ID: 907225787

View in Genome Browser
Species Human (GRCh38)
Location 1:52945013-52945035
Sequence TGCATTGCTCTTATAATCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 7, 3: 141, 4: 453}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907225787 Original CRISPR TGCATTGCTCTTATAATCAG TGG (reversed) Intronic
904268413 1:29331687-29331709 ACCATTGCTCTTATAATCATTGG + Intergenic
904637610 1:31895584-31895606 TGCATTTCTCTGATGATTAGTGG - Intergenic
905327557 1:37167603-37167625 TGCATTTCTCTAATGATCAGTGG + Intergenic
905528537 1:38657884-38657906 TGGATTGCTTTTATAATTAGAGG - Intergenic
907174064 1:52501362-52501384 TGCATTTCTCTAATGATTAGTGG - Intronic
907209702 1:52809745-52809767 TGCATTTCTCTGATGATAAGTGG + Intronic
907225787 1:52945013-52945035 TGCATTGCTCTTATAATCAGTGG - Intronic
908306930 1:62828382-62828404 TGCATTTCTCTAATGATCAGTGG + Intronic
908604798 1:65785178-65785200 TGCATTTCTCTGATGATTAGTGG - Intergenic
908996470 1:70162132-70162154 TGTATTACTCTTAAAATGAGAGG + Intronic
909098684 1:71322847-71322869 TGCATTTCTCTAATGACCAGTGG - Intergenic
909329023 1:74390134-74390156 TTCATAGCTCCTATAATCACTGG + Intronic
909421206 1:75468079-75468101 TGCATTCCTCTGATAATCAATGG - Intronic
910024985 1:82639210-82639232 TGCATTTCTCTAATGATCAATGG - Intergenic
910159186 1:84255311-84255333 ACCATTGCCCTTATAATAAGAGG + Intergenic
910403901 1:86865530-86865552 TGCATTTCTCTTAAAATAAATGG - Intronic
910742734 1:90538128-90538150 TGCATTACTCTTGTAAACAGAGG + Intergenic
911319185 1:96391720-96391742 TGCAGTTCTCTGATAATTAGTGG + Intergenic
911691323 1:100838072-100838094 AGCATTTCTCTTATAAACATAGG - Intergenic
911800831 1:102135548-102135570 TGCATTTCTCTAATGATCAGTGG - Intergenic
914999471 1:152575423-152575445 TGAATTTCTCTAATGATCAGTGG - Intronic
915846702 1:159273955-159273977 TGCATTTCTCTGATGATGAGTGG - Intergenic
916252345 1:162751406-162751428 TGCATTTCTCTGATGACCAGTGG - Intronic
916302597 1:163292750-163292772 GGCATTTCTCTAATGATCAGTGG + Intronic
916807556 1:168273473-168273495 TTCATTTCTCTGATCATCAGTGG + Intergenic
917260991 1:173169165-173169187 TGCATTTCTCTGATGATTAGTGG - Intergenic
917382405 1:174427858-174427880 TTCATTGCTGTTATCCTCAGTGG - Intronic
919508882 1:198435385-198435407 TGCATTTCTCTAATGATTAGTGG + Intergenic
919578570 1:199342165-199342187 TGCATTTCTCTAATGACCAGTGG - Intergenic
920103895 1:203536842-203536864 GGTATTGCTCCTATATTCAGGGG + Intergenic
920550134 1:206853492-206853514 TGCATTTCTCTGATGATCAGTGG - Intergenic
923189599 1:231607825-231607847 TGCATTTCTCTAATGATTAGTGG + Intronic
924070082 1:240267920-240267942 TGCATTTCTCTGATGATTAGTGG - Intronic
924737461 1:246770964-246770986 TGCATTTCTCTAATGATCAGTGG + Intergenic
1063699158 10:8367799-8367821 TTCATTTCTCTAATCATCAGTGG - Intergenic
1064912119 10:20414305-20414327 TGCATTTCTCTAATGATGAGTGG - Intergenic
1065275111 10:24077922-24077944 TGCATTTCTCTAATGATCAGTGG + Intronic
1065542337 10:26782780-26782802 TGCATTGCCCTAATGATAAGTGG - Intronic
1065640095 10:27772987-27773009 TGCATTTCTCTGATGATTAGTGG + Intergenic
1065877115 10:30007078-30007100 TGGAATGCACTTATAATCAATGG + Intergenic
1065975435 10:30837705-30837727 TGCATTTCTCTAATGATCAGTGG - Intronic
1066148286 10:32586106-32586128 TGCATTTCTCTAATGACCAGTGG + Intronic
1066257154 10:33691060-33691082 TGCATTTCTCTAATAACCAGTGG + Intergenic
1066422075 10:35273001-35273023 TGCCTTTCTCTAATGATCAGTGG + Intronic
1066735709 10:38476643-38476665 TGCATTTCTCTAATGATCAGTGG + Intergenic
1067665814 10:48277711-48277733 TGCATTTCTCTCATTATCAATGG + Intergenic
1068100963 10:52552438-52552460 TGCATTTCTCTGATGATTAGTGG + Intergenic
1068353338 10:55878829-55878851 TACTTTGCTCTAATAATCTGTGG + Intergenic
1068650044 10:59512609-59512631 TGCTTTGCTCTTTTCATCTGAGG - Intergenic
1072377393 10:94831634-94831656 TACATTTCTCTGATGATCAGTGG + Intronic
1072452503 10:95549892-95549914 TGCATTGGTATTAAAATCAATGG - Intronic
1072919821 10:99567118-99567140 TTCATTTCTTTTATTATCAGTGG + Intergenic
1074732741 10:116395235-116395257 TGCATTGTTCTGATGGTCAGTGG + Intergenic
1074904281 10:117847336-117847358 TGCATTTCTCTAATGACCAGTGG - Intergenic
1075012148 10:118882885-118882907 TGCATTTCTCTGATAATTTGTGG - Intergenic
1076174559 10:128357998-128358020 GGCATTTCTCTAATGATCAGTGG - Intergenic
1077696227 11:4395255-4395277 TGCATTTCTCTGATGATCAGTGG + Intergenic
1079306208 11:19325573-19325595 TGCATTTCTTTAATGATCAGTGG - Intergenic
1079519073 11:21303381-21303403 TGCATTTCTCTGATGATTAGTGG - Intronic
1079709553 11:23664865-23664887 TGCATTTCTCTGATGATTAGTGG + Intergenic
1079920814 11:26432139-26432161 TGTATTACTCTAATGATCAGTGG + Intronic
1080339071 11:31236340-31236362 TTCATTACACTTATAATAAGAGG - Intronic
1080908423 11:36570753-36570775 TGCATTTCTCTGATGATCAGTGG + Intronic
1081830300 11:46105386-46105408 TGCAGTGATCTAATCATCAGGGG - Intronic
1082665567 11:55971525-55971547 TGCATTTCTCTAATGATCACTGG - Intergenic
1082945573 11:58755242-58755264 TGCATTTCTCTGATGACCAGTGG - Intergenic
1083385835 11:62309390-62309412 TGCATTTCTCTGATGATCAGTGG + Intergenic
1084574127 11:69977686-69977708 TGCATTGTCCTTGAAATCAGAGG - Intergenic
1085842352 11:80027028-80027050 TGCCTTACTCTGATGATCAGTGG - Intergenic
1086086688 11:82962589-82962611 TGCATTTCTCTAATGATCAGTGG + Intronic
1086119257 11:83288299-83288321 TGCATTTCTCTAATGATCAGTGG + Intergenic
