ID: 907240255

View in Genome Browser
Species Human (GRCh38)
Location 1:53077324-53077346
Sequence CTTGAGGTGCAGCTTGTACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 99}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907240255_907240264 -8 Left 907240255 1:53077324-53077346 CCCTGTACAAGCTGCACCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 99
Right 907240264 1:53077339-53077361 ACCTCAAGGTGGGCAGGGGAGGG 0: 1
1: 0
2: 2
3: 46
4: 413
907240255_907240269 2 Left 907240255 1:53077324-53077346 CCCTGTACAAGCTGCACCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 99
Right 907240269 1:53077349-53077371 GGGCAGGGGAGGGGTAAGGAGGG 0: 1
1: 3
2: 85
3: 905
4: 6107
907240255_907240266 -7 Left 907240255 1:53077324-53077346 CCCTGTACAAGCTGCACCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 99
Right 907240266 1:53077340-53077362 CCTCAAGGTGGGCAGGGGAGGGG 0: 1
1: 0
2: 7
3: 46
4: 542
907240255_907240270 3 Left 907240255 1:53077324-53077346 CCCTGTACAAGCTGCACCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 99
Right 907240270 1:53077350-53077372 GGCAGGGGAGGGGTAAGGAGGGG 0: 1
1: 2
2: 75
3: 859
4: 5755
907240255_907240272 26 Left 907240255 1:53077324-53077346 CCCTGTACAAGCTGCACCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 99
Right 907240272 1:53077373-53077395 CACAGCAGACCCCACAGCCAGGG 0: 1
1: 0
2: 7
3: 51
4: 552
907240255_907240263 -9 Left 907240255 1:53077324-53077346 CCCTGTACAAGCTGCACCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 99
Right 907240263 1:53077338-53077360 CACCTCAAGGTGGGCAGGGGAGG 0: 1
1: 0
2: 1
3: 30
4: 352
907240255_907240271 25 Left 907240255 1:53077324-53077346 CCCTGTACAAGCTGCACCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 99
Right 907240271 1:53077372-53077394 GCACAGCAGACCCCACAGCCAGG 0: 1
1: 0
2: 3
3: 47
4: 365
907240255_907240267 -2 Left 907240255 1:53077324-53077346 CCCTGTACAAGCTGCACCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 99
Right 907240267 1:53077345-53077367 AGGTGGGCAGGGGAGGGGTAAGG 0: 1
1: 0
2: 21
3: 253
4: 2538
907240255_907240268 1 Left 907240255 1:53077324-53077346 CCCTGTACAAGCTGCACCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 99
Right 907240268 1:53077348-53077370 TGGGCAGGGGAGGGGTAAGGAGG 0: 1
1: 2
2: 10
3: 246
4: 2083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907240255 Original CRISPR CTTGAGGTGCAGCTTGTACA GGG (reversed) Exonic
905150834 1:35926058-35926080 CTTGAAGAGCAGATTGGACATGG + Exonic
905457845 1:38100697-38100719 CTTGGGGTGCCACTTGGACAGGG + Intergenic
906527896 1:46507066-46507088 CTGCTGGTGCAGGTTGTACATGG - Exonic
906719567 1:47995853-47995875 CTGGAGGTGCACCTTGCCCAAGG + Intronic
907229426 1:52982135-52982157 CTTGTGATACAGCTTGTGCATGG + Intronic
907240255 1:53077324-53077346 CTTGAGGTGCAGCTTGTACAGGG - Exonic
919768002 1:201139654-201139676 CCTGAGGGGCAGCGTGCACAAGG - Intronic
923485816 1:234430079-234430101 CTTGGAGTGCAGCAGGTACAGGG - Exonic
1063328821 10:5134592-5134614 CTAGAGGTGAAAGTTGTACATGG + Intronic
1069537511 10:69265797-69265819 CTGAGGGTGCAGCTTGTACAGGG - Exonic
1069612876 10:69786930-69786952 CTTCAGGTGCAGCTTGTTCCAGG + Intergenic
1072187787 10:93059118-93059140 CTTCAGGTGCAGCTTGTGCGAGG + Exonic
1075427454 10:122352913-122352935 AATGAGGTGAAGCTTGTGCATGG + Intergenic
