ID: 907240833

View in Genome Browser
Species Human (GRCh38)
Location 1:53080167-53080189
Sequence CTGGGGCCTGGCTGTTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 7, 3: 44, 4: 387}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907240824_907240833 17 Left 907240824 1:53080127-53080149 CCCTGGATGCCAGGCATGTGATG 0: 1
1: 1
2: 3
3: 18
4: 271
Right 907240833 1:53080167-53080189 CTGGGGCCTGGCTGTTGTGCTGG 0: 1
1: 0
2: 7
3: 44
4: 387
907240826_907240833 8 Left 907240826 1:53080136-53080158 CCAGGCATGTGATGATCTGAGAC No data
Right 907240833 1:53080167-53080189 CTGGGGCCTGGCTGTTGTGCTGG 0: 1
1: 0
2: 7
3: 44
4: 387
907240823_907240833 18 Left 907240823 1:53080126-53080148 CCCCTGGATGCCAGGCATGTGAT 0: 1
1: 0
2: 5
3: 21
4: 198
Right 907240833 1:53080167-53080189 CTGGGGCCTGGCTGTTGTGCTGG 0: 1
1: 0
2: 7
3: 44
4: 387
907240819_907240833 30 Left 907240819 1:53080114-53080136 CCTGACTGCCCTCCCCTGGATGC No data
Right 907240833 1:53080167-53080189 CTGGGGCCTGGCTGTTGTGCTGG 0: 1
1: 0
2: 7
3: 44
4: 387
907240825_907240833 16 Left 907240825 1:53080128-53080150 CCTGGATGCCAGGCATGTGATGA 0: 1
1: 1
2: 0
3: 13
4: 202
Right 907240833 1:53080167-53080189 CTGGGGCCTGGCTGTTGTGCTGG 0: 1
1: 0
2: 7
3: 44
4: 387
907240821_907240833 22 Left 907240821 1:53080122-53080144 CCCTCCCCTGGATGCCAGGCATG 0: 1
1: 0
2: 2
3: 36
4: 334
Right 907240833 1:53080167-53080189 CTGGGGCCTGGCTGTTGTGCTGG 0: 1
1: 0
2: 7
3: 44
4: 387
907240822_907240833 21 Left 907240822 1:53080123-53080145 CCTCCCCTGGATGCCAGGCATGT No data
Right 907240833 1:53080167-53080189 CTGGGGCCTGGCTGTTGTGCTGG 0: 1
1: 0
2: 7
3: 44
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907240833 Original CRISPR CTGGGGCCTGGCTGTTGTGC TGG Intronic
900092844 1:927898-927920 TTGGGGCGTGGCTGGGGTGCCGG + Intronic
900476363 1:2878204-2878226 CTGGCTGCTGGCTGTTGTGGGGG + Intergenic
900506216 1:3030885-3030907 CTGGGGCCTGGGTGAGGGGCTGG - Intergenic
900617480 1:3571871-3571893 CTGGGTCCTGCCAGGTGTGCTGG + Intronic
900635866 1:3664648-3664670 CTGGGGCCTGGTGGTTGTAGGGG + Intronic
900644525 1:3702959-3702981 CTGGGGCCTGGCTCCTGCTCGGG - Intronic
901154397 1:7125686-7125708 CTGGGGGCTGGCGGTTCAGCAGG + Intronic
902173220 1:14629787-14629809 CTAGGGCCGGGTTGTTCTGCTGG + Intronic
902677042 1:18016015-18016037 CTGGGGAATGGCTGTTGACCTGG - Intergenic
903827188 1:26154955-26154977 CTGGGGCCAGGCTATTGTTGTGG + Intergenic
904006151 1:27364292-27364314 GCGGGGCCTGGCTGATGGGCTGG - Exonic
904268525 1:29332479-29332501 CTGGGCCTTGGCTCCTGTGCTGG - Intergenic
904520232 1:31089593-31089615 GTGGCGCCTGCCTGTTGTCCTGG - Intergenic
904657858 1:32062742-32062764 CTGGGGCCTGGCAGCAGAGCTGG + Intergenic
