAGTGATGCAGG + Intergenic
1160687110 19:442247-442269 GTGGGTGAACGGATGGATGATGG + Intronic
1163235412 19:16026939-16026961 GTGGATGATAGGATGGATGCTGG + Intergenic
1165429964 19:35766952-35766974 GTTGGTGAGCCGAGGGAGGGAGG + Exonic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1166824240 19:45599331-45599353 GTGAGTGAGCCCAGGGGTGCTGG - Intronic
926148062 2:10408852-10408874 GTGGGTGATACCAGGGACCCTGG - Intronic
935918265 2:107982737-107982759 GAGGGTGATCCTAGGTATGGAGG - Intergenic
937098513 2:119250990-119251012 GTGGGTGGTCGGAGGGAGGCAGG + Intronic
938407369 2:131039965-131039987 GGCGTTGCTCCGAGGGATGCGGG + Intronic
941925007 2:170885741-170885763 GTGGGTGACCCGAGGGATGGGGG - Intergenic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
943528219 2:189045816-189045838 GTGGGTGCTCCAGGAGATGCAGG - Exonic
945768089 2:214004709-214004731 CTGGGTCATCCTAGGGATGCAGG + Intronic
946037348 2:216754707-216754729 GTGGGTGGGCAGAGGGATGTAGG + Intergenic
946427880 2:219609036-219609058 GGCGGTGATCAGAGGGATGAGGG - Intronic
1171314392 20:24176245-24176267 GTGGTTGATCTGAAGGGTGCAGG + Intergenic
1172773744 20:37395820-37395842 GCGGGTGCTCCCAGGGCTGCTGG - Intronic
1173656385 20:44703011-44703033 GTGGTTGATCTGTGGGTTGCTGG + Intergenic
1174132272 20:48354131-48354153 GTGGGTGCTCAGAGAGATGGTGG + Intergenic
1175817876 20:61893069-61893091 ATGGGTGAGTAGAGGGATGCTGG + Intronic
1175817896 20:61893148-61893170 GTGGGTGAATAGAGGGATGGTGG + Intronic
1181317893 22:21982711-21982733 GTGGGTGAGCGGCGGGCTGCGGG - Exonic
1182777670 22:32842893-32842915 GTGGGTGATCAAAGGGATGTGGG + Intronic
1183064473 22:35353586-35353608 GTGGGTGAACTGAGGAATGGGGG + Intergenic
1184810794 22:46830384-46830406 CTGGGAGATCTGAGGGCTGCTGG - Intronic
1185041285 22:48505733-48505755 GAGGGTGGTCTCAGGGATGCTGG - Intronic
1185296923 22:50058929-50058951 CGGGGTGATCCGCGGGGTGCGGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952027040 3:29095716-29095738 GGGGTTCATCCCAGGGATGCAGG - Intergenic
954744593 3:52779944-52779966 GTGGCTGAGTTGAGGGATGCAGG + Intronic
955961006 3:64341471-64341493 GTGGGTGGTCCCAGGCATGCAGG - Intronic
956821951 3:72961981-72962003 GTGTGTGATACTAGGGAGGCAGG + Intronic
970710357 4:18854990-18855012 GTGGTTGAGTCCAGGGATGCTGG - Intergenic
975517251 4:75260306-75260328 GTGGCTGCTGTGAGGGATGCAGG - Intergenic
978140636 4:105313696-105313718 GTGGGGGATGCGAAGGATGAGGG - Intergenic
982158228 4:152541248-152541270 GTGGGTGATCGCAGTGATTCAGG + Intergenic
984088371 4:175340095-175340117 GTGGGTGGTCTTAGGGATGATGG + Intergenic
984822427 4:183893471-183893493 CTGGGTGATGCAAGTGATGCTGG + Intronic
985655830 5:1130955-1130977 GAGGGTGGTCTGAGGGCTGCTGG + Intergenic
985750006 5:1668214-1668236 GTGGGTGATCCGGGGGGTTGTGG + Intergenic
