ID: 907240256

View in Genome Browser
Species Human (GRCh38)
Location 1:53077325-53077347
Sequence CCTTGAGGTGCAGCTTGTAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 110}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907240256_907240269 1 Left 907240256 1:53077325-53077347 CCTGTACAAGCTGCACCTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 110
Right 907240269 1:53077349-53077371 GGGCAGGGGAGGGGTAAGGAGGG 0: 1
1: 3
2: 85
3: 905
4: 6107
907240256_907240264 -9 Left 907240256 1:53077325-53077347 CCTGTACAAGCTGCACCTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 110
Right 907240264 1:53077339-53077361 ACCTCAAGGTGGGCAGGGGAGGG 0: 1
1: 0
2: 2
3: 46
4: 413
907240256_907240272 25 Left 907240256 1:53077325-53077347 CCTGTACAAGCTGCACCTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 110
Right 907240272 1:53077373-53077395 CACAGCAGACCCCACAGCCAGGG 0: 1
1: 0
2: 7
3: 51
4: 552
907240256_907240266 -8 Left 907240256 1:53077325-53077347 CCTGTACAAGCTGCACCTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 110
Right 907240266 1:53077340-53077362 CCTCAAGGTGGGCAGGGGAGGGG 0: 1
1: 0
2: 7
3: 46
4: 542
907240256_907240270 2 Left 907240256 1:53077325-53077347 CCTGTACAAGCTGCACCTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 110
Right 907240270 1:53077350-53077372 GGCAGGGGAGGGGTAAGGAGGGG 0: 1
1: 2
2: 75
3: 859
4: 5755
907240256_907240268 0 Left 907240256 1:53077325-53077347 CCTGTACAAGCTGCACCTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 110
Right 907240268 1:53077348-53077370 TGGGCAGGGGAGGGGTAAGGAGG 0: 1
1: 2
2: 10
3: 246
4: 2083
907240256_907240271 24 Left 907240256 1:53077325-53077347 CCTGTACAAGCTGCACCTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 110
Right 907240271 1:53077372-53077394 GCACAGCAGACCCCACAGCCAGG 0: 1
1: 0
2: 3
3: 47
4: 365
907240256_907240263 -10 Left 907240256 1:53077325-53077347 CCTGTACAAGCTGCACCTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 110
Right 907240263 1:53077338-53077360 CACCTCAAGGTGGGCAGGGGAGG 0: 1
1: 0
2: 1
3: 30
4: 352
907240256_907240267 -3 Left 907240256 1:53077325-53077347 CCTGTACAAGCTGCACCTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 110
Right 907240267 1:53077345-53077367 AGGTGGGCAGGGGAGGGGTAAGG 0: 1
1: 0
2: 21
3: 253
4: 2538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907240256 Original CRISPR CCTTGAGGTGCAGCTTGTAC AGG (reversed) Exonic
900496555 1:2978543-2978565 CCTTGGGGCCCAGCTTGTTCAGG - Intergenic
900958461 1:5903711-5903733 CCTTGAGGTGCAGTTTGTATAGG - Intronic
902974004 1:20075611-20075633 CCATGGTGTGCAGCTTGTATTGG + Intronic
903193970 1:21671381-21671403 CCTTCAAGGGCAGCATGTACTGG + Intergenic