904880988 1:33696726-33696748 CTGGGGCCTGGCAGGTGGGCAGG + Intronic
905250241 1:36643680-36643702 CTGGTGCCTGGGTGGTGTGTGGG + Intergenic
906388339 1:45391407-45391429 CTGGGGTCTTGCTGTTGTCCAGG + Intronic
906533924 1:46540949-46540971 CTGGGGCCTCTCAGCTGTGCTGG - Intergenic
906680911 1:47725073-47725095 GAGGGGCCGCGCTGTTGTGCTGG - Intergenic
907240833 1:53080167-53080189 CTGGGGCCTGGCTGTTGTGCTGG + Intronic
907667145 1:56443241-56443263 CTGGTACTTAGCTGTTGTGCTGG + Intergenic
908086028 1:60634964-60634986 CTGAGCCCTGTCTGTTGTGGAGG - Intergenic
908288029 1:62630453-62630475 CAGGTGCCTGCCTGTCGTGCGGG - Intronic
908711446 1:67019996-67020018 CTGAGGTCTGGCTGTTTTGTAGG - Intronic
910513910 1:88036924-88036946 CAGGGGCAGGGTTGTTGTGCTGG - Intergenic
911333213 1:96549515-96549537 ATGGGGCCTTGCTGTGGGGCCGG - Intergenic
912363459 1:109113816-109113838 CCCGGGCCTGCCTGTTGGGCCGG + Exonic
913062444 1:115220585-115220607 CAGAGGCCTGGCTGATGGGCTGG + Intergenic
914859086 1:151371993-151372015 CTCGGGGCTGGCTCTTGAGCTGG - Intronic
915344202 1:155190487-155190509 CTGGGGCCGGCCTGGTGTCCGGG + Intronic
919101678 1:193104600-193104622 CTGGTGCCTGGCGGTCCTGCCGG - Intronic
919478035 1:198053776-198053798 CTGTGGACTGGTGGTTGTGCTGG - Intergenic
919745378 1:201005389-201005411 CTGGGTGCTGGCTGTGGTGCGGG + Exonic
920196289 1:204229276-204229298 CTGGGGCCTAGCAGGTGGGCAGG - Intronic
920436482 1:205950178-205950200 CTAGGGCCTGCCTGCTGTGCCGG - Intergenic
921903017 1:220467853-220467875 CTGAGGGCTGGCTGGGGTGCTGG + Intergenic
923405012 1:233651235-233651257 CTGGGGCATAGATGCTGTGCAGG - Intronic
924034463 1:239922281-239922303 CTGGTGCCTGGCTGTTACTCTGG - Intergenic
924451605 1:244183872-244183894 CTTGGGCCTGTCTGTAGTGGTGG - Intergenic
1062939375 10:1410078-1410100 CTGAGGCCTGGCTGTGGTCATGG + Intronic
1062939439 10:1410338-1410360 CTGAGGCCTGGCTGTGGTCATGG + Intronic
1062955275 10:1536034-1536056 CTGGGGCCTGCTTGATGGGCCGG - Intronic
1063733754 10:8729224-8729246 CTGGGTCATGGCTGTTGTCCTGG - Intergenic
1063918309 10:10906754-10906776 CTGTCGCCAGGCTGTAGTGCGGG + Intergenic
1064155246 10:12898388-12898410 CTGGGGGCTGCCAGGTGTGCAGG - Exonic
1066166510 10:32794120-32794142 CTGGGGACTGCCTGATGTGGAGG - Intronic
1066259120 10:33711714-33711736 ATGGAGTCTGGCTGTTGTCCAGG - Intergenic
1066705760 10:38175842-38175864 CTGGGGCCAGGCTGTGGTGTCGG + Intergenic
1067525501 10:47036019-47036041 GTGGGGCCTGGCAGGTGTGCTGG + Intergenic
1067749573 10:48961896-48961918 CTGGGGCCAGGACGTTGGGCTGG - Intronic
1067848519 10:49740672-49740694 CTGGGGCCTGCCTGGCCTGCAGG + Intronic
1069058244 10:63866849-63866871 CTGGGGCCTGGCAGTAATGATGG + Intergenic
