ID: 907239576

View in Genome Browser
Species Human (GRCh38)
Location 1:53074147-53074169
Sequence CTCCATCTGGCAGATGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907239576_907239583 0 Left 907239576 1:53074147-53074169 CCTGACACATCTGCCAGATGGAG No data
Right 907239583 1:53074170-53074192 CAGGGGTGAGCCAGGTGGTGAGG 0: 1
1: 3
2: 3
3: 60
4: 583
907239576_907239584 3 Left 907239576 1:53074147-53074169 CCTGACACATCTGCCAGATGGAG No data
Right 907239584 1:53074173-53074195 GGGTGAGCCAGGTGGTGAGGAGG 0: 1
1: 0
2: 6
3: 64
4: 621
907239576_907239582 -5 Left 907239576 1:53074147-53074169 CCTGACACATCTGCCAGATGGAG No data
Right 907239582 1:53074165-53074187 TGGAGCAGGGGTGAGCCAGGTGG 0: 1
1: 1
2: 9
3: 60
4: 551
907239576_907239581 -8 Left 907239576 1:53074147-53074169 CCTGACACATCTGCCAGATGGAG No data
Right 907239581 1:53074162-53074184 AGATGGAGCAGGGGTGAGCCAGG 0: 1
1: 1
2: 6
3: 138
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907239576 Original CRISPR CTCCATCTGGCAGATGTGTC AGG (reversed) Intronic
No off target data available for this crispr