1086298882 11:85402751-85402773 TGCATTTCTCTAATGACCAGTGG - Intronic
1086570040 11:88272586-88272608 TGCATTTCTCGGATGATCAGTGG - Intergenic
1086931238 11:92695237-92695259 TACTTTACTCTTAGAATCAGAGG + Intronic
1086985675 11:93246578-93246600 TGCATTTCTCTAATGACCAGTGG - Intergenic
1087080521 11:94166897-94166919 TGCACTGGTCTTAGAAGCAGTGG - Intronic
1087288007 11:96287169-96287191 TGTAATGCTCTTATAATAACAGG - Intronic
1087466292 11:98510610-98510632 TGCATTTCTCTGATCATTAGTGG + Intergenic
1087484588 11:98745951-98745973 TGCATTTCTCTAATTACCAGTGG - Intergenic
1087532033 11:99395272-99395294 TGCATTTCTCTAATGATCGGTGG + Intronic
1088010070 11:104989815-104989837 TGCATTTCTCTGATCATCAATGG - Intergenic
1088046926 11:105464209-105464231 TGCGTTTCTCTGATGATCAGTGG - Intergenic
1088070415 11:105777216-105777238 GGTATTGCTCTTAAAATCAGGGG + Intronic
1088545870 11:110958206-110958228 TGCATTTCCCTGATGATCAGTGG - Intergenic
1088708746 11:112487202-112487224 TGAATTCATCTTATAATCATTGG + Intergenic
1090971804 11:131650245-131650267 GGCATTGCTTTTAGAATCACTGG - Intronic
1092102241 12:5894220-5894242 TGCATTTCTCTAATGACCAGTGG + Intronic
1093248241 12:16767306-16767328 TGCATTTCTCTGATGATCAGTGG - Intergenic
1093891255 12:24524579-24524601 TGCATTTCTCTGATGATTAGTGG - Intergenic
1093950365 12:25158850-25158872 TGCATTTCTCTGATGACCAGTGG - Intronic
1094098837 12:26739066-26739088 TGCATTTCTCTAATGACCAGTGG - Intronic
1095319854 12:40813926-40813948 TGCATTTCTCTGAGGATCAGTGG + Intronic
1095913519 12:47453205-47453227 TGCATTACTTTTAGAGTCAGAGG + Intergenic
1096206268 12:49724633-49724655 TGCATTTCCCTGATAATTAGTGG - Intronic
1096357100 12:50950411-50950433 TGCATTCCTATTTTATTCAGTGG - Intergenic
1096929574 12:55191753-55191775 TGCATTTCTCTAGTGATCAGTGG + Intergenic
1097916339 12:65024205-65024227 TGCATTGCATTTATCATTAGAGG + Intergenic
1098201355 12:68059250-68059272 TGCATTTCTCTAATTATCAGTGG + Intergenic
1098633699 12:72755827-72755849 TGCATTTCTCTGATGATCAGTGG - Intergenic
1098937967 12:76502208-76502230 TGCATGGCTCTGAGAATGAGAGG + Intronic
1099070802 12:78043663-78043685 TGCATTTCTCTAATGACCAGTGG + Intronic
1099159192 12:79219091-79219113 TGCATTGCCTTGATAATTAGTGG + Intronic
1099248718 12:80225480-80225502 TGAACTGCTTTTATAATCAAGGG - Intronic
1099258663 12:80347851-80347873 TGCATTTCTCTAATGACCAGTGG + Intronic
1099948513 12:89273105-89273127 TGCATTTCTCTAAAGATCAGTGG + Intergenic
1100365184 12:93913975-93913997 TGCATTTCTCTGATGATTAGTGG - Intergenic
1100619616 12:96258661-96258683 TGCATGGCTTTTATTCTCAGTGG - Intronic
1101057173 12:100929911-100929933 TGCATTTCTCTGATGATCAGTGG + Intronic
1101301189 12:103484393-103484415 TGCATTTCTCTGATGACCAGTGG + Intronic
1101469182 12:104979404-104979426 TGCCTTGTTCTCAAAATCAGAGG + Intergenic
1101672507 12:106889053-106889075 TATATTACTTTTATAATCAGAGG - Intronic
1101790630 12:107923638-107923660 TGCATTTCCCTAATGATCAGTGG - Intergenic
1103179211 12:118893931-118893953 TGCATTTCTCTAATAATCTGTGG - Intergenic
1103315177 12:120048401-120048423 TGCATTGCTGTTAAAATTACAGG + Intronic
1104209992 12:126679439-126679461 TGCATTACACATATACTCAGTGG - Intergenic
1104295431 12:127507598-127507620 TGCATTGCACTTATCCGCAGCGG + Intergenic
1104456481 12:128917731-128917753 TGCATTTCTCTAATGATCAGTGG - Intronic
1105317687 13:19282132-19282154 TGCATTTCTCTGATGACCAGTGG - Intergenic
1105565602 13:21544542-21544564 TGCATTTCCCTGATGATCAGTGG - Intronic
1105819672 13:24068748-24068770 TGCATTTCTCTAATGATCAGTGG + Intronic
1106139090 13:26996032-26996054 TGCATTCTTCTTATGATTAGAGG + Intergenic
1108108322 13:47038094-47038116 TGCATTGCTATTATACAAAGAGG + Intergenic
1108145130 13:47468930-47468952 TGCATTTCTTTAATGATCAGTGG - Intergenic
1108235322 13:48396904-48396926 TGCATTTCTCTAATGACCAGTGG - Intronic
1109016095 13:57016191-57016213 TGCATTTCTCTAATGATTAGCGG - Intergenic
1109145648 13:58776165-58776187 TGCATTTCTCTGATGATTAGTGG - Intergenic
1109388047 13:61658145-61658167 TGCCTTGCTGTAATAATCAGTGG + Intergenic
1109869433 13:68313884-68313906 TCCATTTCTCTTATGATTAGTGG - Intergenic
1110476396 13:75919459-75919481 TGCATTACTCTAATGATCAGTGG - Intergenic
1110691710 13:78437703-78437725 GGCACTGCTGATATAATCAGAGG - Intergenic
1110923866 13:81125669-81125691 TGCATTTCTCTGATGATTAGTGG + Intergenic
1111318680 13:86595093-86595115 TGCATTTGTCTGATGATCAGTGG - Intergenic
1111506544 13:89197023-89197045 TGCATTTCTCTAATGACCAGTGG - Intergenic
1111798215 13:92950516-92950538 TGCATAGCACTCTTAATCAGAGG - Intergenic
1112830675 13:103446329-103446351 TGCATTTCTCTAATAATCAGTGG - Intergenic
1113300486 13:109013697-109013719 TGCATTTCTCTGATGACCAGTGG + Intronic
1114848408 14:26352272-26352294 TGCATTTCTCTGATAATTAATGG + Intergenic
1114931693 14:27477056-27477078 TGCATTTTTCTAATAATTAGTGG + Intergenic
1116376096 14:44202862-44202884 TGCATTTCTCTGATAATTAGCGG + Intergenic
1116393908 14:44425388-44425410 TGCATTTCTCTGATGATCAATGG - Intergenic
1116555076 14:46292427-46292449 TGCATTTCTCTAATGATCAGTGG + Intergenic
1117192965 14:53311787-53311809 TGCATTTCTCTGATCATTAGTGG - Intergenic
1117888122 14:60387029-60387051 TGCATTTCTCTGATGACCAGTGG - Intergenic
1117927710 14:60801589-60801611 TGCATTTCTCTGATGATTAGTGG - Intronic
1118125762 14:62901955-62901977 TGCATTTCTCTGATGATCAGAGG + Intronic
1118332911 14:64827600-64827622 TGCAATGCGATTATGATCAGAGG - Intronic