1069531863 10:69225620-69225642 CTGAGGCCTGGCTGATGACCGGG + Intronic
1069824629 10:71247491-71247513 CTGAGGCCTCGCTGTTGGACAGG + Intronic
1069923385 10:71831352-71831374 CTGAGGGCTGGCTGTTTTCCAGG - Intronic
1070656944 10:78278181-78278203 CTGTGGCCGGGCTGTGGAGCAGG - Intergenic
1071908340 10:90200517-90200539 CTGGTTCCTGCCTGTTGTTCTGG + Intergenic
1071973472 10:90931361-90931383 CTGGGGTCTGGTTGGTATGCAGG - Intergenic
1073037379 10:100573666-100573688 GTGGGGCCTGGCTGTGGGGTAGG - Intergenic
1073717144 10:106120597-106120619 CTGGGGCCTGTCGGTGGGGCAGG + Intergenic
1074741890 10:116493365-116493387 CTGGGGCCTGTCGGTGATGCGGG - Intergenic
1074823269 10:117197383-117197405 CTGGAGCCTGGCTGTTCTCCGGG + Intergenic
1074823467 10:117198297-117198319 GGGGGTCCTGGCTGTTGTCCTGG + Intronic
1075719600 10:124576954-124576976 CTGGGTCGTGGCTGTTGAGAGGG - Intronic
1075733747 10:124651688-124651710 CTGGGGCCTGCCTGCTCTGGAGG + Intronic
1076570068 10:131426681-131426703 TTGGGCCCTGCCTGATGTGCCGG - Intergenic
1076875401 10:133213323-133213345 CTGAGGGCTGGCTGTGGTGGCGG - Intronic
1077033860 11:484394-484416 CTGAGGCCTGGGTGTTGGGTGGG + Intronic
1077049392 11:560056-560078 CTGGGACCTGGCTTTTCTCCTGG - Intronic
1077065797 11:640398-640420 CAGGGGCCTTCCTGCTGTGCTGG + Exonic
1077179471 11:1205809-1205831 CTGGGGCCTCGCCGTGTTGCAGG + Intergenic
1077192168 11:1260159-1260181 GTGGGGCCTCCCTGCTGTGCAGG - Intronic
1078470341 11:11581260-11581282 GTGAGGCCTGCCTGTTGTACTGG - Intronic
1079114752 11:17634139-17634161 CTGGGGCTTGGCACTGGTGCTGG - Exonic
1080187950 11:29513273-29513295 CTGGGGCCTGTCTGTTCTTGGGG - Intergenic
1081145916 11:39562531-39562553 CTGGGGCCAGGCTGTAATGCAGG - Intergenic
1081630777 11:44688240-44688262 CTGGGGCCAGGCTGCCTTGCTGG - Intergenic
1082166134 11:48953836-48953858 CTGGGGCCTGTCTGGGGTGGGGG - Intergenic
1082237063 11:49831131-49831153 CTGGGGCCTGTCTGGGGTGGGGG + Intergenic
1082241631 11:49878573-49878595 CTGGGGCCTGTCTGGGGTGGGGG - Intergenic
1083668800 11:64289210-64289232 CTGGGGCCTGGGTATTCTGTGGG - Exonic
1083826238 11:65205540-65205562 CTGGGGCCCTGCTGTGGTGCAGG + Intronic
1083945385 11:65920140-65920162 CTGTGGCCTTGCTGGTGTCCCGG - Intronic
1084345376 11:68543723-68543745 CTGGGTCCTGGCTGTCCAGCAGG + Intronic
1085634512 11:78148021-78148043 CTGGGACCTGGCTGGCCTGCTGG + Intergenic
1085821203 11:79795518-79795540 CTGGTTCTGGGCTGTTGTGCAGG - Intergenic
1085884970 11:80511069-80511091 CTGGGGCCTGCCTGGGGTGGGGG + Intergenic
1087479456 11:98680833-98680855 CTGGGGCATGTCTGTTCTGTAGG - Intergenic
1088492459 11:110401217-110401239 TTGGGGCCAGGCTGTAGTGCAGG - Intergenic
