ID: 907239700

View in Genome Browser
Species Human (GRCh38)
Location 1:53074660-53074682
Sequence CAAGCCCCTCACCTTGTTAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907239700_907239709 12 Left 907239700 1:53074660-53074682 CCAATAACAAGGTGAGGGGCTTG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 907239709 1:53074695-53074717 GGGTTGCTGCCCTGTCCTCTAGG 0: 1
1: 0
2: 2
3: 24
4: 252
907239700_907239708 -8 Left 907239700 1:53074660-53074682 CCAATAACAAGGTGAGGGGCTTG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 907239708 1:53074675-53074697 GGGGCTTGAGGCAGGGTGGGGGG 0: 1
1: 1
2: 4
3: 134
4: 1449
907239700_907239706 -10 Left 907239700 1:53074660-53074682 CCAATAACAAGGTGAGGGGCTTG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 907239706 1:53074673-53074695 GAGGGGCTTGAGGCAGGGTGGGG 0: 1
1: 1
2: 11
3: 116
4: 874
907239700_907239707 -9 Left 907239700 1:53074660-53074682 CCAATAACAAGGTGAGGGGCTTG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 907239707 1:53074674-53074696 AGGGGCTTGAGGCAGGGTGGGGG 0: 1
1: 1
2: 10
3: 116
4: 933

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907239700 Original CRISPR CAAGCCCCTCACCTTGTTAT TGG (reversed) Exonic
903179371 1:21597656-21597678 CCAGCCCCTCAGCTTGTGTTTGG - Intronic
906494735 1:46296551-46296573 CTACCCCATCACCTAGTTATGGG + Intronic
906669346 1:47643327-47643349 CAAGCCTCTCCCCTTGGTATAGG - Intergenic
907239700 1:53074660-53074682 CAAGCCCCTCACCTTGTTATTGG - Exonic
907351044 1:53830996-53831018 CAATCTCCTCACCTCGTGATCGG - Intronic
907359053 1:53900088-53900110 GAAGCCCCTCTCCTTGTCCTTGG - Intronic
908843100 1:68298157-68298179 CAAGCCCCTCACTATGGTCTAGG - Intergenic
912411889 1:109485367-109485389 CAAGTCCCTCCCCTTCTTAGAGG - Intronic
914737611 1:150432970-150432992 CAACCCCCTCACCTTGAGACAGG - Intronic
917454296 1:175172606-175172628 CAAACCCCACACCATGTTAGTGG - Intronic
919624573 1:199898726-199898748 CAAGCACCTCACCATCTTAAGGG - Intergenic
920134644 1:203759675-203759697 CAATCCACCCACTTTGTTATTGG - Intergenic
920502178 1:206492380-206492402 GTAGGACCTCACCTTGTTATGGG + Exonic
923446374 1:234075321-234075343 CAAGCCCTTCACCTCATTATGGG + Intronic
924497906 1:244607888-244607910 CAAACTCCTGACCTTGTGATCGG - Intronic
1066484360 10:35828934-35828956 CAAGCCCAAAACCTTTTTATGGG - Intergenic
1069419592 10:68235050-68235072 CAAGCCCCTCATTTTGCAATGGG + Intergenic
1071957435 10:90774648-90774670 CAAGTCCCTCACCGTGTCATTGG - Intronic
1077735859 11:4790116-4790138 CAATCTCCTGACCTTGTGATCGG - Intronic
1077739882 11:4834069-4834091 CAGGCCCCTCACGTTTTTCTGGG + Intronic
1078493688 11:11794841-11794863 CATGCCCCTCACCTTGCTTCTGG - Intergenic
1078991801 11:16655228-16655250 CCAGCCCCTCCCCAAGTTATAGG - Intronic
1081005234 11:37728131-37728153 CTAGCCCCTCACCTCGTGACAGG + Intergenic