1118523529 14:66615443-66615465 TGCATTTCTCTGATGGTCAGTGG + Intronic
1118557509 14:67041949-67041971 TGCATTTCTCTAATGACCAGTGG + Intronic
1118591262 14:67403153-67403175 TGCATTTCCCTGATAATCAATGG + Intronic
1118618809 14:67596015-67596037 TACATTGGTCTTAGAATCAAGGG - Intronic
1118679188 14:68221948-68221970 TGCATTTCCCTGATAATTAGTGG - Intronic
1118798260 14:69165239-69165261 TGTATTTCTCTGATGATCAGTGG - Intergenic
1119536611 14:75408134-75408156 TGCATTTCTCTGATGATGAGTGG + Intergenic
1121112335 14:91320950-91320972 CCCATTCCTATTATAATCAGCGG + Intronic
1121833381 14:97071032-97071054 TGCATGCCTCTTAGAAACAGGGG + Intergenic
1122360189 14:101154793-101154815 TGGATTTCTCTTATATTCAATGG + Intergenic
1123802210 15:23833131-23833153 TGCATTTCCCTAATAATTAGTGG + Intergenic
1123968597 15:25483043-25483065 TGCATTTCTCTAATGACCAGTGG - Intergenic
1123990095 15:25676911-25676933 GGCATTCCTGTGATAATCAGAGG - Intergenic
1124189250 15:27558139-27558161 TGCTTTGTTCTAATTATCAGAGG + Intergenic
1125125955 15:36221113-36221135 TGCATTTCTCTAATGACCAGTGG + Intergenic
1125587437 15:40830789-40830811 TGCATTGGTTTTATAATCCTTGG + Intergenic
1126976801 15:54191783-54191805 TGCATTTCTCTAATGACCAGTGG + Intronic
1127090801 15:55465010-55465032 TGCATTTCCCTAATAATTAGCGG - Intronic
1127970322 15:63953851-63953873 TGCATTTCTCTGATGATCAATGG + Intronic
1130190424 15:81730238-81730260 TGAATTACTCTTATATTCTGGGG - Intergenic
1130570475 15:85038748-85038770 TGCATTTCTCTGATGATTAGAGG - Intronic
1131531054 15:93192283-93192305 TGCATTTCTCTGATGATTAGTGG + Intergenic
1135466420 16:22689838-22689860 TGCCTTGTTCTTATCCTCAGAGG + Intergenic
1135799928 16:25483882-25483904 TGCATTTCTCTAATGATTAGTGG + Intergenic
1137625913 16:49908491-49908513 TGCTTTTCTCTTATCACCAGGGG - Intergenic
1138856333 16:60697730-60697752 TCCATTGCATTTATGATCAGAGG + Intergenic
1140157364 16:72445574-72445596 TGCATTTCCCTTATAATTAGTGG + Intergenic
1140974664 16:80047516-80047538 TGCATTTCTCTACTGATCAGAGG - Intergenic
1144231355 17:13207455-13207477 TGCATTTCTCTAATTATTAGTGG + Intergenic
1146613848 17:34335154-34335176 TGCATTTCTCTAATGACCAGAGG + Intergenic
1146834745 17:36101405-36101427 TGCATTTCTCTAATGATTAGTGG + Intergenic
1146849352 17:36208587-36208609 TGCATTTCTCTAATGATTAGTGG + Intronic
1146853736 17:36246681-36246703 TGCATTTCTCTGATGATTAGTGG + Intronic
1146869643 17:36370573-36370595 TGCATTTCTCTGATGATTAGTGG + Intronic
1147072520 17:37971197-37971219 TGCATTTCTCTGATGATTAGTGG + Intergenic
1147084043 17:38050734-38050756 TGCATTTCTCTGATGATTAGTGG + Intronic
1147099990 17:38174701-38174723 TGCATTTCTCTGATGATTAGTGG + Intergenic
1148236376 17:45971913-45971935 TGGAGTGCTCTTAGCATCAGAGG - Exonic
1149162988 17:53717134-53717156 TGCATTGCTCTAATGATTAGTGG + Intergenic
1149230956 17:54533300-54533322 TGCATTTCTCTAATGATCAGTGG + Intergenic
1149280737 17:55102858-55102880 TGCATTTCTCTAATGACCAGTGG + Intronic
1150013526 17:61529575-61529597 TGCATTGTACTTATCATCATGGG + Intergenic
1150082993 17:62257992-62258014 TGCATTTCTCTGATGATTAGTGG + Intergenic
1150317422 17:64181025-64181047 TGCATTGTTTTTATAATCAAGGG - Intronic
1150874031 17:68948477-68948499 TGCATTTCTCTAGTGATCAGTGG + Intronic
1150998806 17:70350372-70350394 TGCATTTCTCTAATGATCAGTGG - Intergenic
1151098113 17:71522527-71522549 TGCATTTCTCTGATGATCAGTGG - Intergenic
1151253645 17:72857717-72857739 TGCATTTCTCTAATGATCAGTGG + Intronic
1153559274 18:6354689-6354711 TACATTTCTCTGATGATCAGTGG - Intronic
1153717372 18:7863931-7863953 TGCATTTCTCTAATGACCAGTGG + Intronic
1153873989 18:9349102-9349124 TTCCTTGCTCATATAATGAGGGG + Intronic
1154479256 18:14801067-14801089 AGCATAGCTCTAATAATCTGTGG - Intronic
1154480046 18:14811954-14811976 AGCATAGCTCTAATAATCTGTGG - Intronic
1154939325 18:21095114-21095136 TGCATTTCTCTGATGATCAGTGG - Intronic
1155049498 18:22134285-22134307 TGCATTACTTACATAATCAGTGG + Intergenic
1155091103 18:22512254-22512276 TGCATTTCTCTAATGATCAGTGG + Intergenic
1155275822 18:24186583-24186605 TGTACTGCTCTTCTAATCAAGGG + Intronic
1155432668 18:25777159-25777181 TGCATTTCCCTAATGATCAGTGG - Intergenic
1155513843 18:26604171-26604193 TGCATTTCTCTAATGATCAGTGG - Intronic
1155722969 18:29041890-29041912 TGCATTTCTCTAATGACCAGTGG + Intergenic
1157066826 18:44359709-44359731 TGCATTTCTCTAATGACCAGTGG + Intergenic
1157469491 18:47977931-47977953 TGCATTGCTTCTCTATTCAGGGG + Intergenic
1158031904 18:52976090-52976112 TCCATTTCTCTAATGATCAGTGG + Intronic
1158078375 18:53559473-53559495 TGCATTTCTCTGATGATTAGTGG - Intergenic
1158298439 18:56025410-56025432 TGAAATGCTCTTATTCTCAGTGG - Intergenic
1158398564 18:57099299-57099321 TGCATTTCTCTAATGATCAGTGG + Intergenic
1158795753 18:60844402-60844424 TGCATTTCTCTTATGATCTGTGG - Intergenic
1160075214 18:75667939-75667961 TGCATTGCACCTAAAAACAGTGG + Intergenic
1161176491 19:2845689-2845711 TGCATTTCTCTGATGATTAGTGG + Intronic
1164135366 19:22410012-22410034 TGTATTTCTCTAATGATCAGTGG - Intronic
1165269630 19:34694609-34694631 TGCATTTCCCTGATAATTAGTGG - Intergenic
1165548708 19:36564505-36564527 TGCATTTCTCTGATGATTAGTGG - Intronic
1168489778 19:56798872-56798894 TGCATTTCTCTAATGATCAGTGG - Intronic
926824990 2:16897410-16897432 TGCATTGCTCATATAATTTGTGG - Intergenic
926836121 2:17022956-17022978 TGCATTTCTCTAATGATTAGTGG + Intergenic
929318042 2:40504720-40504742 TGCATTTCTCTGATGATCAGTGG - Intronic