1089739252 11:120571111-120571133 CTGGTGCCCGGCTGTTTTCCTGG + Intronic
1089977016 11:122741707-122741729 CTGGGGCCTGGCTGTCGTGAGGG - Intronic
1090941113 11:131389199-131389221 CTCGGGCCTGGCTCCTGGGCAGG + Intronic
1091401299 12:182283-182305 TTGGGGCCTGGCTGCCGTCCTGG - Intergenic
1092880691 12:12885668-12885690 CTGGGGACTGGGTGTGGGGCGGG + Intergenic
1093523465 12:20077065-20077087 CTGGGGCCTGTCGGTGGTGAGGG + Intergenic
1094443334 12:30503488-30503510 CTGGAGCCCGCCTGCTGTGCGGG + Intergenic
1095199585 12:39367111-39367133 CTGGGTACTGGCAGTTGTCCGGG + Exonic
1095875254 12:47073382-47073404 CAGGGGGCTGGCTCTTGGGCAGG + Intergenic
1096588760 12:52643522-52643544 CTGGGTCCTGGCTGGTCTGGAGG + Intergenic
1096650823 12:53061150-53061172 CAGGGTCCTGGCTGTTGCCCCGG - Exonic
1097069291 12:56343137-56343159 CTGGAGGCTGCCTGCTGTGCTGG - Exonic
1097317450 12:58187133-58187155 CTGGAGCCTGGATGTGATGCTGG + Intergenic
1098124146 12:67272732-67272754 CTGTCGCCAGGCTGTAGTGCAGG + Intronic
1099373415 12:81866116-81866138 CTGGGGCATGTCTGTCCTGCAGG - Intergenic
1101962225 12:109258838-109258860 CTGAGCCCTGGCTCTGGTGCTGG + Intronic
1102060059 12:109925209-109925231 CAGGGGCCTGGGTGTGGGGCAGG + Intronic
1102278466 12:111599765-111599787 CTGGGGCCTGCCTGGTGTGGAGG + Intergenic
1102875757 12:116447392-116447414 CTGGGGTCTGCCAGTTGTCCTGG + Intergenic
1102914647 12:116743788-116743810 ATGGTGCCTGCCTGTTCTGCAGG + Intronic
1103937225 12:124483094-124483116 CAGGGGGCTGCCTGCTGTGCAGG + Intronic
1103954012 12:124566842-124566864 CCCTGGCCTGGCTGTTGTGGAGG - Intronic
1104684351 12:130775008-130775030 ATGGGGCCTGGCGTTTGTGTGGG - Intergenic
1106415218 13:29540726-29540748 CTGGGGCCTGGCCATTCTGAAGG - Intronic
1106435700 13:29721426-29721448 CAGGGTCCTGCCTGTTTTGCTGG + Intergenic
1108596462 13:51954224-51954246 CTGGGACCTGCCAGTGGTGCAGG + Intronic
1108795434 13:54024295-54024317 CAGGGGCATGGTGGTTGTGCTGG - Intergenic
1108831734 13:54487448-54487470 CTGGGGCCTGGTAGCTCTGCTGG + Intergenic
1109306065 13:60643351-60643373 CTGGGGCCTGTCAGATGGGCAGG - Intergenic
1111110705 13:83705131-83705153 CTGGGACTTGGATGTGGTGCTGG - Intergenic
1112501619 13:99947379-99947401 GAGGGGTCTGGCTGTTGTGTGGG - Intergenic
1112796835 13:103066297-103066319 CTGGGCCCTGGCTCTGCTGCTGG + Exonic
1112846744 13:103653018-103653040 CTGGGGCTTAGCTGATGTGGGGG + Intergenic
1113521790 13:110946773-110946795 CTGGGACTTGACTGTTCTGCAGG - Intergenic
1113578447 13:111411394-111411416 CTGGTGCCAGGCTGTGGAGCTGG - Intergenic
1113628368 13:111863289-111863311 CTCGGGGCTGTCTGTGGTGCGGG - Intergenic
1113647959 13:112012221-112012243 CTGGGGCCTGGCTGCTTCGCAGG - Intergenic