1081913522 11:46716610-46716632 CGAACTCCTCACCTTGTGATCGG + Intergenic
1083128495 11:60598268-60598290 CAAGCCCTTCATATTGTCATTGG + Intergenic
1083841947 11:65309639-65309661 CAATCTCCTCACCTCGTGATCGG + Intergenic
1084537922 11:69768734-69768756 CCAGCCCCACACCTTCTCATGGG + Intergenic
1087472690 11:98597330-98597352 CAAGCCCCTAGCCTCGTTACTGG - Intergenic
1092072192 12:5640372-5640394 CATGCTCCACACCTTGTTCTAGG + Intronic
1096984984 12:55750298-55750320 CAAGCCCCTCACCTTGCCAGTGG - Exonic
1098029423 12:66238928-66238950 AAAGACCCTCACATTTTTATTGG + Intronic
1103495720 12:121360817-121360839 CAATCTCCTGACCTTGTGATCGG + Intronic
1104746580 12:131214793-131214815 CAATCTCCTGACCTTGTGATCGG + Intergenic
1111901205 13:94201725-94201747 CAAACTCCTGACCTTGTGATCGG - Intronic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1115882862 14:37939687-37939709 CCAGCCCCTCAGGCTGTTATGGG - Intronic
1120951507 14:90046063-90046085 TAAGCCCCTCACCTTGGCAAGGG - Intergenic
1121161489 14:91745364-91745386 CAAGCGCCTCAGCTGGTTGTAGG - Intronic
1122172574 14:99889218-99889240 CAAGCCCCACACCAGGTTCTTGG + Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1124185651 15:27526161-27526183 CAAGCCCTCCACCTTGCTCTGGG - Intronic
1124905140 15:33861384-33861406 CCAGCCCCTCAACCTGTGATTGG + Intronic
1127935176 15:63630336-63630358 CAAGCACATCACTTTGCTATGGG - Intronic
1131163856 15:90128235-90128257 CAAACTCCTGACCTTGTGATCGG + Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1134915108 16:18062746-18062768 CAGCTCCCTCACCTTGTAATGGG + Intergenic
1135333062 16:21576974-21576996 CAAACTCCTGACCTTGTGATAGG - Intergenic
1136046012 16:27615575-27615597 CAATCTCCTGACCTTGTGATCGG + Intronic
1140124248 16:72106945-72106967 CAAACTCCTGACCTTGTGATCGG - Intronic
1143858577 17:9871247-9871269 CAAGCCCCTCACCTTAGCCTGGG - Intronic
1147850021 17:43435227-43435249 CAAGCCACGCACCTTGGCATGGG + Intergenic
1151269885 17:72986003-72986025 CAAGCCCCTCTCCTAGCTTTTGG - Intronic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1159262053 18:66026859-66026881 CAAGCACCTCAGCTGGTTATGGG + Intergenic
1159861368 18:73653142-73653164 CTAGACCCTCACCTTGGAATAGG - Intergenic
1164201233 19:23020541-23020563 CAAACTCATCACCTTGTTACTGG + Intergenic
1164517408 19:28948109-28948131 CAAGCCTCTCACGCTGTCATGGG + Intergenic
1166640519 19:44491219-44491241 CAAGCCCCTCCCTTGGTTAGAGG + Intronic
1166891357 19:45995640-45995662 CAAGCGCCTACCCTTGTTAAAGG - Intronic
929170973 2:38933232-38933254 CAAGCTTATCACCTGGTTATTGG + Intronic
932144090 2:69304038-69304060 CAAGCCCTTCATGTGGTTATTGG + Intergenic
932823933 2:74923477-74923499 CAAACTCCTGACCTTGTGATCGG + Intergenic
937921205 2:127132927-127132949 CAAGCCCTTCACTCTGTCATGGG - Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
