ID: 907237326

View in Genome Browser
Species Human (GRCh38)
Location 1:53061661-53061683
Sequence TTTCCGGGAAGAGGCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907237314_907237326 21 Left 907237314 1:53061617-53061639 CCAACAGGGATGGGAGTGGAGGG 0: 1
1: 0
2: 2
3: 56
4: 444
Right 907237326 1:53061661-53061683 TTTCCGGGAAGAGGCCCAGCAGG 0: 1
1: 0
2: 2
3: 10
4: 166
907237310_907237326 28 Left 907237310 1:53061610-53061632 CCCAGGGCCAACAGGGATGGGAG 0: 1
1: 0
2: 1
3: 33
4: 275
Right 907237326 1:53061661-53061683 TTTCCGGGAAGAGGCCCAGCAGG 0: 1
1: 0
2: 2
3: 10
4: 166
907237311_907237326 27 Left 907237311 1:53061611-53061633 CCAGGGCCAACAGGGATGGGAGT 0: 1
1: 0
2: 0
3: 30
4: 334
Right 907237326 1:53061661-53061683 TTTCCGGGAAGAGGCCCAGCAGG 0: 1
1: 0
2: 2
3: 10
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907237326 Original CRISPR TTTCCGGGAAGAGGCCCAGC AGG Intergenic
901930513 1:12594037-12594059 TTTCCAGCAAGAGGTCCAGTGGG - Intronic
905404903 1:37726073-37726095 CTTCCGGGCAGAGGCTCTGCAGG - Intronic
907237326 1:53061661-53061683 TTTCCGGGAAGAGGCCCAGCAGG + Intergenic
909663034 1:78105085-78105107 TTTCAAGGTAGAGACCCAGCTGG + Intronic
911094341 1:94043405-94043427 GTCCCAGGAGGAGGCCCAGCTGG - Exonic
913332612 1:117680007-117680029 TTACTGGAAAGAGGCCAAGCTGG - Intergenic
914950393 1:152108902-152108924 ATTCCGTGAAGAGGAACAGCAGG - Exonic
915191542 1:154154855-154154877 TTTCCTGCTGGAGGCCCAGCGGG - Exonic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
915490552 1:156247921-156247943 TTTCCCAGAAGAGCCCCAGAAGG + Exonic
917257845 1:173134947-173134969 TTTCAAGGAAGTGGCACAGCCGG + Intergenic
919183246 1:194112470-194112492 TTTTCGAGGAGAGGGCCAGCTGG - Intergenic
920085048 1:203409219-203409241 TTGCCAGGCAGAGGCACAGCTGG + Intergenic
921254291 1:213325464-213325486 TTGCAGGGAATAGCCCCAGCAGG + Intergenic
922562281 1:226577972-226577994 TGTCAGGGAAGAGGCCGAGGGGG - Intronic
922959761 1:229636359-229636381 TGTCCGGGAGAAGGGCCAGCAGG - Exonic
923359837 1:233200214-233200236 TTTGCGGGAAGAGCCCAAGGAGG + Exonic
1064705280 10:18066561-18066583 CTACCAGGAACAGGCCCAGCAGG - Intergenic
1067208902 10:44242356-44242378 TTTCCTGGAAGAAGGACAGCTGG + Intergenic
1070675195 10:78407331-78407353 ATGCTGTGAAGAGGCCCAGCTGG - Intergenic
1071719861 10:88132079-88132101 CTTCTGGGAGGAGGCCCAGCTGG - Intergenic
1073469251 10:103712628-103712650 TTTCAGGGATGTGGCCCAGCAGG + Intronic
1074772135 10:116741633-116741655 GTTGCGGGAAGAGGACGAGCAGG - Intronic
1077487825 11:2847160-2847182 CCTCCTGGAAGTGGCCCAGCAGG + Intronic
1078083690 11:8221203-8221225 TTTCTGGGAGCAGGCCCAGGAGG + Intergenic
1078354925 11:10626234-10626256 TCCCAGGGGAGAGGCCCAGCTGG - Exonic
