ID: 907232757

View in Genome Browser
Species Human (GRCh38)
Location 1:53015374-53015396
Sequence GAGTCACTAAATGTGCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907232754_907232757 0 Left 907232754 1:53015351-53015373 CCAGGCTTCTGAGGTGGTTTAGG 0: 1
1: 0
2: 0
3: 19
4: 465
Right 907232757 1:53015374-53015396 GAGTCACTAAATGTGCTGATTGG 0: 1
1: 0
2: 0
3: 9
4: 130
907232753_907232757 4 Left 907232753 1:53015347-53015369 CCTTCCAGGCTTCTGAGGTGGTT 0: 1
1: 0
2: 0
3: 21
4: 173
Right 907232757 1:53015374-53015396 GAGTCACTAAATGTGCTGATTGG 0: 1
1: 0
2: 0
3: 9
4: 130
907232750_907232757 12 Left 907232750 1:53015339-53015361 CCTCATGGCCTTCCAGGCTTCTG 0: 1
1: 0
2: 2
3: 27
4: 401
Right 907232757 1:53015374-53015396 GAGTCACTAAATGTGCTGATTGG 0: 1
1: 0
2: 0
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907232757 Original CRISPR GAGTCACTAAATGTGCTGAT TGG Intronic
900724208 1:4204473-4204495 GAGTCAAATAATCTGCTGATGGG + Intergenic
900811966 1:4810841-4810863 GAGTCAGTAATTGTGCTCCTTGG + Intergenic
902158821 1:14512543-14512565 GAGTCAGTAGATTTGCTAATAGG - Intergenic
905297801 1:36965274-36965296 GAGTCATTAAATTTTCTGATAGG - Intronic
907232757 1:53015374-53015396 GAGTCACTAAATGTGCTGATTGG + Intronic
908894798 1:68886568-68886590 AAGGCTCTAAATGTGCTGATAGG + Intergenic
912012973 1:104994575-104994597 GAGTCATAAAATGTGTTAATTGG - Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
915122291 1:153637274-153637296 GAGTCAGAAAAAGTGATGATTGG + Intronic
916025760 1:160832023-160832045 CAGTCCCTAAATGCTCTGATGGG + Intronic
916096985 1:161360177-161360199 AAGTCACTAAATGAGCCCATGGG - Intronic
916873848 1:168947374-168947396 GGGTCAATAATTATGCTGATAGG + Intergenic
918509687 1:185297707-185297729 GAGTCATTTAATGTGCAAATTGG + Exonic
921708494 1:218350251-218350273 GAACCACAACATGTGCTGATTGG - Intronic
1064225932 10:13485125-13485147 GAGTCACGTGATGTGCTCATGGG - Intronic
1065364042 10:24917641-24917663 GAGACACCAAAAGAGCTGATGGG + Intronic
1066007058 10:31155162-31155184 AAGTCACTTAATGTGCTGTTAGG + Intergenic
1069585471 10:69598079-69598101 GAGTTGATAAATGTGTTGATGGG - Intergenic
1072411431 10:95205928-95205950 GAGTTACTCACTGGGCTGATGGG - Intronic
1073467152 10:103700840-103700862 GAGTGACAAAATGGGGTGATGGG + Intronic
1075531953 10:123237125-123237147 GGGTCATGAAATGTGCTGATTGG - Intergenic
1080415422 11:32065677-32065699 GAATCAGCAAAAGTGCTGATGGG - Intronic
1081043626 11:38243395-38243417 AAGTTACAAAATGTGCTGAAGGG - Intergenic
1085276773 11:75305478-75305500 AAGTCACTGAATGTGCAGTTGGG - Intronic
1087080746 11:94168866-94168888 AAGTAACAAGATGTGCTGATTGG + Intronic
1090248243 11:125232744-125232766 AACTCACTAAATGTGATCATAGG - Intronic