940957645 2:159746384-159746406 CAAGACCCACACTTTGTTTTTGG + Intronic
944088949 2:195883222-195883244 CAATCTCCTGACCTTGTGATCGG - Intronic
944218269 2:197277148-197277170 CAATCTCCTGACCTTGTGATTGG + Intronic
946478370 2:220030563-220030585 CAAGCCCCTTATCTTTCTATAGG - Intergenic
947127163 2:226881602-226881624 CCAGCACTTCACCTTGTTCTGGG - Intronic
1169570364 20:6899233-6899255 AAAGCCCCTCACCTTTTTTCAGG - Intergenic
1171415157 20:24973366-24973388 CTCGCCCCTCACCATTTTATTGG - Intronic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1179567043 21:42255753-42255775 CAAGCCCCTCACCTGTTTAGAGG + Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1182511684 22:30824585-30824607 CTAGCCCCTGACATCGTTATGGG + Intronic
1185220410 22:49626661-49626683 CAAGCCCCTCCCCTCCTTAGAGG - Intronic
950409511 3:12826148-12826170 CAGGCTCCTCACCTTATGATGGG + Intronic
950645635 3:14374926-14374948 CTAGACCCTCACCTGGCTATAGG - Intergenic
954146383 3:48636288-48636310 CTGGCCCCTCACTTTGTAATTGG - Intergenic
954334604 3:49909010-49909032 CACGCCCCTCACCTATTGATGGG - Exonic
954439372 3:50513307-50513329 CAAGCCCCTAAGCCTGTTCTTGG + Intergenic
957460621 3:80514350-80514372 CAAGCCCCTCACTTTTATAAGGG - Intergenic
957777047 3:84766992-84767014 CAAGCCCCCCACCTCCTGATAGG - Intergenic
961783038 3:129332528-129332550 TAAGCCCCTCACTTAGTTCTGGG - Intergenic
963106750 3:141653944-141653966 TAAGCCCCTCCCCTGTTTATGGG - Intergenic
963868323 3:150386385-150386407 CAAACTCCTGACCTTGTGATCGG - Intergenic
965415934 3:168392153-168392175 GAAGCTCCTCAACTTGTTACAGG + Intergenic
969958947 4:10922949-10922971 CAAGCCCATCCCCCTGTTGTGGG + Intergenic
971655808 4:29342843-29342865 CGATCCCCTGACCTTGTGATCGG - Intergenic
977206337 4:94168812-94168834 CAATCTCCTGACCTTGTGATCGG - Intergenic
977595778 4:98877954-98877976 AAATCACCTCAGCTTGTTATAGG - Intronic
982226332 4:153170775-153170797 CAAGCCCTTCACCCTGTTGAGGG + Intronic
982415871 4:155131212-155131234 AAAGCCCATAACCTTGTTAAGGG + Intergenic
982944638 4:161604703-161604725 GAAGCCACTCATCGTGTTATTGG + Intronic
983247661 4:165307084-165307106 CAAGCTTCTGACCTTGTGATCGG - Intronic
984710521 4:182880456-182880478 CAAGCCCGGCACCTTGGCATTGG - Intergenic
986234360 5:5893519-5893541 CAAGCCCCTCACCTGGAGAATGG - Intergenic
988329583 5:29818179-29818201 CAACTCCCTCACCTAGTTCTGGG + Intergenic
991649345 5:68836251-68836273 CAGTCCCCTCACCTTATTTTTGG - Intergenic
993043513 5:82841878-82841900 CCAGCCCCCCACCTTATTACAGG + Intergenic
996741882 5:126806998-126807020 CAATCTCCTGACCTTGTGATTGG + Intronic
998237832 5:140415158-140415180 CAAACTCCTGACCTTGTGATCGG - Intronic
999120238 5:149204068-149204090 CAAGCTCCGTACCTTGTTTTAGG - Intronic
1000260891 5:159587583-159587605 CAATCTCCTGACCTTGTGATCGG + Intergenic
1000623735 5:163514956-163514978 AAAGACCCTCACCTTGATCTTGG - Intronic
