ID: 907227866

View in Genome Browser
Species Human (GRCh38)
Location 1:52966364-52966386
Sequence ATGTTCCCCACTTAGATCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907227865_907227866 3 Left 907227865 1:52966338-52966360 CCAGTATCTATGGAGATAATTGC No data
Right 907227866 1:52966364-52966386 ATGTTCCCCACTTAGATCTATGG 0: 1
1: 0
2: 0
3: 4
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907227866 Original CRISPR ATGTTCCCCACTTAGATCTA TGG Intronic
901284473 1:8066156-8066178 TTGATCCCCAGTTAGATCTGAGG - Intergenic
902329096 1:15722089-15722111 ATGTTTCCCCCTTAAATCTGAGG + Intronic
907227866 1:52966364-52966386 ATGTTCCCCACTTAGATCTATGG + Intronic
907646173 1:56245784-56245806 TTGTTCCACACTAAGAACTAAGG + Intergenic
912263115 1:108128876-108128898 ATGTTCCCCCTTAAGATATAGGG - Intergenic
912505811 1:110155111-110155133 AACTTCCCCACTGAGATCTCAGG - Intronic
913156621 1:116106001-116106023 ATGTTATTCATTTAGATCTATGG + Intergenic
913549862 1:119906931-119906953 ATGGTACCCACTTAGATTGAGGG - Intergenic
917308234 1:173649892-173649914 ATTTTCCCCACTGAAATTTAGGG + Intronic
918682291 1:187370663-187370685 ATGTTCCCCACTGTCATTTATGG - Intergenic
1071458573 10:85870132-85870154 ATGTTGCCCACTGAGATTGAGGG - Intronic
1076409768 10:130238164-130238186 ATGCTCCCCACATTGATATATGG - Intergenic
1079824595 11:25175045-25175067 ATGTTCCCCACCCATATCTCAGG - Intergenic
1085830146 11:79891561-79891583 ATGTTCCCTTCTTAGAACCAAGG + Intergenic
1088705565 11:112461168-112461190 ATGCTCCCCACTTGAATCTGGGG - Intergenic
1089338367 11:117741209-117741231 AGGTGCCCCACCTAGATGTAAGG - Intronic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1092873020 12:12823679-12823701 ATATTCCCCACTTAGCCTTAAGG - Intronic
1098080621 12:66781041-66781063 TTGTTCACCACTGAGTTCTAGGG + Intronic
1098802657 12:74981705-74981727 CTGTTCCCTGCTTAGATCTGAGG - Intergenic
1100366382 12:93924645-93924667 ATGTCTCTCACTTAAATCTATGG + Intergenic
1102447462 12:113014748-113014770 AAGATCCCCACTTACATCAAAGG + Intergenic
1103790440 12:123466453-123466475 ATCTTCCTCACATAGTTCTAAGG + Intronic
1103830215 12:123773244-123773266 TTGTTTCCCAGTTAGATCAAGGG + Intronic
1112303385 13:98250929-98250951 GTCTTCCCCACTTAGCTGTAAGG + Intronic
1115295175 14:31817817-31817839 ATTTACCCCACTTACATTTAAGG - Intronic
1124951439 15:34325152-34325174 CTGTTCACCACTTACATTTAGGG + Intronic
1125256089 15:37764806-37764828 CATTTCCCCACTTAAATCTAGGG + Intergenic
1133845507 16:9449941-9449963 ATGTTCACCATTTAGATTTACGG + Intergenic
1140129902 16:72151257-72151279 ATGTTCCCCACCTATCTCTTGGG - Intronic
1140146939 16:72320186-72320208 ATTTTTCCCTCTTAGATCTCAGG + Intergenic
1141147781 16:81543638-81543660 AGTTTCCCCACCTAGAGCTAAGG + Intronic
1142929613 17:3271518-3271540 ATTTTACCCACTGATATCTATGG + Intergenic
1146539221 17:33680236-33680258 ATGTCCCCCACTATGAACTATGG + Intronic
1148623458 17:49051894-49051916 CTGTTTGCCCCTTAGATCTATGG - Exonic
1158165041 18:54530771-54530793 ATGTTCTGTATTTAGATCTAGGG - Intergenic
1159177090 18:64851653-64851675 ATGGTCCCCACCCAGATCGAGGG - Intergenic
1163858360 19:19725066-19725088 ATTTACCCCACTTACATTTAAGG + Intronic
928443992 2:31316957-31316979 ATGTTTCCTATTAAGATCTAAGG + Intergenic
929478972 2:42283545-42283567 CTTTTCCCCACTTAGATCCAAGG + Intronic
931240863 2:60451274-60451296 ATTTTCCCCACTTAGGTTCACGG + Intronic
939452106 2:142387717-142387739 ATGTTCCCCACTTAACTAGATGG + Intergenic
939798137 2:146673624-146673646 ATCTTCCCCACTTAGAATAATGG + Intergenic
941240780 2:163034861-163034883 ATTTACCCAAGTTAGATCTATGG - Intergenic
944205337 2:197152275-197152297 ATTTTCCCCACTTATATTCATGG - Intronic
944380081 2:199098316-199098338 AGGTTCCCAAATTAGATATACGG + Intergenic
947269571 2:228318804-228318826 TTTTTCCCCACTTATATCTTAGG - Intergenic