903265025 1:22153110-22153132 CCTTGAGTTGCAGCTTTTTCAGG - Intergenic
903838656 1:26222639-26222661 TCTGGAGGTGCAGCTTCTGCAGG + Intergenic
904927319 1:34059245-34059267 CCTTGGGGTGTAGCTTTTGCTGG - Intronic
905457844 1:38100696-38100718 CCTTGGGGTGCCACTTGGACAGG + Intergenic
906827470 1:48996995-48997017 CCCTGAGGTGGAGGTTGTAGTGG - Intronic
907240256 1:53077325-53077347 CCTTGAGGTGCAGCTTGTACAGG - Exonic
907445955 1:54507838-54507860 CCCTGAGGTGCACCCTCTACAGG + Intergenic
911670413 1:100601506-100601528 CCTTCAGGAGCAGGTTGTTCAGG + Intergenic
919453877 1:197800933-197800955 CCCTGAGGTGGAGCTGGTCCTGG + Intergenic
920354091 1:205357340-205357362 CCCTGAGGTTCAGCTTGACCTGG - Intergenic
920861113 1:209707731-209707753 GCTGGAGGTACAGCTTGTCCTGG + Intronic
923485817 1:234430080-234430102 CCTTGGAGTGCAGCAGGTACAGG - Exonic
1065046861 10:21753232-21753254 CCCTGAGGTGCAGTGGGTACCGG - Intergenic
1066994664 10:42552670-42552692 ACTGGAGGTGCCGCTTGTCCTGG - Intergenic
1069537512 10:69265798-69265820 ACTGAGGGTGCAGCTTGTACAGG - Exonic
1076572886 10:131444122-131444144 CCTTGGGTTGCGGGTTGTACAGG - Intergenic
1076850439 10:133089884-133089906 CCCTGAGGTGCTGCTGGTGCTGG - Intronic
1077571215 11:3339883-3339905 GCATGAGGTGCAGCTTGTGTTGG - Intronic
1081572518 11:44300596-44300618 CCTGGTGGTGCAGGATGTACGGG + Intronic
1102472153 12:113165417-113165439 TCTTGAGATGCACCTTGTTCTGG - Intronic
1102612002 12:114120500-114120522 CCTTAAGGAGCAGGTTGTTCTGG + Intergenic
1103981610 12:124740409-124740431 CCTTCAGGTACAGCTTGATCCGG - Intergenic
1105641570 13:22270216-22270238 GCTTGAAGTGTAGCCTGTACGGG + Intergenic
1106139310 13:26998299-26998321 GCTTGAGGTGCAGATTGTCTGGG + Intergenic
1107978554 13:45713484-45713506 TCTTGTGGTGCAGCTTGTGGTGG - Exonic
1113968991 13:114174174-114174196 CCTTGAGATGAGGCTTGTCCAGG - Intergenic
1119648431 14:76365949-76365971 CCTTGAGGTGTACCATGTGCAGG - Intronic
1121119114 14:91364767-91364789 CCTTGAGATGCAGCATGCTCTGG - Intronic
1121299145 14:92855663-92855685 CATTCAGGTGCAGGTTGTTCAGG - Intergenic
1121590590 14:95103989-95104011 CCTTGATGTGCAGCATTTTCAGG + Exonic
1124892286 15:33744513-33744535 CATTGTGGGGCAGCTTGTTCAGG + Intronic
1128826747 15:70725291-70725313 CCTTGAGGATCATCTTGTCCAGG + Intronic
1131681944 15:94732728-94732750 CCTGGAGGTGGAGCTTGCAGTGG + Intergenic
1132681043 16:1141851-1141873 CCTTGAAGTGGAGCTTGCTCTGG - Intergenic
1136000607 16:27289778-27289800 CACTGATGTGCACCTTGTACAGG - Intronic
1138367708 16:56495132-56495154 CCCTGAGGTACAGTTTGTACAGG - Intronic
1141174037 16:81707778-81707800 CCTTCTGGGGCAGCTGGTACAGG - Intronic
1143584978 17:7846486-7846508 CCTTGAGGTGAGGCTGGCACTGG + Exonic
1143602920 17:7960881-7960903 CCTTGAGGTTCAGCTGATGCTGG + Intergenic
1143673093 17:8410377-8410399 CCTTGAGCTGCAGCTTTGAGAGG + Intergenic