1081617820 11:44601033-44601055 CTTCCTGGAGGAGGCCGAGCAGG - Intronic
1083190342 11:61047328-61047350 TTTCTGGGAAGAGGCCCATTAGG - Intergenic
1089653246 11:119928859-119928881 TCTTCAGGAAGAGGCCAAGCAGG - Intergenic
1091400395 12:177554-177576 TGTCCAGGAAGCAGCCCAGCCGG + Exonic
1091700138 12:2653767-2653789 TCCCTGGGAAGGGGCCCAGCTGG + Intronic
1092162875 12:6325639-6325661 CTTCAGGGCAGAGGCCCAGGTGG + Intronic
1092170444 12:6370806-6370828 TTTCCTGGAAATGGCACAGCAGG - Intronic
1097468961 12:59964912-59964934 TTTCTAGAAAGAGGCACAGCTGG - Intergenic
1099477208 12:83122027-83122049 TTTCCAGGCAGTGGGCCAGCAGG + Intronic
1099477221 12:83122111-83122133 TTTCCAGGCAGTGGCCAAGCAGG + Intronic
1101725455 12:107384775-107384797 TTCCTGGGAAGAGACTCAGCAGG + Intronic
1101911493 12:108863360-108863382 TTTCCTGGAGGAGGCCCAAGAGG + Intronic
1107175274 13:37392521-37392543 GTTCAGGAAAGAGGCCCAGTTGG + Intergenic
1113091113 13:106618327-106618349 TTTCCAGGAAGGGACCCAGTGGG + Intergenic
1113994577 14:16055687-16055709 TTTCTTGGAAGCTGCCCAGCGGG - Intergenic
1118270654 14:64339207-64339229 TTGCAGGGGAGGGGCCCAGCGGG + Intergenic
1118603578 14:67487286-67487308 GTTCCGGGAAGGGGCCCTGGTGG - Intronic
1118806014 14:69237556-69237578 CTTCCTGGAACAAGCCCAGCCGG - Exonic
1123030085 14:105447481-105447503 TTTGCTGGAAGAGCCCCAGAAGG + Intronic
1126104591 15:45139208-45139230 CCTCTGGGAAGAGGCTCAGCTGG + Intronic
1127847310 15:62882102-62882124 TTCATAGGAAGAGGCCCAGCAGG - Intergenic
1128608495 15:69055955-69055977 TTTGCAGGAAGTGGCCCAGAAGG + Intronic
1131536565 15:93242185-93242207 ATTTGGGGAAGAGGCCCAGGAGG + Intergenic
1133741476 16:8655016-8655038 CTATTGGGAAGAGGCCCAGCAGG - Intergenic
1136455103 16:30375957-30375979 ATTCCAGGGAGAGGGCCAGCAGG - Intronic
1136913304 16:34161152-34161174 TTTCTTGGAAGCTGCCCAGCGGG - Intergenic
1140639965 16:76960189-76960211 CTTCCACGAAGAGGCCCTGCAGG - Intergenic
1141033199 16:80607257-80607279 AGTCAGGGATGAGGCCCAGCAGG + Intronic
1141798986 16:86294614-86294636 TCCCCGTGAGGAGGCCCAGCTGG + Intergenic
1141934678 16:87229389-87229411 TTGCTGGGAGGAGGCCCAGGGGG - Intronic
1142750982 17:1987374-1987396 TTTCCGGGAGGAGGGACAGATGG + Intronic
1143121174 17:4607935-4607957 TTTCCTGGCAGTGGCCCAGAGGG - Exonic
1146487868 17:33258773-33258795 CTTCCCAGAAGTGGCCCAGCTGG + Intronic
1147337864 17:39738115-39738137 TTACCTGGAGGAGCCCCAGCAGG - Intronic
1150060472 17:62065022-62065044 GTTCCCGGGCGAGGCCCAGCCGG - Intronic
1151063642 17:71125761-71125783 TTTCCGAGTAGGGGCCCAGTTGG - Intergenic
1152281023 17:79384953-79384975 TATCTGGGGAGAGGCCCAGAAGG + Intronic
1152317726 17:79590611-79590633 TTTCCTGGAGGAGCCCCAGCTGG - Intergenic