1076572885 10:131444121-131444143 CTTGGGTTGCGGGTTGTACAGGG - Intergenic
1076775281 10:132692307-132692329 CAACAGGTGCAGCTTGTAAAGGG + Intronic
1089684337 11:120137432-120137454 CTTGAGATGCAGCTCGCAGAAGG + Exonic
1091970087 12:4779660-4779682 CTGGAGGTGCAGCTGCCACAGGG + Intronic
1092129134 12:6096299-6096321 CTTGAGCTGCATCTTGAAGAAGG - Intronic
1095115610 12:38348388-38348410 CTTGAGTTGCTTTTTGTACAAGG - Intergenic
1099016569 12:77350335-77350357 CTTAAGCTGCAGGTTGTATAAGG + Intergenic
1101430893 12:104626161-104626183 CTTGAGGTTCACATTGTAAAAGG - Intronic
1102553650 12:113711370-113711392 CTTCAGGTGCAGCTGGACCAAGG - Intergenic
1102878444 12:116466036-116466058 CTTCAGATGCAGCTTGTCCAAGG - Intergenic
1106837818 13:33654926-33654948 CATGAGGTGCGGCTTGTCAATGG - Intergenic
1107671019 13:42746334-42746356 CTGAGGGTGCAGCTTCTACAGGG - Intergenic
1108899947 13:55390009-55390031 CTTGAGGTAGTGCTTGTAAATGG + Intergenic
1112806433 13:103168101-103168123 CTTGATGTGCTGCTTCTGCAGGG + Intergenic
1113316983 13:109191273-109191295 ATTGAGGTTCTGCTTGTACTAGG + Intronic
1113800722 13:113085156-113085178 CTTGAGCAGCAGCTGGTACTTGG - Exonic
1118744051 14:68761461-68761483 GCTGAGCTGCAGCTTGTCCAGGG - Intergenic
1119648430 14:76365948-76365970 CTTGAGGTGTACCATGTGCAGGG - Intronic
1121590591 14:95103990-95104012 CTTGATGTGCAGCATTTTCAGGG + Exonic
1124892287 15:33744514-33744536 ATTGTGGGGCAGCTTGTTCAGGG + Intronic
1127262590 15:57337113-57337135 CTGGAGGAGCAGCATGAACATGG + Intergenic
1128241080 15:66101366-66101388 CTGGAGATGCAGGTTGTAGATGG - Intronic
1128749145 15:70136241-70136263 ATTGAGGTGATGCTTCTACAAGG + Intergenic
1133897929 16:9946897-9946919 CTTCAGGTGTGGCTTGAACAAGG - Intronic
1136428498 16:30184222-30184244 CTTGAGGAGCAGCCTGTATCTGG - Intronic
1140520741 16:75579310-75579332 CTTGAGGTGTAGCTAGAACCAGG + Intergenic
1143673094 17:8410378-8410400 CTTGAGCTGCAGCTTTGAGAGGG + Intergenic
1147591028 17:41683447-41683469 CTTGATCTGCAGCCTGCACAGGG - Intergenic
1147716898 17:42514576-42514598 CCTGAGGTGAAGCTAGTGCAGGG - Intronic
1152777103 17:82208960-82208982 CTTGAGCTGTAGCTTTTAGATGG - Intronic
1153522922 18:5968972-5968994 CTTGAGGTGCAGGATGTCCTGGG + Intronic
1158101702 18:53836623-53836645 CTTGAGTTGATTCTTGTACATGG - Intergenic
1158642031 18:59212206-59212228 CTGGAGTGGCAACTTGTACATGG - Intergenic
1158671590 18:59479189-59479211 CATGAGGTTAAGCTTGTTCAGGG - Intronic
1160157273 18:76443163-76443185 CAGGAGGTGCACCTTCTACATGG + Exonic
927099390 2:19776332-19776354 CCTAATGTGCAGCTTGTACTTGG - Intergenic
931899592 2:66772782-66772804 CTTGAGGTTCAGCCTCTGCAGGG - Intergenic
933814600 2:86055549-86055571 GTTGAGGTGCAGCTTGAAGTAGG - Intronic
937379424 2:121363109-121363131 CATGAGGAGCAGTTTGGACATGG - Intronic
938494838 2:131789677-131789699 CTTGATTTGCAGCTCATACAGGG + Intergenic
941629552 2:167868902-167868924 CGTGAGGTGGAGATTGTCCATGG - Intergenic
943181922 2:184555684-184555706 CTTTAGGTGAAGCCTCTACAGGG - Intergenic
946430625 2:219625384-219625406 CTTGGTGTGCAGGATGTACATGG + Intergenic
948814647 2:240503609-240503631 CCTGAGGTGGAGCTTGTTCAGGG - Intronic
1172020238 20:31908759-31908781 CATGAGCTGGAGCTGGTACAAGG + Intronic
1174490718 20:50892883-50892905 CTTGAGGTGAACTTTTTACAGGG + Exonic