929528488 2:42728689-42728711 TGCATTTCTCTGATGATCATTGG + Intronic
930235604 2:48886013-48886035 TGCATTCCTCTAATGATCAGTGG - Intergenic
932452287 2:71819293-71819315 TGAATTGCTTTTATAATGTGGGG - Intergenic
933146392 2:78859058-78859080 TGCATTTCTCTAATGATTAGAGG - Intergenic
933421729 2:82055961-82055983 TGCATTTCTCTGATGATTAGTGG - Intergenic
933447575 2:82401737-82401759 TGCATTTCTCTGATAATTAATGG + Intergenic
933521802 2:83383213-83383235 TGCATTTTTCTGATAATTAGTGG - Intergenic
934721939 2:96585384-96585406 TGCATTTCCCTGATAATTAGTGG - Intergenic
935437437 2:103050202-103050224 TGCATTTCTCTGATGATCAGTGG + Intergenic
935481846 2:103599505-103599527 TGCATTTCTCTAATGATTAGTGG - Intergenic
935495495 2:103775955-103775977 GGCATTGATCCTATCATCAGGGG - Intergenic
935601437 2:104926364-104926386 TGCATTTCTCTAATGATCAATGG - Intergenic
935978151 2:108599758-108599780 TGCATTTCTCTGATGATCAGTGG + Intronic
936135768 2:109892354-109892376 TGCATTTCTCTGATGATCAGTGG + Intergenic
936208929 2:110479131-110479153 TGCATTTCTCTGATGATCAGTGG - Intergenic
936824998 2:116571378-116571400 TGCATTTATCTAATGATCAGTGG + Intergenic
937020371 2:118645163-118645185 TGGTTTCCTCTTATATTCAGGGG - Intergenic
937784711 2:125883105-125883127 TAGATTGCTTTTATTATCAGTGG + Intergenic
937846127 2:126581154-126581176 TGCATTTCTCTAATGATCAGTGG - Intergenic
938674977 2:133623559-133623581 TGCATTTCCCTAATAATTAGTGG - Intergenic
939313779 2:140519873-140519895 TGCATTTCTCTGATGACCAGTGG - Intronic
939344476 2:140946110-140946132 TGCATTTCTCTGATTATTAGTGG - Intronic
939404701 2:141741527-141741549 TGCATTTCTCTGATGATCAGTGG + Intronic
939960139 2:148559055-148559077 TGCTTTGCTTTTGTAAACAGAGG - Intergenic
939975669 2:148714644-148714666 TGCATTTCTCTAATGATCAGTGG + Intronic
940555034 2:155214111-155214133 TTTATTGCTTTTATAATCAGAGG + Intergenic
940744413 2:157551659-157551681 TTTATTGCTCTTAAAATCAAAGG + Intronic
940891198 2:159037091-159037113 TGCATTTCTCTGATGACCAGTGG + Intronic
941057877 2:160808784-160808806 TGCGTTTCTCTAATGATCAGTGG + Intergenic
941196087 2:162453694-162453716 TGCATTTCTCTAATGATCAGTGG + Intronic
941296009 2:163738472-163738494 TACATTGTTTTTATATTCAGTGG - Intergenic
942033211 2:171984513-171984535 TACATTTCTCTAATGATCAGTGG + Intronic
942808530 2:179966789-179966811 CGCATTTCTATTATAATCAGAGG + Intronic
942912123 2:181256854-181256876 AGCATTGATCTTAGAATAAGAGG + Intergenic
942945137 2:181664237-181664259 TGCATTTCTCTGATGGTCAGTGG - Intronic
943548449 2:189310327-189310349 TGCGTTTCTCTGATGATCAGTGG - Intergenic
943967615 2:194357394-194357416 TGCATTTATCTGATGATCAGTGG - Intergenic
944614664 2:201448446-201448468 TGCAGTGTTCTTATAATAATAGG - Intronic
945053350 2:205846796-205846818 TGCATAGTTCTTATTAGCAGGGG + Intergenic
945328153 2:208507187-208507209 TGCATTTCTTTAATAATTAGTGG + Intronic
945494232 2:210490540-210490562 TGCATTGCACCTATAAAGAGAGG + Intronic
945973142 2:216250003-216250025 TGCATTTCTCTGATAATCAATGG - Intergenic
946195382 2:218029663-218029685 TGAATGGCACTTGTAATCAGTGG - Intergenic
946515579 2:220407277-220407299 TGCATTTCTCTAATCATTAGTGG + Intergenic
946967339 2:225051097-225051119 TGCATTTCCCTGATAATTAGTGG + Intergenic
947027142 2:225749066-225749088 TGCATTTCTCTAATTATTAGTGG - Intergenic
948077119 2:235173664-235173686 TGCATTTCTCTGATGATGAGTGG + Intergenic
1169161966 20:3388157-3388179 TGCATTTCTCTAATGATTAGAGG - Intronic
1169537304 20:6558989-6559011 TCCTTTTCTCCTATAATCAGTGG - Intergenic
1171057660 20:21923178-21923200 TGCATTTCTGTAATGATCAGTGG + Intergenic
1171095620 20:22329937-22329959 TGCATTTCTCTGATGATTAGAGG + Intergenic
1171130727 20:22650597-22650619 TGCATTTCTCTAATAATTAGTGG + Intergenic
1172611208 20:36253850-36253872 TGCATTTCCCTAATGATCAGTGG - Intronic
1173239140 20:41277981-41278003 TGTATTGCTCTTGTAATCAGGGG - Intronic
1173540915 20:43850271-43850293 TGTATTGCTTGTATAATCTGGGG - Intergenic
1173758688 20:45540680-45540702 TGCATTTCTCTGATGATCACTGG - Exonic
1174840443 20:53896350-53896372 TGTATTATTTTTATAATCAGGGG - Intergenic
1174957843 20:55120286-55120308 TGCATTCCTCTGATGATTAGTGG + Intergenic
1174965154 20:55204881-55204903 TGCATTTCTCTGATGATGAGTGG + Intergenic
1175272050 20:57741057-57741079 TGTATTGCTTTTATAATTGGGGG - Intergenic
1176511753 21:7753868-7753890 TTCCTTGCTCATATAACCAGGGG + Intronic
1176886673 21:14264701-14264723 TGCATTCCTATTATAATAAGGGG - Intergenic
1177143556 21:17383405-17383427 TGCATTTCTCTGATGACCAGTGG - Intergenic
1177956099 21:27601157-27601179 TGTATTTCTCTAATGATCAGTGG + Intergenic
1178160189 21:29903541-29903563 TGCATTTCTCTAATGACCAGTGG - Intronic
1178645866 21:34384395-34384417 TTCCTTGCTCATATAACCAGGGG + Intronic
1178816951 21:35939744-35939766 TCCATGACTTTTATAATCAGGGG + Intronic
1180594334 22:16963586-16963608 TGCCTGGCTCTTATGCTCAGTGG - Intronic
1184988156 22:48149735-48149757 TGCATTTCTCTAATGAGCAGTGG - Intergenic
1184988330 22:48150972-48150994 TGCATTTCTCTAATGAGCAGTGG + Intergenic
949277004 3:2295409-2295431 TGCATTTCTCTGATATCCAGTGG + Intronic
949390656 3:3558665-3558687 TGCATTTCTCTGATGATCAGTGG + Intergenic
949675260 3:6446162-6446184 TGCATTGCTCTTGTCCTCAAAGG - Intergenic
949917293 3:8975012-8975034 TTCATTGCCCTTATCATCATTGG - Intergenic
950944576 3:16931615-16931637 TGCATTGGTCTTAGAGTCTGAGG + Intronic
951070375 3:18321221-18321243 TGCATTTCTCTAATGATTAGTGG + Intronic