1113706105 13:112433930-112433952 CTGGGACCTGACTGTTCTGCAGG + Intronic
1113807479 13:113118182-113118204 CTGGGGTCTGGGTGTTGAGGTGG - Intronic
1113945838 13:114043668-114043690 CTGGGGCCTGTTTCCTGTGCCGG - Intronic
1114666110 14:24377988-24378010 GTGTGGGCTGGCTGTTGTGCTGG + Exonic
1115479283 14:33845654-33845676 TTGGTGCCTGGCTTTTTTGCAGG + Intergenic
1116073099 14:40074218-40074240 CAGGGTCATGGCTGTTCTGCTGG - Intergenic
1116866869 14:50038419-50038441 CTGGGTCCTGGCTTTTGTCTTGG - Intergenic
1117337194 14:54765726-54765748 AAGGGGCCTGGCCGCTGTGCTGG - Intronic
1117527757 14:56627838-56627860 CTGTGTCCTGACTGTTGTGGTGG - Intronic
1117591960 14:57279514-57279536 CTGGGGCCTGTCAGTTGTGGGGG + Intronic
1117888186 14:60387610-60387632 CTGGGGCCTGTCGGTGGGGCGGG + Intergenic
1119273165 14:73327907-73327929 CTGGGGACTGGGTGTGGTGGGGG - Intronic
1121004789 14:90483207-90483229 CTGGGGCCAAGCTCTTGAGCAGG - Intergenic
1121282857 14:92711805-92711827 TTGGGGGCTGGCTGTTCAGCTGG - Intronic
1122145195 14:99684553-99684575 GCGGGGCCTGGCTGGGGTGCTGG + Intronic
1122268769 14:100558968-100558990 CTGGGGCCTGGGGGTTGTTGGGG + Intronic
1122598811 14:102910676-102910698 CTCGGGGCTGGCAGGTGTGCGGG + Exonic
1122599454 14:102914026-102914048 CTGGGGCTCGGCTGCTGGGCTGG + Intergenic
1122615661 14:103016199-103016221 CTGTGGCAGGGCTGTTCTGCTGG + Intronic
1123005969 14:105324033-105324055 CTGGGGACTGGCTTTTGTGCAGG + Intronic
1123997334 15:25728031-25728053 CTGGGCCCCTGCTGTTGTTCTGG - Intronic
1124719796 15:32101654-32101676 CTGGGGACTGGCTGTGGTGCAGG - Intronic
1125269338 15:37921255-37921277 CTGGAGCCTGGCAGATTTGCTGG - Intergenic
1125722711 15:41852854-41852876 CTGAGGCCTGGCTGGCCTGCTGG - Exonic
1125956985 15:43797307-43797329 CTGGTTCCTGGCTGTCCTGCTGG - Exonic
1126092195 15:45062451-45062473 CTGGGGCCAGGCTGCGGTGGGGG - Intronic
1126489983 15:49225990-49226012 ATGGGGCATGTCTGTTCTGCAGG - Intronic
1128063059 15:64747411-64747433 CTGGGACCTGGCTGGGGAGCAGG - Intronic
1128254308 15:66185733-66185755 CTGGTGCCTGGCTGCTGGGTGGG - Intronic
1128501488 15:68229959-68229981 CTGAGGCCTGGGTGTTGGGCTGG + Intronic
1128734933 15:70048120-70048142 CAGTGGCCTGGCTGTTTTCCCGG + Exonic
1129760895 15:78128840-78128862 CAGGGCCCTGGCTGTCGTGATGG + Intronic
1129847370 15:78774102-78774124 CTGGGGCCTGCCAGTGGGGCTGG + Intronic
1129850144 15:78789170-78789192 CTGTGCCCTGGCTGTTGAGCTGG - Intronic
1130027889 15:80285585-80285607 CTGGAGCCTGCCCCTTGTGCAGG - Intergenic
1130252118 15:82306406-82306428 CTGTGCCCTGGCTGTTGAGCTGG + Intergenic
1130367943 15:83257462-83257484 ATGAGGCCAGGCTTTTGTGCAGG + Exonic
1132582420 16:691098-691120 CTGGTGCCTGACTTCTGTGCGGG - Intronic