1152358711 17:79819884-79819906 TTGCCTGCAAGAGACCCAGCTGG + Intergenic
1152526364 17:80890321-80890343 TTCCCTGGAAGGGGCCCAGTGGG + Intronic
1152572996 17:81128630-81128652 TTTCCCAGAAAAGGCCAAGCGGG - Intronic
1152701660 17:81822696-81822718 ATTCAGGGAAGAGGCCAGGCTGG + Exonic
1155223231 18:23704216-23704238 TGTATGGGAAGAGACCCAGCTGG - Intronic
1160501298 18:79402205-79402227 TATCCGGGAAGACGCACAGGAGG + Intronic
1160701223 19:508360-508382 TTGCAGGGAAGAGGCCCAGCAGG + Intronic
1160705836 19:529852-529874 GTCCCCGGAAGAGGACCAGCAGG - Intergenic
1162561827 19:11421751-11421773 TTTCCTCCACGAGGCCCAGCAGG + Exonic
1162967649 19:14163640-14163662 TTTCCAGGGAGAGGGGCAGCTGG - Intronic
1163331473 19:16641144-16641166 TTTCTGGTAAGAGGCCAAACAGG + Intronic
1164733224 19:30521316-30521338 TTTCAGGGAAGGGGAGCAGCAGG - Intronic
1166116233 19:40656686-40656708 TTTCTGAGCAGTGGCCCAGCAGG - Intergenic
1167837227 19:52084117-52084139 CTGCCGGTAAGAGTCCCAGCAGG + Intronic
1168450535 19:56462982-56463004 ATTCCAGGTAGAGGCACAGCAGG + Intronic
925147608 2:1591593-1591615 TTTGCAGGAGGAAGCCCAGCCGG + Intergenic
931090080 2:58876319-58876341 ATGCCTGGAAGAGGCACAGCTGG - Intergenic
932299663 2:70657409-70657431 TCTCCGGGAAGAGGCCAGGTGGG - Exonic
933729020 2:85443317-85443339 TGTGCAGGCAGAGGCCCAGCTGG - Intergenic
934047725 2:88186221-88186243 TTTCCGGGAGGCTGCTCAGCTGG + Exonic
935149156 2:100417831-100417853 TTTCTGGATGGAGGCCCAGCGGG - Intergenic
935709135 2:105881827-105881849 TTTTGGGGACGAGGCCCACCTGG - Exonic
936962922 2:118095381-118095403 TCTCCAGTAAGAGGCCAAGCTGG - Intronic
937468975 2:122159049-122159071 TAGCAGGGAAGATGCCCAGCAGG + Intergenic
937469135 2:122160328-122160350 TGGCAGGGAAGATGCCCAGCAGG + Intergenic
938338369 2:130518772-130518794 TTGCCATCAAGAGGCCCAGCTGG - Intergenic
938351470 2:130601978-130602000 TTGCCATCAAGAGGCCCAGCTGG + Intergenic
938536894 2:132255065-132255087 TTTCTTGGAAGCTGCCCAGCGGG + Intronic
940762355 2:157751566-157751588 TTTCCAGGCAGTGGGCCAGCAGG - Intronic
940785024 2:157971872-157971894 TTTCCAGGCAGTGGGCCAGCAGG + Intronic
942444134 2:176067135-176067157 TTTCCGGGAACAGGGGCAGGCGG - Intergenic
942733517 2:179083894-179083916 TGTCCTGGAAGAGACCCAGTGGG - Intergenic
948789569 2:240370327-240370349 ATTCCGGGTAGAGGCCCAGCAGG - Intergenic
1170779263 20:19409233-19409255 TTCCCAGGAAGAGGCGCAGCAGG + Intronic
1171865795 20:30486842-30486864 TTTCTTGGAAGCTGCCCAGCGGG + Intergenic
1173897200 20:46560096-46560118 AGTCCGGGAAGGTGCCCAGCTGG + Exonic
1174569836 20:51493664-51493686 TCTCAGGGAATAGGCCCAGTGGG - Intronic
1176548214 21:8210753-8210775 TTTCCCGGAAGCTGCCCGGCGGG - Intergenic
1176556107 21:8254961-8254983 TTTCCCGGAAGCTGCCCGGCGGG - Intergenic