1090518662 11:127455549-127455571 TAGTAACTAATTGTGATGATAGG - Intergenic
1091871919 12:3899106-3899128 GAATCACCAAATCTTCTGATTGG - Intergenic
1094599573 12:31896740-31896762 GAGTCACTGACTGTGTCGATAGG + Intergenic
1099193457 12:79585320-79585342 GAGTCACAAACTTTGCAGATGGG - Exonic
1102638672 12:114346935-114346957 GACTCACCAGATGTGCTCATTGG - Intergenic
1104752527 12:131248745-131248767 GAGTCAGTAAATGTTCCCATTGG + Intergenic
1104779419 12:131410492-131410514 GAGTCAGTAAATGTTCCCATTGG - Intergenic
1105651904 13:22388056-22388078 CAGTCTCTAACTGTGCTAATAGG + Intergenic
1105962023 13:25350711-25350733 GAGTGACAAAATGTTCTTATGGG - Intergenic
1109231759 13:59766085-59766107 GAGTCATCAAATTTTCTGATAGG - Intronic
1114044559 14:18712371-18712393 GAGTCAAAAAACTTGCTGATGGG + Intergenic
1114048892 14:18903097-18903119 GAGTCAAAAAACTTGCTGATGGG + Intergenic
1114113670 14:19498836-19498858 GAGTCAAAAAACTTGCTGATGGG - Intergenic
1117440619 14:55755871-55755893 AAGCCACTAAATTTGGTGATTGG - Intergenic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1120251799 14:82067643-82067665 GTGTCACTACATCTGCTGCTTGG - Intergenic
1121494841 14:94385149-94385171 GGGACACTAAATATGCTGAGTGG + Intronic
1124810807 15:32936364-32936386 GAGACACTAGCTGGGCTGATTGG - Intronic
1125481465 15:40083842-40083864 CAGTCTCTGAATGTGCTGACAGG + Intergenic
1126040290 15:44584032-44584054 GAGTCACTAAACTTTTTGATTGG - Exonic
1127290836 15:57569632-57569654 GAGTGAGTATATGTGCTGAGTGG + Intergenic
1131021011 15:89098771-89098793 GAGTCAATAAATAGACTGATGGG - Intronic
1134674043 16:16076924-16076946 CAGACACTGAGTGTGCTGATTGG + Intronic
1137319210 16:47362143-47362165 GAATCAGTAAATTTGCTGATTGG - Intronic
1142947492 17:3444324-3444346 GAGTAATAAAATATGCTGATTGG - Intronic
1142987411 17:3704565-3704587 GGGTCACACAAGGTGCTGATGGG - Intergenic
1147241323 17:39092459-39092481 GAGTCAACAAATGTGCTGCATGG - Intronic
1147458945 17:40556442-40556464 GAGACTCTACATGTGCTGACAGG + Intronic
1203192440 17_KI270729v1_random:201696-201718 GAGTCTTTTCATGTGCTGATTGG + Intergenic
1203201805 17_KI270730v1_random:1133-1155 GAGTCTTTTCATGTGCTGATTGG + Intergenic
1155546384 18:26920087-26920109 GAGTCACTAAATGTAATGACAGG - Intronic
1155980866 18:32177955-32177977 GAGTCACCAAAGGGCCTGATGGG - Intronic
1156425616 18:37008808-37008830 GAGTCAGTAAATTTGAAGATAGG + Intronic
1163241105 19:16064421-16064443 GACACACTAAAGATGCTGATGGG + Intergenic
1167842608 19:52134309-52134331 TAGTTAATAAATGTGATGATTGG - Intronic
925685419 2:6467502-6467524 GAGTCAGTTGATGTACTGATAGG + Intergenic
927565058 2:24104639-24104661 GAGTCACTTACTCTGCTGTTCGG - Intronic
929010833 2:37442525-37442547 AAGGAAATAAATGTGCTGATTGG - Intergenic