951180213 3:19651040-19651062 TGCATTTCTCTAATGACCAGTGG - Intergenic
951326405 3:21307495-21307517 TGCATTTCTCTGATAATTAGTGG - Intergenic
951433775 3:22638331-22638353 TGCATTTCTCTAATGACCAGTGG + Intergenic
951675957 3:25242043-25242065 TGCATTTCTCTAATGACCAGTGG + Intronic
951974677 3:28491944-28491966 TGCATTGCTCTACTAAACAATGG + Intronic
952100038 3:30000298-30000320 TGCATTTCTCTGATAATCAGTGG - Intronic
952194283 3:31056593-31056615 TGCATTTCTCTAATGACCAGTGG + Intergenic
952614533 3:35254001-35254023 TTCATTTCTCTAATGATCAGTGG - Intergenic
952875906 3:37944150-37944172 TGTATTGCTCTAATAATGGGGGG - Intronic
952901267 3:38113170-38113192 TGCATTTCTTTAATTATCAGTGG - Intronic
953199184 3:40762790-40762812 TGCATTTCTCTGATGATCAATGG - Intergenic
953480136 3:43244238-43244260 TGCATTGGTCTTATGATCTGAGG - Intergenic
953663161 3:44905755-44905777 GGCATTGCCCTTATAATAGGGGG + Intronic
953826405 3:46255126-46255148 TGCATTTCCCTGATAATTAGTGG + Intronic
953848593 3:46448650-46448672 TGAGTTGTTCTTATAACCAGAGG + Intronic
954957313 3:54533031-54533053 TGCATTTCTCTCATGATTAGTGG + Intronic
957279196 3:78127979-78128001 TTCATTCCTTTTATATTCAGAGG + Intergenic
957467644 3:80615633-80615655 TGCATTTCTCTAATGAACAGTGG - Intergenic
957786588 3:84890394-84890416 TGCATTTCTCTGATGACCAGTGG - Intergenic
958557635 3:95700875-95700897 TGCATTTCTCTGATGATCAATGG - Intergenic
958668706 3:97174629-97174651 TGCATTTCTGTAATGATCAGTGG + Intronic
958773041 3:98448883-98448905 TCCATTTCTCTAATGATCAGTGG - Intergenic
959443657 3:106410783-106410805 TGCATTTCTCTGATGATCAATGG + Intergenic
959599841 3:108169223-108169245 TGCATTGTTCTAATTAACAGTGG + Intronic
960013098 3:112854885-112854907 TGCATCTCTCTAATGATCAGTGG - Intergenic
960065860 3:113371988-113372010 TGTATTTCTCTGATGATCAGTGG - Intronic
960086083 3:113593040-113593062 AGCATTGCTCTTACCATCATTGG - Exonic
960373087 3:116864924-116864946 AGCATTGCTCTTATTATAACGGG + Intronic
960783501 3:121346683-121346705 TGCATTGCTCTGATGGCCAGTGG + Intronic
960861547 3:122159470-122159492 TGCATTTCTCTGATAATCAGTGG + Intergenic
961151817 3:124645058-124645080 TGCATTTCTCTAGTAACCAGTGG + Intronic
961408523 3:126701002-126701024 TGCATTTCTCTGATGATTAGTGG + Intergenic
962018754 3:131473817-131473839 TGCATTTCCCTGATAATTAGTGG - Intronic
962866995 3:139455375-139455397 TGCATTTCTCTTATAATGTGAGG - Intronic
963016280 3:140827372-140827394 TGAATTCCTCTTATATTTAGAGG - Intergenic
963120308 3:141770665-141770687 TGCATTTCTCTGATCATTAGTGG - Intergenic
964048949 3:152367760-152367782 TGCATTTCTCTAATGAACAGTGG + Intronic
964886224 3:161486245-161486267 CCCATTGCTTTTTTAATCAGTGG + Intergenic
964962760 3:162448406-162448428 TGCATTTCTCTAATGACCAGTGG + Intergenic
965172834 3:165290270-165290292 TGCATTTCTCTAATGATCAGTGG + Intergenic
965191517 3:165536040-165536062 TGCCTTGGTTTTCTAATCAGGGG + Intergenic
965285648 3:166816604-166816626 TACATAGATCTTAGAATCAGTGG - Intergenic
965394604 3:168147074-168147096 TGCATTTCTCTGATGATCAATGG + Intergenic
965896380 3:173582529-173582551 TGCATTTCTCTAATAACTAGGGG + Intronic
966564036 3:181356134-181356156 TGTATTGGTCCTATAAGCAGAGG - Intergenic
966730657 3:183148603-183148625 TGCATTTCTCTTATGATCAGTGG - Intronic
967166402 3:186783624-186783646 TGCATACCTGTTATAATCCGCGG - Exonic
967944239 3:194789957-194789979 TGCATTTCTCTAATGATTAGTGG + Intergenic
968195738 3:196704667-196704689 TGCATTTCTCTTATTTTGAGGGG - Intronic
968332108 3:197879657-197879679 GGCATTCCTCTAAAAATCAGAGG - Intronic
968860159 4:3161653-3161675 TGCATTTCTCTAATGACCAGTGG + Intronic
971004047 4:22354192-22354214 TGCATTTCTCTAATGATCACTGG - Intronic
971099486 4:23447581-23447603 TGCATTTCTCTGATGAACAGTGG + Intergenic
971861049 4:32106452-32106474 AGCATTGCTATTATCTTCAGTGG + Intergenic
972032317 4:34477063-34477085 TGCATTTCTCTGATGGTCAGTGG + Intergenic
972419604 4:38874399-38874421 TGCATTTCTCTAATGATTAGTGG + Intronic
972680291 4:41299733-41299755 TGCATTTCTGTGATTATCAGTGG + Intergenic
974141148 4:57888581-57888603 TGCATTTCTTTGATAATTAGTGG + Intergenic
974205379 4:58695925-58695947 TGCATTTCTCTAATGATTAGTGG - Intergenic
974686320 4:65235869-65235891 AGCATTGCTCTTAGAGTCACAGG + Intergenic
974944138 4:68505612-68505634 TGCATTTATCTAATGATCAGTGG - Intergenic
974954690 4:68622926-68622948 TGCATTTATCTAATGATCAGTGG - Intronic
975031323 4:69621409-69621431 TTCATTTCTCCAATAATCAGTGG - Intronic
975494432 4:75022187-75022209 TGCATTTCTCTAATGATTAGTGG + Intronic
976131553 4:81890181-81890203 TGCATTTCTCTGATGACCAGTGG - Intronic
976687161 4:87826721-87826743 TGCATTTCTGTAATGATCAGTGG + Intronic
977068597 4:92352225-92352247 TACATTACTCTTATGATTAGTGG + Intronic
977083894 4:92569702-92569724 TGTATTTCTCTAATAATCAGTGG + Intronic
977326019 4:95575613-95575635 TGCATTTCTCTGATGACCAGTGG + Intergenic
977398388 4:96500029-96500051 TGCATTTCTCTAATGACCAGTGG + Intergenic
977723063 4:100263249-100263271 TGCATTTCTCTAATGACCAGTGG + Intergenic
977752361 4:100624551-100624573 TGCATTTCTCTAATGACCAGTGG + Intronic
977888365 4:102278398-102278420 TGCATTTCGCTAATGATCAGTGG - Intronic
977892893 4:102332423-102332445 TGCATTTCTCTAACAATCAGTGG - Intronic
978058026 4:104297379-104297401 TCCATTTCTCTAATGATCAGTGG + Intergenic
978164536 4:105591127-105591149 AGCAATGCTTTTATAATCATGGG - Intronic
978317947 4:107460848-107460870 TGCATTTCTCTAATGATCAGTGG - Intergenic