1132640183 16:974644-974666 CTGGGTCCTGGGGGCTGTGCTGG - Intronic
1132655476 16:1040270-1040292 CTTGGGCCTGGCTGTTCTCTTGG - Intergenic
1133170483 16:3979800-3979822 CAGGGGCTTGGCTGCTGTGTGGG - Intronic
1133231581 16:4369519-4369541 CTGGGACCTGGCTGAGGGGCGGG - Intronic
1133238481 16:4401112-4401134 CTGGGGCCTGGAGGTTGTCACGG + Intronic
1133282646 16:4675981-4676003 CTGGGTCCTGGCGGTGGGGCCGG + Intronic
1134314085 16:13102284-13102306 CTGTGACCTGGATGTTGAGCTGG - Intronic
1135944184 16:26850883-26850905 CTGGGGCCTGTCGGTGGAGCGGG + Intergenic
1136051593 16:27654525-27654547 CTGGGGCCTCGCTCTTCTGTTGG - Intronic
1136070654 16:27785056-27785078 CTGGGGCTTTGATGCTGTGCAGG - Intergenic
1136510987 16:30738252-30738274 TTGGGGCCTGGTGGTTGTCCTGG - Exonic
1136571543 16:31100586-31100608 ATGGGACATGGCTCTTGTGCAGG + Intergenic
1137457400 16:48628503-48628525 GTGGGGCCTGGCTGTTTTCAAGG - Intergenic
1137486316 16:48894438-48894460 CTGGGTCCTGCCTCTTGGGCTGG - Intergenic
1139530926 16:67542398-67542420 GTGGGGCCTGGCAGTTCTGAAGG - Exonic
1140169647 16:72590675-72590697 CTGGGGCATGACCCTTGTGCAGG - Intergenic
1140416669 16:74778589-74778611 CTGGGGCCAGGCATCTGTGCTGG + Intergenic
1142253659 16:89003674-89003696 GTGGGGCCTGGGTGTGGGGCCGG - Intergenic
1142378382 16:89718361-89718383 CTGGGGCCGTTCTGGTGTGCAGG - Intronic
1143443903 17:6996146-6996168 CCGGGGCCTGGCTCTTCTCCGGG + Exonic
1144061034 17:11583470-11583492 CTGGGCCCAGGCTGGTGTCCAGG + Intergenic
1144270525 17:13610929-13610951 TTCGGGTCTGGCTGGTGTGCTGG - Intergenic
1145998763 17:29119093-29119115 CTGGGGCCTGGCTGTATTGGAGG - Intronic
1146001311 17:29132151-29132173 CTGGGGCCAGGGGTTTGTGCTGG + Intronic
1147193606 17:38750573-38750595 CAGGAGCCTGGCTTTTGCGCAGG + Exonic
1149194422 17:54102486-54102508 CTGGGGCATGTCTGCTCTGCAGG + Intergenic
1150219266 17:63486906-63486928 ATGGGGCCTGGGGGTAGTGCAGG + Intronic
1151673333 17:75585059-75585081 CTGGGGCAAGGCAGCTGTGCTGG - Intergenic
1152058255 17:78049683-78049705 CTGGGGCATGGCTGTTGGTATGG + Exonic
1152750647 17:82060996-82061018 CTGGGGCCTGACGGTGGAGCCGG - Intronic
1153424259 18:4945204-4945226 CTGGGGCAGGGTAGTTGTGCTGG - Intergenic
1156059998 18:33063097-33063119 ATGGCGCCTGGCTGGTGGGCTGG - Intronic
1157053569 18:44198448-44198470 CTGGGGCATGTCTGTCCTGCAGG + Intergenic
1157140724 18:45103509-45103531 CTAGGCCCAGGCTGTGGTGCCGG + Intergenic
1157591982 18:48841657-48841679 CGGGGGCCAGGCTGGTGGGCAGG + Intronic
1159278260 18:66249424-66249446 CTGGTGCCTGGTTGTTTTCCTGG + Intergenic
1159856777 18:73598352-73598374 GTGGGGCTTGGCTGTAGTGAAGG + Intergenic
1160913989 19:1488077-1488099 GTTGGGCCTCGCTGTTCTGCAGG + Exonic