1176567145 21:8393788-8393810 TTTCCCGGAAGCTGCCCGGCGGG - Intergenic
1176575044 21:8437998-8438020 TTTCCCGGAAGCTGCCCGGCGGG - Intergenic
1180312514 22:11251717-11251739 TTTCTTGGAAGCTGCCCAGCGGG + Intergenic
1180342738 22:11630668-11630690 TTTCTTGGAAGCTGCCCAGCGGG - Intergenic
1180733415 22:17999075-17999097 CTTCTGGGAAGTGGCCCAGATGG - Intronic
1180935906 22:19625365-19625387 TTTCCGGGAACAGAGACAGCAGG + Intergenic
1181471942 22:23145888-23145910 TTTCAGGGAAAAGGCCTAGTTGG + Intronic
1181503885 22:23337895-23337917 TGTCAGGGAAGAAGTCCAGCTGG - Intergenic
1181654722 22:24287430-24287452 TGTCAGGGAAGAAGTCCAGCTGG - Intronic
1181708874 22:24668115-24668137 TGTCAGGGAAGAAGTCCAGCTGG - Intergenic
1182413922 22:30209036-30209058 TGGCCGGTAGGAGGCCCAGCTGG + Intergenic
1182443112 22:30375630-30375652 AATCCGGGAAGTGGCCCAGCAGG + Exonic
1183623385 22:38987410-38987432 TTTCAGGGAAGAGTCTCAGCAGG - Intronic
1183627688 22:39014606-39014628 TTTCGGGGGAGAGTCTCAGCAGG - Intronic
1183628984 22:39021762-39021784 TTTCAGGGAAGAGTCTCAGGAGG - Intronic
1183633625 22:39047736-39047758 TTTCGGGGGAGAGTCTCAGCAGG - Intronic
1183638232 22:39077607-39077629 TTTCAGGGGAGAGTCTCAGCAGG - Intronic
1185126957 22:49016717-49016739 TGTCCGGAAAGAGGCCGAGCAGG - Intergenic
1185208540 22:49553911-49553933 TGTCCGGAGAGAGGGCCAGCAGG + Intronic
1203253093 22_KI270733v1_random:127053-127075 TTTCCCGGAAGCTGCCCGGCGGG - Intergenic
1203261148 22_KI270733v1_random:172134-172156 TTTCCCGGAAGCTGCCCGGCGGG - Intergenic
953387289 3:42513817-42513839 GTGCCTGGAGGAGGCCCAGCTGG + Exonic
954407163 3:50351631-50351653 CTTCCGGGAACAGGCCTGGCTGG + Intronic
954529651 3:51307991-51308013 TTTCCAGGAAGCTGCCAAGCAGG + Intronic
955957305 3:64304027-64304049 TTTCCCGGCTGACGCCCAGCTGG + Intronic
961652849 3:128425917-128425939 TTTCCAGGCGGGGGCCCAGCAGG + Intergenic
965310127 3:167116561-167116583 GTTCAGGGAGGAGGCACAGCTGG - Intergenic
965510092 3:169558618-169558640 TTTCTGGGCTGAGGCCCAGATGG - Intronic
968232035 3:197009958-197009980 GTTCTGGGAGCAGGCCCAGCGGG + Intronic
969521183 4:7678575-7678597 TTTCCTGGAAGAGGCTGAGCAGG + Intronic
974805663 4:66877199-66877221 TTTCCAGGAAGTTGCCCATCTGG + Intergenic
976060662 4:81124581-81124603 GTCCCAGGAAGAGGCCCACCTGG + Intronic
985070678 4:186164338-186164360 CCGCCAGGAAGAGGCCCAGCCGG + Intronic
990562148 5:56993847-56993869 TATCCGGAAAGTGGCCCTGCAGG - Intergenic
994006608 5:94844892-94844914 TTTCCTGGAAGAAACCCAGTAGG + Intronic
997311837 5:132892336-132892358 TTTGAAGGAACAGGCCCAGCGGG + Exonic
997766203 5:136506190-136506212 CTTCCAGGAAGATGCCCAACAGG + Intergenic
999758584 5:154683082-154683104 TCTCCGGGAAAGGGCCCAGACGG - Intergenic