1146518546 17:33508515-33508537 GCTTGAGGTCCAACTTGGACTGG - Intronic
1147559401 17:41499727-41499749 CCTGGTGGTGCAGCTTCTTCTGG - Intergenic
1151420929 17:73997050-73997072 CCATGATGTTCAGCTTGTTCAGG + Intergenic
1152361524 17:79835236-79835258 CCTTGCTGTGCGGCTGGTACTGG + Exonic
1153156894 18:2159909-2159931 CCTTTATGTGGAGCTTTTACTGG + Intergenic
1153522921 18:5968971-5968993 CCTTGAGGTGCAGGATGTCCTGG + Intronic
1154013808 18:10598495-10598517 CCTTGAGGTGGAGGTTGCAGTGG - Intergenic
1156947454 18:42852037-42852059 CCTTGTGGTGCACTTTGAACTGG - Intronic
1162017426 19:7853124-7853146 CTTTGAGGACCAGCTTGTCCGGG - Exonic
1162926567 19:13933208-13933230 CATAGAGGTGCAGCGTGTGCAGG + Exonic
1163835623 19:19571701-19571723 CCTGGAGCTGCAGCTTGTGCAGG + Intronic
1166986107 19:46660809-46660831 CCTGGAGGAGCAGCTGGTAAGGG - Exonic
930037870 2:47099138-47099160 CCTCAAGGTGCAGCTTTCACAGG + Intronic
930900973 2:56507359-56507381 CCTTGAGAAGCAGCTAGAACTGG - Intergenic
931034601 2:58225339-58225361 ATTTGAGGTACAGCTTATACTGG - Intronic
931848974 2:66234209-66234231 CCTTGGAATGCAGGTTGTACAGG + Intergenic
932161532 2:69464857-69464879 CCTAGAGCTGCTGCTTCTACAGG + Intronic
932822512 2:74913413-74913435 CCCTGAGGTAAAGTTTGTACAGG - Intergenic
936151552 2:110024769-110024791 CCTTGAGGTGTGGCAGGTACTGG + Intergenic
936193122 2:110346600-110346622 CCTTGAGGTGTGGCAGGTACTGG - Intergenic
937239119 2:120449106-120449128 CCTTGAGGGGCACCTCATACTGG - Intergenic
945048255 2:205800517-205800539 CCTTAAGGTGCAGTGTGTCCTGG - Intergenic
947624646 2:231612095-231612117 CTATGAGGTGGAGCTAGTACCGG + Intergenic
947644644 2:231729489-231729511 CCTGGAGATGCAGCTTTTTCTGG - Intergenic
947685598 2:232081565-232081587 CCTTGAGGTACAGTTCGTACAGG + Intronic
948814649 2:240503610-240503632 GCCTGAGGTGGAGCTTGTTCAGG - Intronic
1171044344 20:21796589-21796611 CCGTGAGGGCCAGATTGTACTGG - Intergenic
1172314984 20:33946770-33946792 GCTTCAGGTGCAGCTTGATCAGG - Intergenic
1174339813 20:49888623-49888645 CCTAGAGTTGCAGCTTGCAGGGG - Exonic
1174901552 20:54506051-54506073 CCATGAGTGGCAGCTTGAACTGG + Intronic
1175817468 20:61890964-61890986 CCTGGAGGTGCAGCGTGACCCGG - Intronic
1184898270 22:47425125-47425147 CCTTGAGGGGTAGCTTGTCCTGG - Intergenic
949918683 3:8984808-8984830 CCTTGAGGGGCAGACTGTTCTGG + Exonic
950055828 3:10023654-10023676 CCTGTGGGTTCAGCTTGTACAGG + Intergenic
952655279 3:35778445-35778467 CCTTGGGATGCAGCTGGTTCTGG + Intronic
953272321 3:41457705-41457727 CCTTTGTGTGCATCTTGTACAGG + Intronic
954792088 3:53141092-53141114 CCTAGAGTTGCAGCTTGTCAGGG + Intergenic
955745469 3:62135988-62136010 CCTGGAGGTGCAGCTGCTGCAGG + Intronic
964726935 3:159823167-159823189 CCTTGAGGTGAAGCTTGATGGGG + Intronic