935841738 2:107119740-107119762 GAGTGACAATATGTGCTGTTTGG + Intergenic
938426207 2:131191353-131191375 GAGTCAAAAAACTTGCTGATGGG + Intronic
942826463 2:180182920-180182942 CAAACACTAAATATGCTGATAGG - Intergenic
944716630 2:202381474-202381496 GAGTCTGGAAATGTGCTGGTAGG - Intronic
944749458 2:202693766-202693788 GAGTCACATAATGTAATGATAGG - Intronic
946519471 2:220449381-220449403 GAATCGCTAGATGTGATGATAGG - Intergenic
947502558 2:230682069-230682091 GAGTCAGAAAATGAGCTGCTTGG + Intergenic
1169534019 20:6517504-6517526 AATTCACTAATTGTGCTGTTAGG - Intergenic
1171302029 20:24071484-24071506 GAGTGAGTAAATGTGTTCATTGG + Intergenic
1175244991 20:57576795-57576817 GAGTCAGTTAATGAGCAGATTGG + Intergenic
1178779190 21:35584420-35584442 GACTTACTAAATGAGCTAATAGG + Intronic
1180295530 22:10930739-10930761 GAGTGACAAAATGTGGTGTTTGG + Intergenic
1180595986 22:16973714-16973736 GAGTGAGTGCATGTGCTGATGGG - Intronic
1184345853 22:43912255-43912277 GAGTCACTTAATGTTCTGCTTGG - Intergenic
950663849 3:14483007-14483029 GGGTCTCTAAAGGTTCTGATTGG + Intronic
953501340 3:43437749-43437771 GATTCTCTAACTGGGCTGATTGG + Intronic
955161006 3:56465774-56465796 GAGTTACTAAATTTGCCTATTGG + Intronic
963764029 3:149315190-149315212 GAGTCAAGAAAAGTGCTGCTTGG + Intergenic
965727703 3:171736587-171736609 GAGTCAGTACATGTGCAGGTAGG + Intronic
967458603 3:189719474-189719496 GAGGGACTAGATGTGTTGATTGG - Intronic
970243858 4:14038007-14038029 GGGTTACTAAATGTCCAGATAGG - Intergenic
972923299 4:43970420-43970442 GAGTGAATAAAGGAGCTGATGGG + Intergenic
976081608 4:81361158-81361180 GAGTCTCTAAGTGTACTGAGCGG + Intergenic
978587636 4:110291289-110291311 GAGGTAATAAATATGCTGATTGG + Intergenic
979358900 4:119738485-119738507 GAGTCACAAAATGCACTGTTGGG + Intergenic
987884380 5:23794664-23794686 GACTTACTAAATCTGCTCATGGG - Intergenic
990364439 5:55055391-55055413 ACGTCACTAAATGTGATGCTGGG + Intergenic
990825893 5:59897254-59897276 CAATCACTCAATGTGCTGCTGGG + Intronic
991527115 5:67572387-67572409 CAGCCACTAAATGTTTTGATTGG + Intergenic
992459852 5:76950692-76950714 GAGTCCCCAAGTATGCTGATTGG - Intergenic
993628726 5:90258151-90258173 GAGTTATTAAATGTCCTGCTTGG + Intergenic
994733908 5:103528158-103528180 TAGTCATTAAATGTGATCATAGG + Intergenic
994912045 5:105922790-105922812 GAGTCACTACATGACCTGTTTGG - Intergenic
995409817 5:111843720-111843742 GAATCTCTAAATGGGCTGACTGG - Intronic
998624819 5:143834565-143834587 TAGTAACTGAATGTACTGATGGG + Intergenic
998937064 5:147240525-147240547 GAGTCAGTAAATAAGCTGCTTGG - Intronic
1000239024 5:159392035-159392057 CAGTCACTAAAAGTTTTGATGGG - Intergenic
1001634475 5:173199822-173199844 GAGTAACTGAATTTCCTGATGGG + Intergenic