1175272395 20:57743638-57743660 CTTGAATTGTAGCTTTTACAAGG - Intergenic
1181061592 22:20284499-20284521 TTTCAGGTGCTGCTTGTCCAGGG + Intergenic
1183331614 22:37225230-37225252 TTTCAGGTGCAGCTTGATCAAGG - Intergenic
1183584766 22:38746541-38746563 CTTGAAGTCCAGCATGGACATGG + Intronic
1183724736 22:39582207-39582229 CCTGAGGTCAAGCTTGTACTTGG - Intronic
950006342 3:9693898-9693920 CTTCAGGTGCAGCCTGATCAAGG + Intronic
951452796 3:22858372-22858394 TTTGATGTGCAGGTTGTAGATGG - Intergenic
953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG + Intronic
955008506 3:54992098-54992120 CTTGGGCTGCAGCTTGAACTTGG - Intronic
956673006 3:71708860-71708882 CTTGAGGTGCTGTCTGTACTTGG + Intronic
963297090 3:143558103-143558125 CTTTAGCTCCAGCTTTTACATGG + Intronic
967233075 3:187359256-187359278 CTTGAGGTGAAGCTGGAAGAGGG - Intergenic
968440391 4:621056-621078 GTTGAGGTGCAGCTTGGAGGGGG - Intergenic
969310257 4:6348808-6348830 CTTCAGGTGCAGCTTGATCCAGG - Intronic
971012860 4:22458329-22458351 CTGGAGGTGCAGCCTGTTTACGG + Intronic
971211840 4:24625201-24625223 CTAGAGGTGCAGGTTATGCAGGG - Intergenic
971294426 4:25376613-25376635 TTTGGGGTGCTGCTTGGACAGGG + Intergenic
973624411 4:52757047-52757069 CTTGGAGTGCAAGTTGTACAAGG + Intergenic
975857843 4:78643275-78643297 CTTGAGATGCAGCTTTCTCAGGG + Intergenic
975939487 4:79625271-79625293 CATGAGGAGCAGCTTGAATATGG + Intergenic
977891943 4:102322286-102322308 CTTTAGGTACAGCTTATCCAGGG - Intronic
983123170 4:163914156-163914178 CTTGAAGTGTACTTTGTACAAGG - Intronic
990701741 5:58481855-58481877 AGTGAGGGGCAGCTTATACAGGG + Intergenic
1000242826 5:159424484-159424506 CTTGAGTGGCATCTTGCACAGGG - Intergenic
1005134995 6:22557750-22557772 CCTGAGCTCCAGCTTCTACATGG + Intergenic
1009653500 6:66508271-66508293 ACTGAGTTGCAGCTTATACAGGG - Intergenic
1010337040 6:74698459-74698481 CTTAATGTTCAGCTTGGACATGG - Intergenic
1023108324 7:36785213-36785235 CTTGAGGAACAGCAAGTACAGGG - Intergenic
1023850067 7:44145496-44145518 CCTGGGGTGCAGCTTGTACACGG + Exonic
1028830576 7:95323112-95323134 CTTGAGATTCTGCCTGTACAGGG + Intronic
1029105461 7:98171647-98171669 CAGGAAGTGCAGCTTGTGCATGG - Exonic
1030018128 7:105244803-105244825 CTTGGCGTGCTGCTTGTACGGGG - Intronic
1033238750 7:139659485-139659507 CTGCAGCTGCAGCTTGTGCACGG + Intronic
1033824344 7:145171198-145171220 CTTGAGATGCAGTCTGTACCTGG + Intergenic
1034480978 7:151320453-151320475 CTTGAGGTGGAGCTGGCCCAGGG + Intergenic
1043744666 8:83859120-83859142 CTTTAGATGCAACTTGAACAAGG - Intergenic
1048603421 8:135943075-135943097 CTTGAGCAGCAGTTTGTACCAGG - Intergenic
1048921091 8:139230825-139230847 CTTCAGGTGCAGATTGTTCAGGG - Intergenic
1050333786 9:4571335-4571357 CATGTGGTGCAGGATGTACAGGG - Intronic
1052389427 9:27861622-27861644 CTTGAGTTACATCTTCTACAAGG - Intergenic
1052977105 9:34419377-34419399 CTTGAGGTGCCCCTTAGACAGGG + Intronic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1057177414 9:93010310-93010332 CTTGAGCAGCAGCTCGTACCGGG - Exonic
1058110718 9:101028779-101028801 CTGGCGCTGCAGCTTGCACAGGG - Exonic
1061049544 9:128186290-128186312 GTGGAGGTGCAGCTTGCCCAGGG + Intronic
1187004806 X:15221916-15221938 GTTAAGGTACAGCTTCTACAAGG + Intergenic
1195201789 X:102558193-102558215 CTTTATGTACAGCTTGCACAGGG + Intergenic
1196087140 X:111695759-111695781 CTTGAGGAGGAGGTTGAACAGGG + Intronic