ID: 907225623

View in Genome Browser
Species Human (GRCh38)
Location 1:52943520-52943542
Sequence TGTGCTTAAGAACCCACTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907225623_907225625 27 Left 907225623 1:52943520-52943542 CCCATAGTGGGTTCTTAAGCACA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 907225625 1:52943570-52943592 GATGTCTGTTGTTACTCATTTGG 0: 1
1: 0
2: 1
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907225623 Original CRISPR TGTGCTTAAGAACCCACTAT GGG (reversed) Intronic