968440392 4:621057-621079 GGTTGAGGTGCAGCTTGGAGGGG - Intergenic
968882926 4:3310377-3310399 TCTTGGGGTGCAGCGTGGACTGG - Intronic
971211841 4:24625202-24625224 CCTAGAGGTGCAGGTTATGCAGG - Intergenic
985489889 5:173046-173068 CCTTGAAGGACTGCTTGTACAGG - Exonic
990701740 5:58481854-58481876 CAGTGAGGGGCAGCTTATACAGG + Intergenic
991898947 5:71437362-71437384 CCGTGAGGTGGAGCTTGCAAAGG - Intergenic
1002398436 5:178976159-178976181 CCTTCAGATGAAGCCTGTACTGG + Intergenic
1002719051 5:181246876-181246898 CCTTCAGGTGCAGCTTGAGGGGG + Intronic
1003566973 6:7230250-7230272 CCTTGAGGTGCTTCTTGCGCAGG - Exonic
1006633487 6:35446051-35446073 CCTTGAGGTGCAGCAGGTTGTGG + Intergenic
1007909502 6:45499432-45499454 ACTTTAGGTGCAGCCTGTGCTGG + Intronic
1014987877 6:128034074-128034096 ACAAGAGGTACAGCTTGTACTGG - Intronic
1015444628 6:133288641-133288663 CCTTGAGGTGATGCTTTTAAGGG + Intronic
1016352755 6:143185338-143185360 TCTTAAGGTGCAGCTTGTCCAGG + Intronic
1020902040 7:14016147-14016169 CCGGGAGGTGGAGCTTGTAGTGG + Intergenic
1029212087 7:98917445-98917467 CCTTCATGTGCTGCTTGTGCAGG - Exonic
1030018129 7:105244804-105244826 CCTTGGCGTGCTGCTTGTACGGG - Intronic
1033379296 7:140798335-140798357 CCAGGAGGTGGAGCTTGTAGCGG - Intronic
1033544005 7:142383870-142383892 GCATGAGGTGCAGCTTGTGAGGG + Intergenic
1034480977 7:151320452-151320474 CCTTGAGGTGGAGCTGGCCCAGG + Intergenic
1038757627 8:30356609-30356631 CCGTGAGGTGTAGCTTATACAGG + Intergenic
1039168579 8:34714817-34714839 CTTTGAGCTGCAGCTGGAACTGG + Intergenic
1042938508 8:74084426-74084448 CTCTGAAGTGCAGTTTGTACAGG + Intergenic
1048921092 8:139230826-139230848 TCTTCAGGTGCAGATTGTTCAGG - Intergenic
1049038204 8:140093223-140093245 CCTGGAGGTGCATCCTGTGCAGG + Intronic
1049450865 8:142660740-142660762 CCCTGAGGTGCAGTGTGGACGGG + Intronic
1049912874 9:286526-286548 CCTGGATGTGCAGCTTGCCCAGG + Exonic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1057177415 9:93010311-93010333 CCTTGAGCAGCAGCTCGTACCGG - Exonic
1058110719 9:101028780-101028802 CCTGGCGCTGCAGCTTGCACAGG - Exonic
1058883907 9:109308340-109308362 CCCTGAGGTACAGTTAGTACCGG - Intronic
1059466270 9:114470711-114470733 CCTTAAGGTGCAGCATGGAGTGG - Intronic
1060064588 9:120493383-120493405 CCCTGAGGTGCAGCTCATACAGG - Intronic
1185836540 X:3349681-3349703 TTTTGGGGTGCAGATTGTACAGG - Intergenic
1188538226 X:31220639-31220661 CCTGTAGGTGCTGCTTGTAACGG - Intronic
1189812317 X:44791927-44791949 CCTTGAAATACAGCTTGTGCAGG - Intergenic
1192757623 X:74063161-74063183 ACTTGAGGTACAGTTTGTATAGG + Intergenic
1196995035 X:121373421-121373443 CCTTGAGCTCAAGCCTGTACAGG + Intergenic
1199505071 X:148552354-148552376 ACTTGATGTACAGCTTGAACTGG + Intronic
1201900702 Y:19044230-19044252 GCTTGTGGTGCAGCTGGTAGTGG + Intergenic