978765701 4:112402986-112403008 GGCATTGCCCATGTAATCAGTGG + Intronic
979262059 4:118659596-118659618 TGCATTTCTCTAATGATCAGTGG + Intergenic
979431348 4:120635974-120635996 TGCTTAGCTCTGATACTCAGTGG + Intergenic
979512725 4:121572712-121572734 TGCATTTCTCTAATGACCAGTGG - Intergenic
979594447 4:122518746-122518768 TGCATTTCTGTGATGATCAGCGG + Intergenic
979598970 4:122565625-122565647 TGCATTTCTCTGATGATCAATGG + Intergenic
979609738 4:122676786-122676808 TGCATTTCTCTAATGATCGGTGG - Intergenic
979878379 4:125923055-125923077 TGCATTTCTCTAATGATCAGTGG + Intergenic
980226060 4:129987469-129987491 TGCATTTCTCTGATCATTAGAGG + Intergenic
980925694 4:139135036-139135058 TGTATTACTTTTATAATCAGGGG + Intronic
981054715 4:140348941-140348963 TGCATTTCTCTGATGATTAGTGG + Intronic
981512348 4:145571733-145571755 TGCATTTCTCTAATAATCAGTGG - Intergenic
981870615 4:149480988-149481010 TGCATTTCTCTGATGATCAGTGG + Intergenic
982340302 4:154291197-154291219 TGCATTTCTCTGATAATCAATGG - Intronic
982605325 4:157509193-157509215 TGCAAACCTCTTATAAACAGTGG - Intergenic
983353064 4:166619003-166619025 TGCATTGCCTTTATACTCTGTGG - Intergenic
985329152 4:188808187-188808209 TGCATTTCCGTTATAACCAGAGG - Intergenic
985690016 5:1302829-1302851 TGCATTTCTCTGATGATCAGTGG + Intergenic
985990262 5:3551781-3551803 TGCATTTCTCTAATGATCAGTGG - Intergenic
986962002 5:13225356-13225378 TGCATTCCTCTGATGATCAGTGG - Intergenic
987538040 5:19213891-19213913 TGCATTTCTCTGATGATCAATGG - Intergenic
987584031 5:19831511-19831533 TGCATTTCTCTGATAATTAGTGG - Intronic
987635254 5:20531148-20531170 TGCAATTCTCTAATTATCAGTGG - Intronic
987909676 5:24125028-24125050 TGCATTTCTCTGATGATCAGTGG + Intronic
987980297 5:25075605-25075627 TGCATTTCTCTGATGATCAATGG + Intergenic
988261443 5:28891265-28891287 TGCATTGATTTTATAACCTGAGG - Intergenic
988728983 5:33951324-33951346 TACTTTGCTCTTGGAATCAGTGG - Intronic
988923470 5:35965134-35965156 TGCCCTGGTCTTAGAATCAGTGG - Intronic
989336073 5:40318347-40318369 TGCATTGCTAGAATAATCATTGG - Intergenic
989448327 5:41556997-41557019 TGCATTGCTTTGATAATTGGTGG + Intergenic
989562498 5:42868206-42868228 TGCATTTCTCTGATGACCAGTGG - Intronic
989669713 5:43901428-43901450 TGCATTTCTCTAATGATGAGTGG + Intergenic
989683169 5:44053690-44053712 TGCATTTCTCCGATAATTAGTGG - Intergenic
990422323 5:55648707-55648729 TGCATTTCTGTAATGATCAGTGG - Intronic
990886229 5:60597012-60597034 TGCATTTGACTTAGAATCAGAGG + Exonic
991105968 5:62842482-62842504 TGCATTTCTCTGATGGTCAGTGG - Intergenic
991168257 5:63588815-63588837 TGCATTTCTCTAAAAATCAAGGG + Intergenic
991664129 5:68980522-68980544 TGCATTTCTCTGATGATCAGTGG - Intergenic
992282424 5:75194955-75194977 TGCATTATTATTATAATCAGGGG + Intronic
993633918 5:90320933-90320955 TTCATTTCTCTGATGATCAGTGG + Intergenic
993751667 5:91677006-91677028 TGCATTTCTCTAATGATCAGTGG + Intergenic
994027081 5:95097065-95097087 GGCATTGCTGATATAATCAGGGG - Intronic
994561466 5:101378978-101379000 TGCCTTGCTCTGATGATCAGGGG + Intergenic
994863258 5:105227219-105227241 TGCATTGCTCTCTTTATCACTGG + Intergenic
995810629 5:116103400-116103422 TGCATTTCTCTAATGACCAGTGG + Intronic
995895501 5:117006073-117006095 TGCATTTCTTTAATAATCAGTGG + Intergenic
996427072 5:123325365-123325387 TGCATTTCCCTGATAATTAGTGG + Intergenic
996639540 5:125735687-125735709 TGCATTTCTCTAATAATCAGAGG - Intergenic
996986952 5:129579173-129579195 TGCATTTCTCTAATGACCAGTGG + Intronic
997040796 5:130251046-130251068 TGCATTTCTCTGATGATTAGTGG + Intergenic
997174647 5:131762507-131762529 TGCGTTTCTCTGATGATCAGTGG - Intronic
998632732 5:143918135-143918157 TGCATTACCTTTATAATTAGAGG - Intergenic
998912130 5:146971066-146971088 AGGATTTATCTTATAATCAGTGG + Intronic
999210265 5:149882173-149882195 TGCACTGCTCCCAGAATCAGGGG + Intronic
999469267 5:151837221-151837243 TGCATTGCTCTAATGACCAGTGG - Intronic
1000327465 5:160183335-160183357 TACATTGGTCTTGTAATCAGGGG - Intergenic
1001192697 5:169645356-169645378 TGCATTTCTCAGATGATCAGTGG + Intronic
1003602935 6:7534603-7534625 TGTGTTGCTATTATAACCAGTGG + Intergenic
1003826083 6:9953640-9953662 TGCATTTCTCTAATGATCAGTGG + Intronic
1004057606 6:12155985-12156007 TGCATTTCTCTAATGATCAGTGG + Intronic
1007837703 6:44687094-44687116 TGCATTTCCCTGATAATTAGTGG + Intergenic
1008225244 6:48906701-48906723 TGCATTTCTCTAATGATCAGTGG + Intergenic
1008740848 6:54605936-54605958 TGCATTTCTCTGATGATCAGTGG + Intergenic
1008842162 6:55915898-55915920 AGCAATGCTCTCATTATCAGAGG + Intergenic
1008885381 6:56426761-56426783 TGCACTTCTCTGATGATCAGTGG - Intergenic
1009799025 6:68509260-68509282 TGCATTTCTCTGATCATTAGTGG + Intergenic
1010014964 6:71094152-71094174 TGCATTTCTCTTATGATCAATGG - Intergenic
1010148495 6:72700940-72700962 TGAATTGCTCTTAAAATTACAGG - Intronic
1010251971 6:73716511-73716533 TGCATTTCTCTAATGATCAATGG + Intronic
1010255232 6:73749719-73749741 TGCATTACTTTTATAACCAGAGG - Intronic
1010316915 6:74462188-74462210 TGCATTTCTCTGACAATCAATGG + Intergenic
1010421659 6:75683139-75683161 TGCATTTCTCTGATGACCAGTGG + Intronic
1011722109 6:90168054-90168076 TACTTTACTTTTATAATCAGCGG - Intronic
1012005213 6:93705419-93705441 TGCATTTCTCTGATGATTAGTGG + Intergenic
1012202729 6:96425718-96425740 TGCATTTCTCTGATGATCAGTGG + Intergenic
1012363723 6:98414244-98414266 TGCATTTCTCTAATGACCAGTGG - Intergenic