1003857853 6:10293998-10294020 CAATCTCCTGACCTTGTGATTGG - Intergenic
1005764669 6:28999205-28999227 CAAGCCTCTCATTTTTTTATGGG - Intronic
1005859495 6:29889582-29889604 CGAGCCCCTCACCCTGAGATGGG + Intergenic
1005864640 6:29928306-29928328 CAAGCCCCTCACCCTGAGATGGG + Intergenic
1005867059 6:29944375-29944397 CAAGCCCCTCACCCTGAGATGGG + Exonic
1005875726 6:30008440-30008462 CAAGCCCCTCATCCTGAGATGGG + Intergenic
1006052478 6:31355317-31355339 GAAGCCCCTCACCCTGAGATGGG - Exonic
1006151747 6:31993612-31993634 CCAGCCCCTCACCTCGTTGGAGG - Exonic
1006158048 6:32026350-32026372 CCAGCCCCTCACCTCGTTGGAGG - Exonic
1009574493 6:65434541-65434563 CGATCTCCTCACCTTGTGATCGG + Intronic
1016924402 6:149328513-149328535 CAATCTCCTGACCTTGTGATTGG + Intronic
1018796359 6:167188250-167188272 CAAACTCCTCACCTTGTGATCGG - Intronic
1018819959 6:167366809-167366831 CAAACTCCTCACCTTGTGATCGG + Intronic
1018998354 6:168727073-168727095 CAATCTCCTGACCTTGTGATCGG + Intergenic
1021620106 7:22542817-22542839 CAAGCCCAACACCTGGTTCTCGG + Intronic
1025762179 7:64405149-64405171 CAAGCCCCCCACCTTGTGCAAGG - Intergenic
1026234492 7:68514429-68514451 CAAACTCCTGACCTTGTGATCGG + Intergenic
1027511665 7:79089836-79089858 CTAGCCCCTCACCTTCTGACAGG - Intronic
1027740732 7:82000850-82000872 CAAACTCCTGACCTTGTGATCGG + Intronic
1032908482 7:136401549-136401571 CAACCAAATCACCTTGTTATGGG + Intergenic
1036162676 8:6404463-6404485 CAATCTCCTGACCTTGTGATCGG + Intergenic
1037931353 8:22882236-22882258 CAAGGCCCACAGCCTGTTATTGG + Intronic
1038588601 8:28813980-28814002 CAATCTCCTGACCTTGTGATAGG + Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1042688626 8:71470549-71470571 CAAGCACCTCACCTTCTATTAGG - Intronic
1044200596 8:89430659-89430681 CTAGCCCCCCACCTTGTGACAGG - Intergenic
1045171055 8:99668689-99668711 CAAGCCACTGACCTTGCTAATGG - Intronic
1047335427 8:123931205-123931227 CAAGACCCTGCCCTGGTTATTGG - Intronic
1049677207 8:143895868-143895890 CAAACCCCACACCTTTTAATAGG + Intergenic
1050097177 9:2078719-2078741 CAATCTCCTGACCTTGTGATCGG - Intronic
1055429298 9:76227595-76227617 GAAGCCACTTACCTTGTCATGGG - Exonic
1060558917 9:124526767-124526789 CCAGCCACTCACCTTGATTTAGG + Exonic
1062078421 9:134605145-134605167 CAATCTCCTGACCTTGTGATCGG - Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1190637980 X:52455233-52455255 CATGCCTCCCACCTTGTCATGGG - Intergenic
1190678674 X:52805227-52805249 CATGCCTCCCACCTTGTCATGGG + Intergenic
1195896538 X:109751096-109751118 CAAACTCCTGACCTTGTGATCGG + Intergenic
1196056623 X:111363136-111363158 AAAGACCATCACCTTGTTAATGG + Intronic
1199199612 X:145071661-145071683 CAATCTCCTGACCTTGTGATAGG + Intergenic
1200310514 X:155072096-155072118 CAAGCCCCGCACCTTCTGTTAGG - Intronic
1200788137 Y:7276436-7276458 CAAGCCCCTTTCTTTGTTGTTGG + Intergenic