1170912375 20:20585834-20585856 TTGTTCCCCACTTGAACCTAAGG - Intronic
1171486403 20:25489510-25489532 ATTTTCCAGACTTAGATCTAAGG + Intronic
1173179716 20:40796658-40796680 TTGTTCCCTACCTACATCTAGGG - Intergenic
1177663635 21:24122792-24122814 ATGGTGCCCACTCAGATCGAGGG - Intergenic
949782273 3:7703180-7703202 ATGTTCTCCACTCTGATCTTAGG + Intronic
951606459 3:24439939-24439961 ATGTGACCCACATAGATCAAAGG + Intronic
955066792 3:55540391-55540413 ATGTTCCAGACTGAGAACTAGGG + Intronic
958987343 3:100797274-100797296 ATTTTCCCCACTGAGAAATACGG - Intronic
965387595 3:168063541-168063563 ATCTTCCCCACTGAGATATTGGG + Intronic
965461062 3:168963865-168963887 ATGGTCCCCACTCAGATTAAGGG + Intergenic
972178575 4:36438077-36438099 ATTTTACCCACTTACATTTAAGG + Intergenic
975726726 4:77299472-77299494 ATTTAGCCCACTTAGATTTAAGG + Intronic
976226678 4:82799531-82799553 GTGTTCCTCACTGAGAGCTAAGG - Intergenic
977754650 4:100653197-100653219 TTTTTCCCCACTAAGTTCTATGG - Intronic
977832910 4:101615352-101615374 ATGGTGCCCACTCAGATCAAGGG + Intronic
980577029 4:134695993-134696015 ATGTTCCCTCCTTAAATATAAGG - Intergenic
982390993 4:154863647-154863669 ATGTTCCTCATTTACATCTGAGG + Intergenic
984563862 4:181303929-181303951 ATGTTCTCATCTTAGTTCTATGG + Intergenic
984611036 4:181837783-181837805 ATTTTCCCCACTTCCATATAAGG - Intergenic
985098988 4:186439045-186439067 ATGATCTCCAGTTACATCTATGG - Intronic
985351480 4:189067508-189067530 ATGTTCCCTACTTAGACACAAGG + Intergenic
991254625 5:64600602-64600624 TTGTTCCCCAGATAGATCCAAGG - Intronic
992165516 5:74046858-74046880 ATGTTCTAAACTCAGATCTATGG - Intergenic
996861529 5:128072382-128072404 ATGTTCCACATTTAAATATATGG + Intergenic
1004059101 6:12173790-12173812 ATGTTGCCAAATGAGATCTAAGG + Intergenic
1004207135 6:13602159-13602181 ATGCTCCCCAAATTGATCTATGG + Intronic
1008089901 6:47283397-47283419 ATTTTCCCCACTTAAATTTTAGG - Intronic
1008532166 6:52472966-52472988 ATTTTCCCCAAATTGATCTATGG + Intronic
1008861896 6:56158864-56158886 ATTTTCCCCCCTTGGATTTACGG - Intronic
1008939899 6:57035354-57035376 ATAATCTCCACTTAAATCTAGGG + Intergenic
1009681803 6:66903714-66903736 ATGTTCTTCACTTACATTTATGG + Intergenic
1009994809 6:70886272-70886294 ATTATCCCCACTTACATATAAGG - Intronic
1011333904 6:86238813-86238835 ATTTACCCCACTTACATTTAAGG - Intergenic
1012796952 6:103774401-103774423 ATGTTCCCCACGTAACTCTGAGG + Intergenic
1016235189 6:141855683-141855705 ATGGTGCCCACTCAGATCAAGGG + Intergenic
1022594808 7:31703074-31703096 ATGGTCCCCTTTTAGATTTATGG - Intronic
1023363435 7:39439343-39439365 ATTTACCCCACTTACATTTAAGG + Intronic
1023762417 7:43478986-43479008 CTGTTCCCCATTTAGATCAGTGG + Intronic
1023974488 7:45018026-45018048 CTTTTCCCCACTTTGGTCTATGG - Intronic
1031233392 7:119140197-119140219 ATCTTCCCCAATTAGAAATATGG - Intergenic
1032514064 7:132494031-132494053 ATGTTTGGCACTTAGTTCTATGG + Intronic
1043265713 8:78265747-78265769 ATTTACCCAACTTATATCTAAGG + Intergenic
1044131325 8:88527344-88527366 ATTTAACCCACTTAGATTTAAGG - Intergenic
1046649166 8:116818112-116818134 ATTTGCTCCACTTAGATCTCTGG + Intronic
1048517775 8:135126081-135126103 ACGTTCCCCACTGGGATTTAGGG + Intergenic
1054953326 9:70878887-70878909 GTTTTCCCAACTTAGATGTAAGG - Intronic
1058900408 9:109437655-109437677 ATGCTCCCCACTTGGACATAGGG + Intronic
1059595415 9:115714947-115714969 ATGTGGCCCTCTTAGAACTAAGG + Intergenic
1187658851 X:21514967-21514989 ATAGTCCCCACTTACATATAAGG + Intronic
1188134501 X:26478427-26478449 ATGTTTCCCAAATTGATCTATGG + Intergenic
1194233163 X:91348837-91348859 ATGGTCCCCACCTAGATTGAGGG - Intergenic
1196365925 X:114924106-114924128 ATGTTTTACATTTAGATCTATGG - Intergenic
1197076632 X:122361735-122361757 ATTTTGCCCACTTACATTTAAGG + Intergenic
1197268016 X:124396751-124396773 ATGGTCCACACTTAGGTCAAGGG - Intronic