1013358067 6:109364464-109364486 TGCATTTCTCTGATGACCAGTGG - Intergenic
1013363337 6:109415269-109415291 TTCATTGCTCTTATCATAAAAGG + Intronic
1013405909 6:109843432-109843454 TGCATTTCCCTGATAATTAGTGG + Intergenic
1014335432 6:120127817-120127839 TGCATTTCCCTAATGATCAGTGG + Intergenic
1014375369 6:120665518-120665540 TGCATTTCTCTAATGATCTGTGG + Intergenic
1014421519 6:121251982-121252004 TGCATTTCTCTAATGACCAGTGG - Intronic
1014922895 6:127233607-127233629 TGCATTTCTCTAATGACCAGTGG - Intergenic
1015093509 6:129387314-129387336 TGCATTTCTCTAATGATCAGTGG - Intronic
1015599077 6:134894878-134894900 TAAATTGCTTTTATAACCAGAGG - Intergenic
1016217901 6:141625438-141625460 TGCATTTCTCTGATGATTAGTGG + Intergenic
1016230227 6:141794912-141794934 TGCATTTCTCTGATGATCAGTGG - Intergenic
1016265498 6:142228268-142228290 TGCATTTTTCTAATGATCAGTGG + Intergenic
1016366517 6:143324385-143324407 TGAATTACTTTTATAGTCAGTGG + Intronic
1017090973 6:150758703-150758725 TGCATTTCTCTAATGATCAGTGG + Intronic
1017370979 6:153708151-153708173 TGCATTTCTCTAATGATCAGTGG + Intergenic
1018377152 6:163223833-163223855 TGAATTGCTTTTCTAAACAGTGG + Intronic
1020633326 7:10667208-10667230 TGCATTTCTCTGATGATCAGTGG + Intergenic
1020658324 7:10953555-10953577 TGCATTTCTTTGATGATCAGTGG + Intergenic
1020810472 7:12844970-12844992 TGCATTTCTCTAATGACCAGTGG - Intergenic
1020867499 7:13585782-13585804 TGCATTTCTCTAATAACCAATGG + Intergenic
1020995963 7:15264690-15264712 TGCATTTCTCTAATCATTAGTGG - Intronic
1021042659 7:15882381-15882403 TGCATTTCTCTAATGACCAGTGG + Intergenic
1021176455 7:17455554-17455576 TGCATTTCCCTGATAATCAGTGG - Intergenic
1021595045 7:22306301-22306323 TGCATTTCTCTGATGATCAGTGG + Intronic
1021643510 7:22764492-22764514 TGCATTTCTCTGGTAATTAGTGG - Intergenic
1022410145 7:30133863-30133885 TGCATTTCTCTGATAATTAGTGG - Intergenic
1022639914 7:32172451-32172473 TGCATTTCTCTAATGATCAGTGG - Intronic
1024152366 7:46585390-46585412 TGCATTTCTCTAATGATCAGTGG - Intergenic
1024181059 7:46895419-46895441 TGCATTTCTCTGATAACGAGTGG + Intergenic
1024408936 7:49016178-49016200 TGCATTTCTCTAATGATCAGTGG - Intergenic
1025146252 7:56507150-56507172 TGCATTTCTCTGATGGTCAGTGG + Intergenic
1025784226 7:64629718-64629740 TGCAATTCTCTAATGATCAGTGG - Intergenic
1028026107 7:85842831-85842853 TGCATTTCTCTAACAATTAGAGG + Intergenic
1028057619 7:86267030-86267052 TGCATTTCTCTAATGACCAGTGG - Intergenic
1029009282 7:97241706-97241728 TGCATTTCTCTAATGACCAGTGG - Intergenic
1029881718 7:103819147-103819169 GGCATTGCTTTCATAATCAGAGG + Intronic
1030234789 7:107246630-107246652 TGCATTTCTCTAATGATCAGTGG - Intronic
1030434669 7:109501571-109501593 TGCATTTCTCTAGTAATCAGCGG + Intergenic
1030542140 7:110844192-110844214 TGCATTTCTCTTCTCCTCAGTGG - Intronic
1030990823 7:116298007-116298029 TTCATCTCTCTGATAATCAGTGG - Intronic
1031395575 7:121269727-121269749 TGCATTTCTCTGATGATTAGTGG + Intronic
1031527551 7:122839689-122839711 TGCATTTCTCTGATGACCAGTGG - Intronic
1031738285 7:125395417-125395439 TTCATTTCTCTAATGATCAGTGG - Intergenic
1031751252 7:125577800-125577822 TGCATTTCTCTAATGATCAGTGG - Intergenic
1032313643 7:130813407-130813429 TGCATTTCTCTAATAACCAGTGG + Intergenic
1032590143 7:133184318-133184340 TTTATTCCTTTTATAATCAGGGG - Intergenic
1033001594 7:137511169-137511191 TGAATTGCTCTTATTAGCAAAGG + Intronic
1033572981 7:142652034-142652056 TGCATTTCTCTAATGATCAGTGG - Intergenic
1033679715 7:143582742-143582764 TGGATTGCTCTGATCCTCAGTGG - Intergenic
1033692120 7:143746701-143746723 TGGATTGCTCTGATCCTCAGTGG + Intergenic
1033769709 7:144536148-144536170 TGCATTTCTCTAATGATTAGTGG + Intronic
1034705002 7:153133717-153133739 TGCATTTCTCTAATGATCAGTGG + Intergenic
1034740537 7:153469462-153469484 TGCATTTCTCTTATAGTGAGAGG + Intergenic
1035033228 7:155878158-155878180 TGTATTACTTTTATAATCAGTGG + Intergenic
1035615574 8:998714-998736 CCCTTTGCTCTTATAATCTGAGG + Intergenic
1036285320 8:7439941-7439963 TGCATTGATTTTATAAGCAAAGG - Intergenic
1036336156 8:7871588-7871610 TGCATTGATTTTATAAGCAAAGG + Intergenic
1036804031 8:11815602-11815624 TGCATTTCTCTGATGACCAGTGG + Intronic
1036836164 8:12070155-12070177 TGCATTGCTCTAGTGATTAGTGG - Intronic
1036858006 8:12316725-12316747 TGCATTGCTCTAGTGATTAGTGG - Intergenic
1037074678 8:14699863-14699885 TGCATTTCTCTAATGATTAGTGG - Intronic
1037125029 8:15337869-15337891 TTTGTTGCCCTTATAATCAGAGG + Intergenic
1038673657 8:29603214-29603236 TGCATTTCTATTATGATCACTGG + Intergenic
1039172982 8:34769816-34769838 TGCAGAGTTCTAATAATCAGAGG - Intergenic
1039402722 8:37284638-37284660 TGCATTTCTCTGATGATCAGTGG - Intergenic
1039638348 8:39191484-39191506 TGCATTTCTCAAATAATCAGTGG + Intronic
1042619648 8:70691143-70691165 TGCATTTCTCTAATGATCAGTGG + Intronic
1043015495 8:74934982-74935004 TGAATTTCTCTGATGATCAGTGG + Intergenic
1043733894 8:83720588-83720610 TGCATTTCTCTAATGATCAGTGG - Intergenic
1043839977 8:85091557-85091579 TGCATTTCTCTAATAATTAGTGG - Intergenic
1044362057 8:91297447-91297469 TGCTTTGCTCTTATAATTCTAGG - Intronic
1044470151 8:92557557-92557579 TGCATTTCTCTGATAACCAGTGG + Intergenic
1044594687 8:93947357-93947379 TGCATTTCTCTAATGACCAGTGG + Intergenic
1044798461 8:95928622-95928644 TGCATTTCTCTGATGACCAGTGG + Intergenic
1045322159 8:101090446-101090468 TGCATTTCCCTTATGATTAGTGG + Intergenic
1045404050 8:101847535-101847557 TCCCTTTCTCATATAATCAGAGG - Intronic