1002349472 5:178573459-178573481 GAGTCACTCAGTGTGCCAATGGG - Intronic
1002950285 6:1802936-1802958 AATGCACTAACTGTGCTGATCGG + Intronic
1005283936 6:24304153-24304175 GCGTCACTTAATGTGATGCTAGG - Intronic
1005489632 6:26335510-26335532 GAGTCACTGAATGTGAAGTTGGG + Intergenic
1008943530 6:57072639-57072661 GAGTCACTAACAGTATTGATGGG - Intergenic
1009517687 6:64640834-64640856 GAGACACTAAATGTGTTTAGTGG - Intronic
1009959727 6:70504091-70504113 GAGTAACAAACTGTGCTGGTGGG - Intronic
1011692626 6:89884220-89884242 AAGACACTAAATGTGCTGCATGG - Intergenic
1011859647 6:91738689-91738711 GAGTCACTAAATGTCATGAGTGG + Intergenic
1013743318 6:113315204-113315226 AATTCAATAAATGTGCTGAGTGG + Intergenic
1013913063 6:115301345-115301367 GAATCACTAAATGCACTGATTGG - Intergenic
1015386538 6:132631087-132631109 AAGTAATTAAATGTGTTGATTGG + Intergenic
1015955015 6:138589919-138589941 AAGACACTGAATGTGCTGACCGG + Intronic
1020411139 7:7892938-7892960 GAGTCACTAAATCTGTAGTTGGG + Intronic
1022315729 7:29243915-29243937 GAGGCACTGAATGTTCAGATCGG - Intronic
1023600289 7:41875722-41875744 CAGTCTCTAATGGTGCTGATTGG - Intergenic
1029589265 7:101496371-101496393 GCGTCACTAAATGAGGAGATGGG + Intronic
1029949595 7:104569001-104569023 GAATTAATAAATGTGGTGATTGG + Intronic
1030176163 7:106657333-106657355 GAGTGCCTAAATGTGGTGACCGG - Exonic
1033401472 7:141029332-141029354 GAGTCAATGAATGTGAAGATGGG - Intergenic
1036136951 8:6170907-6170929 CAGTCACTAAAGGTACTGAAAGG + Intergenic
1041184070 8:55280328-55280350 GATTCAGTAAATGTGCAAATGGG + Intronic
1043139987 8:76575920-76575942 GGGTCATGAAATGTGCTGAGTGG + Intergenic
1043960471 8:86412283-86412305 GAGTCACAAACCTTGCTGATTGG + Intronic
1047469329 8:125153097-125153119 GAGTGACTCAATGTCCTGAAGGG - Intronic
1048605721 8:135966764-135966786 GCTTTACTCAATGTGCTGATTGG - Intergenic
1050609276 9:7334580-7334602 GAGTGACTTAATGTGCAAATGGG + Intergenic
1050931445 9:11332223-11332245 GAATCATTAAATATGCTTATTGG + Intergenic
1052973753 9:34397581-34397603 GAGTCACTGTAGGTACTGATAGG + Exonic
1055773246 9:79739729-79739751 GCGTCACTGAATCTACTGATAGG + Intergenic
1058772856 9:108254742-108254764 GAGACACTAAATGAGATGACAGG - Intergenic
1188089043 X:25939572-25939594 GAGTGAGAAAATGTGGTGATTGG - Intergenic
1190949487 X:55129169-55129191 GAGTAACTATATGAGGTGATAGG + Intronic
1192161146 X:68788793-68788815 GAGTCACTGAATGAGGAGATGGG + Intergenic
1196016176 X:110943049-110943071 GAGTAATTATGTGTGCTGATTGG + Intergenic
1196538774 X:116880947-116880969 GACGCACTTAATGTGCTGAAGGG - Intergenic
1198282421 X:135155134-135155156 GTATCACTAAATGAGCTGAGAGG + Intergenic
1198288538 X:135217388-135217410 GTATCACTAAATGAGCTGAGAGG - Intergenic