999860572 5:155641244-155641266 TTTCCAGGAAGAGGCCAGTCTGG - Intergenic
1002278693 5:178118714-178118736 TTTGCAGGAAGAGGGCCTGCAGG + Intronic
1002414345 5:179111590-179111612 CCTTTGGGAAGAGGCCCAGCTGG - Exonic
1002957536 6:1881784-1881806 TTTCCTGCAAGATGCACAGCAGG + Intronic
1004462187 6:15848010-15848032 ATGCCAGGAAGAGGCACAGCTGG + Intergenic
1006514109 6:34536568-34536590 TTTCCAGGCCCAGGCCCAGCTGG + Intergenic
1007626096 6:43247181-43247203 TTTGGGGAAAGAGGCCCTGCAGG + Intronic
1007721114 6:43886059-43886081 TCTTCGGGAGGAAGCCCAGCTGG - Intergenic
1018708176 6:166478055-166478077 TTTCCAGGGGGAGGCCAAGCAGG + Intronic
1019262537 7:89571-89593 TTCCTGGGCAGTGGCCCAGCTGG - Intergenic
1020279673 7:6643890-6643912 CTTCCTGGTAGAGGCCCCGCTGG - Exonic
1028962271 7:96762028-96762050 TTTCCAGGCAGTGGGCCAGCAGG + Intergenic
1030489268 7:110211610-110211632 CTTCAGGAAAGGGGCCCAGCAGG - Intergenic
1034889866 7:154830310-154830332 GTTCCAGGAAGAGGCAGAGCCGG + Intronic
1035438141 7:158874768-158874790 ATTCAGGGATGATGCCCAGCTGG - Intronic
1038348094 8:26750496-26750518 CTTACAGGAAGAGACCCAGCTGG - Intronic
1041208305 8:55521129-55521151 TTCCCGGGCAGAAACCCAGCTGG + Intronic
1042484180 8:69333424-69333446 TTTCCAGGCAGAGGTCGAGCTGG + Intergenic
1043909344 8:85842724-85842746 TTGCCTGGAAGTGGCCCTGCAGG + Intergenic
1046097207 8:109575922-109575944 TCACCGGGTAGAGGCCCAGTTGG - Exonic
1050327893 9:4515444-4515466 TATCCAGGTAGAGTCCCAGCAGG + Intronic
1052832676 9:33228840-33228862 TGTCTGGGAAGATGCCAAGCTGG + Intronic
1057690144 9:97276628-97276650 TATGCAGGAAGCGGCCCAGCAGG - Intergenic
1060875808 9:127082930-127082952 TACCCAGGAAGAGGCCCATCTGG + Intronic
1062255172 9:135617496-135617518 TTTCAGGGCAGAGGATCAGCCGG + Intergenic
1062306620 9:135910911-135910933 TTTCCATGAGGAGGCCCAACAGG - Intergenic
1062439785 9:136564518-136564540 CTTCCAGGAAGGGGCACAGCGGG + Intergenic
1062481946 9:136756641-136756663 ACTCCGGGAAGGAGCCCAGCAGG - Intronic
1203469495 Un_GL000220v1:110200-110222 TTTCCCGGAAGCTGCCCGGCGGG - Intergenic
1203477316 Un_GL000220v1:154172-154194 TTTCCCGGAAGCTGCCCGGCGGG - Intergenic
1203361015 Un_KI270442v1:219180-219202 TTTCTTGGAAGCTGCCCAGCGGG + Intergenic
1188524162 X:31071548-31071570 TCTCCAGGAAGTGGCACAGCTGG + Exonic
1189429494 X:40934329-40934351 ATTCCTGGAATAGGCCCAGAGGG - Intergenic
1189668294 X:43380952-43380974 TTTCCAGGCAGAGGGCGAGCAGG - Intergenic
1195046809 X:101061803-101061825 CTTCTGGGAAGAGTCACAGCTGG + Intergenic
1198614958 X:138446941-138446963 TATCCAGGAAGAGGCCAGGCAGG - Intergenic
1200258726 X:154600196-154600218 TTTCCCGTAAGAAGCCGAGCTGG + Intergenic
1201077432 Y:10198359-10198381 TTTCTGGGAAGCTGCCCAGCGGG - Intergenic