987008733 5:13738170-13738192 ATGGGTGATTAAAGGGATGCTGG - Intronic
990281558 5:54256753-54256775 GGGGTTCATCCCAGGGATGCAGG + Intronic
997701037 5:135899617-135899639 GTGGGTGACCCAAGGCCTGCTGG - Intergenic
999246028 5:150155229-150155251 GTGGGTGATGTCAGGGATGGAGG - Intronic
1001080067 5:168661026-168661048 GGGTGTCATCCGAGGGAGGCAGG - Intergenic
1002641125 5:180631069-180631091 GTGGGTGCTCCCAGGGTGGCTGG + Intronic
1002702411 5:181134000-181134022 GTGGCTGATCCGCGTGAAGCTGG - Intergenic
1002904726 6:1438959-1438981 GTGGCTGCTCTGAGGCATGCAGG - Intergenic
1004843224 6:19610934-19610956 GTGGGAGCTCCGAGGGATCCTGG - Intergenic
1006101671 6:31689555-31689577 GTGGGGGATGGGAGGGAGGCTGG + Intronic
1006824810 6:36926910-36926932 GTGGGAGAACCCAGGGATGGGGG + Intronic
1013870230 6:114749251-114749273 TTGAGTGATCAAAGGGATGCAGG + Intergenic
1014008376 6:116447832-116447854 GTGGGAGCTCCCAGGGATCCAGG - Intergenic
1018220944 6:161578982-161579004 ATTTGTGATCTGAGGGATGCTGG - Intronic
1018623063 6:165750459-165750481 GTGGGAGATCCTGGGGGTGCTGG - Intronic
1019125698 6:169838941-169838963 GAGGGTGAAACGATGGATGCCGG + Intergenic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1019367849 7:644503-644525 GTGGGCCCTCGGAGGGATGCTGG - Intronic
1019526111 7:1481232-1481254 GTGGGTGATCCGAGGTCGGGTGG - Intronic
1021600317 7:22357324-22357346 GTGGGAGATCCGAGGGGGACAGG - Intergenic
1023983125 7:45081071-45081093 ATGGGGGATCCGAGGGATAGGGG - Intronic
1032322468 7:130897627-130897649 GCGGGTCATCTGAGGGAGGCTGG + Intergenic
1034939107 7:155218882-155218904 ATGGGTGAGCCAAGGAATGCAGG - Intergenic
1038378825 8:27072671-27072693 GTTGGTAATCCAAGGGATACTGG + Intergenic
1040299564 8:46180861-46180883 CTGGGTGAGCCGAGGGACTCAGG - Intergenic
1042561225 8:70072921-70072943 CTGGGTGATCTGTGGGTTGCAGG + Intergenic
1042695282 8:71548142-71548164 GGGGGAGACCCGAGGGGTGCTGG - Intronic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1053616822 9:39775808-39775830 GTGGGTGGTGCCAGTGATGCAGG - Intergenic
1053875003 9:42535144-42535166 GTGGGTGGTGCCAGTGATGCAGG - Intergenic
1054236695 9:62566575-62566597 GTGGGTGGTGCCAGTGATGCAGG + Intergenic
1054267346 9:62931630-62931652 GTGGGTGGTGCCAGTGATGCAGG + Intergenic
1054550832 9:66601083-66601105 GTGGGTGGTGCCAGTGATGCAGG + Intergenic
1057199117 9:93131050-93131072 GTGGGTCAGACAAGGGATGCCGG - Intronic
1060510501 9:124228811-124228833 GTGGGAGATCCAAGGGTTGGGGG - Intergenic
1061242669 9:129383499-129383521 GTGGGGGACCCGATGGATCCTGG + Intergenic
1061885194 9:133587758-133587780 TTGGGTGGTCTGAGGGAGGCGGG + Intergenic
1193015679 X:76730927-76730949 GTGTGTCATACCAGGGATGCAGG + Intergenic
1193530871 X:82652138-82652160 GTGGGAGATGCGTGGGATCCTGG + Intergenic
1196438448 X:115695366-115695388 GTGGGTATTACGAGGGAAGCGGG - Intergenic