1045922889 8:107553234-107553256 TTCATTGCACTTATTAGCAGAGG + Intergenic
1046169728 8:110489594-110489616 TGCATTTCTCTGATTATCAATGG - Intergenic
1046542208 8:115600069-115600091 TGCATTTCTCTAATGATCAGTGG + Intronic
1046601219 8:116319178-116319200 TGCATTGCTCTAATGGTAAGTGG - Intergenic
1046703431 8:117426082-117426104 TGCATTTCTCTAATGATTAGTGG - Intergenic
1046810697 8:118530107-118530129 TGCATTTCTCTGATGATCAGTGG + Intronic
1048507999 8:135037978-135038000 TGCATTTCTCTAATGATCAGTGG + Intergenic
1048929385 8:139299205-139299227 TGCATTTCTGTAATGATCAGTGG - Intergenic
1051312172 9:15787834-15787856 TGTATTTCTTTTATTATCAGTGG + Intronic
1051706503 9:19886465-19886487 TGCATTTCTCTAATGATCAGCGG - Intergenic
1052527570 9:29638469-29638491 TATTTTGATCTTATAATCAGGGG - Intergenic
1052535710 9:29743792-29743814 TGCATTTCTCTCATAATTAGTGG + Intergenic
1052554195 9:29992643-29992665 TGCATTTCTCTAATGATCAGTGG + Intergenic
1052627004 9:30988567-30988589 TGCATTTCTCTGATGATCAGTGG + Intergenic
1052885514 9:33644086-33644108 TGCATTTCTCTAATGATCAGTGG - Intergenic
1055387849 9:75783150-75783172 TGCATTTCTCTAATGATTAGTGG + Intergenic
1055403699 9:75951392-75951414 CGGTTTTCTCTTATAATCAGTGG + Intronic
1055572276 9:77629138-77629160 TGCATTTCTCTAATGACCAGTGG - Intronic
1055843773 9:80536416-80536438 TGCATTTCTCTGATGACCAGTGG - Intergenic
1058198984 9:102014851-102014873 TGCATTTCTCTAATGATTAGTGG - Intergenic
1058332811 9:103785291-103785313 TGCATTTCTCTAATGATCAGTGG - Intergenic
1058526383 9:105863432-105863454 TCCATTTCTCTAATGATCAGTGG - Intergenic
1058784011 9:108367936-108367958 TTCACTGCTTTTATAGTCAGTGG + Intergenic
1059017442 9:110534756-110534778 TGCATTTCTCTAATGATCAGTGG + Intronic
1059229534 9:112706110-112706132 TGCATTTCTCTAATGATCAATGG - Intronic
1060706539 9:125806990-125807012 TGGATTGCTAGTTTAATCAGTGG + Intronic
1060777031 9:126382383-126382405 TATATTGCTCTTGTAATTAGGGG - Intronic
1203450435 Un_GL000219v1:108696-108718 TGCATTTCTCTGATTATTAGTGG + Intergenic
1185749854 X:2602170-2602192 TGCATTTCTCTAAGAATCAGCGG - Intergenic
1185914226 X:4017580-4017602 TGCATTTCTCTGATGATTAGTGG + Intergenic
1188716844 X:33469085-33469107 TACAATGCTATTATAATCAAGGG - Intergenic
1188738206 X:33743966-33743988 TGCATTTCTCTAATGATCACTGG - Intergenic
1189898258 X:45678885-45678907 TGCATTTCTCTAATGATTAGTGG - Intergenic
1189921358 X:45906028-45906050 TGCATTTCTCTAATGATTAGTGG + Intergenic
1190126994 X:47714857-47714879 TGCATTTCTCTAATGACCAGTGG - Intergenic
1190390307 X:49924595-49924617 TATATTGCTTTTATAATCAGGGG - Intronic
1190482759 X:50893949-50893971 TGCATTTCTCTGATGATCAGTGG - Intergenic
1191739333 X:64419837-64419859 TGCATTTCTCTAATGATCAGTGG + Intergenic
1191749474 X:64526417-64526439 TGCATTTCTCTAATGATCAGGGG - Intergenic
1191999421 X:67132692-67132714 TGCTTTGCCCTTTTAATCTGAGG + Intergenic
1192026810 X:67461863-67461885 TGCATTTCTCTAATGATCAGTGG - Intergenic
1192359228 X:70427966-70427988 TGTATTACTTTTACAATCAGGGG - Intronic
1192726729 X:73761677-73761699 TGCATTTCTATAATGATCAGTGG + Intergenic
1192963637 X:76154863-76154885 TGCATTTCTCTAATGACCAGTGG - Intergenic
1193483118 X:82052164-82052186 TGCATTTCTCTAATGATCATTGG - Intergenic
1193618341 X:83718205-83718227 TGCATTTCCCTGATAATTAGTGG + Intergenic
1193620231 X:83743938-83743960 TGCATTTCTCTGATGATCAGTGG - Intergenic
1193816449 X:86110010-86110032 TGCATTTCTCTGATGATCACTGG - Intergenic
1193859932 X:86652678-86652700 TGCATTTCTCTAATAATCAATGG + Intronic
1193969218 X:88030975-88030997 TGCATTTTTCTAATGATCAGTGG - Intergenic
1194046953 X:89019601-89019623 TGCATTTCTCTGATGATCAGGGG - Intergenic
1194060967 X:89197427-89197449 TGCATTTCTCTAATGATCAGTGG - Intergenic
1194212745 X:91088657-91088679 TGCATTTCTGTAATGATCAGTGG + Intergenic
1194455056 X:94093525-94093547 TGTATTCCTCTGATAACCAGAGG - Intergenic
1194587673 X:95756063-95756085 TCCATTTCTCTAATGATCAGTGG + Intergenic
1194706378 X:97180235-97180257 TGCATTTCTCTAATTATCAGTGG + Intronic
1194958585 X:100209539-100209561 TGCATTTCTCTAATGACCAGTGG + Intergenic
1196129161 X:112134395-112134417 TGCATTTTTCTTAAAATCATGGG - Intergenic
1196526640 X:116735570-116735592 TGCATTTCTCTAATGATTAGTGG + Intergenic
1196528957 X:116760744-116760766 TGCATTCCTCTAATTATTAGTGG - Intergenic
1197060541 X:122174523-122174545 TGCATTTCTCTAATGACCAGTGG + Intergenic
1197133685 X:123035748-123035770 TGCATTGTGATTCTAATCAGTGG - Intergenic
1198600358 X:138277821-138277843 TGCATTTCTCTGATGTTCAGTGG + Intergenic
1198861660 X:141077274-141077296 TGCATTTCTCTGATGATTAGTGG - Intergenic
1198901031 X:141510114-141510136 TGCATTTCTCTGATGATTAGTGG + Intergenic
1198987240 X:142469281-142469303 TGCATTTCCCTGATAATTAGTGG - Intergenic
1199000313 X:142628557-142628579 TACATTTCTCTAATGATCAGTGG + Intergenic
1199248683 X:145635276-145635298 TGCATTTCTCTAATGATCAGTGG + Intergenic
1199403813 X:147432022-147432044 TGCATTTCTCTAATGATTAGGGG - Intergenic
1199469194 X:148175100-148175122 TGCATTTCTCTAATGAGCAGTGG + Intergenic
1199670357 X:150142065-150142087 TGCATTTCTCTAATGACCAGTGG + Intergenic
1200131958 X:153854628-153854650 TGCGTTCCTCTGATAATCAATGG + Intergenic
1200332555 X:155312973-155312995 TGAATTTCTCTAATTATCAGGGG - Intronic
1200536233 Y:4400973-4400995 TGCATTTTTCTAATGATCAGTGG + Intergenic
1201985938 Y:19965377-19965399 TGTATTTCCCTGATAATCAGGGG + Intergenic