1161304498 19:3559395-3559417 CTGGGGTCTTGCTGTTGCCCAGG - Intronic
1162420076 19:10561139-10561161 CTGGGGCCTGACTGGACTGCTGG - Intronic
1163127288 19:15251188-15251210 CTGGGGCCAGGCTCTAGTTCAGG - Intronic
1163799651 19:19356781-19356803 CTGGGGCCTGGCTAGGGTGCGGG - Exonic
1164465331 19:28482953-28482975 ATGGGGGCTGTCTGTTGGGCTGG - Intergenic
1166432794 19:42741173-42741195 CTGGGGTCTGGCGGCTGAGCTGG + Intronic
1166448767 19:42880388-42880410 CTGGGGTCTGGCGGCTGAGCTGG + Intronic
1166455655 19:42937887-42937909 CTGGGGTCTGGCGGCTGAGCTGG + Intronic
1166471578 19:43083366-43083388 CTGGGGTTTGGCTGCTGAGCTGG + Intronic
1166482720 19:43187182-43187204 CTGGGGTCTGGCAGCTGAGCTGG + Intronic
1166485194 19:43206316-43206338 CTGGGGTCTGGCGGCTGAGCTGG + Intronic
1166492345 19:43270234-43270256 CTGGGGTCTGGCGGCTGAGCTGG + Intergenic
1166855778 19:45782105-45782127 CAGAGGCCTGGCTGTTGGGGGGG - Intronic
1166955490 19:46461729-46461751 TTGGGTCCTGGCTCTTGTTCAGG - Intergenic
1167089284 19:47332274-47332296 CTGGGTCCTGGCTGTGGGCCCGG + Exonic
1168181563 19:54665525-54665547 CTGGGGCTTGGCTCTGGTGCAGG + Intronic
1168469932 19:56631421-56631443 CTGTGGGCTGGGGGTTGTGCTGG - Intergenic
925032342 2:660762-660784 CTGCGGCCTGGCTGAGGAGCAGG - Intergenic
925370184 2:3339409-3339431 CTGAGGCCTGGGTGATGTGTAGG - Intronic
925635855 2:5941046-5941068 CTGGGGCCTGGCTACTTTCCTGG + Intergenic
925774623 2:7322558-7322580 CTGGGCCCTGGCTGCTCTGCAGG + Intergenic
925910305 2:8569506-8569528 CTGTGGCCTGGCTGTGGTGCTGG - Intergenic
926136923 2:10342934-10342956 CTGGGGCCTGGCTTTGGAGATGG + Intronic
926142602 2:10377290-10377312 CTGGGGCCTGGCTCGGGGGCAGG - Intronic
926720606 2:15957527-15957549 CTGGTCCCTGGCATTTGTGCAGG - Intergenic
926985195 2:18614808-18614830 CTAGGGCCTGTCGGTTGTGGTGG - Intergenic
927032555 2:19137585-19137607 CTGTGGCCTGGGTGTAGTGATGG - Intergenic
927928507 2:27029023-27029045 ATGGGGTCTCGCTGTTGTCCAGG - Intergenic
930111860 2:47685542-47685564 CTGGAGCCTGTCAGTGGTGCTGG - Intergenic
930879227 2:56252698-56252720 CTGGGGCCTGTCGGTTGGGCGGG - Intronic
932210699 2:69927240-69927262 CTGGGGCCTGACTTTTGCACTGG + Intronic
932229978 2:70075077-70075099 CTGTGGCCAGGCTGGAGTGCAGG - Intergenic
932396932 2:71454845-71454867 CTGGGCCCTGGCTGCTCTCCAGG + Intronic
932588026 2:73044439-73044461 CTGAGGCCTGGCTGTTCTAGTGG + Intronic
932619199 2:73255917-73255939 CTGGGGAAAGGCTGTGGTGCTGG + Exonic
932844430 2:75120674-75120696 CTGGGTCCTGGCTCTCCTGCTGG - Exonic
933595974 2:84283726-84283748 CTGGAGCCTGGCAGATCTGCGGG + Intergenic
933973272 2:87487487-87487509 CTGGAGGCTGGCTTTAGTGCTGG + Intergenic
934653296 2:96104376-96104398 CTGGAGCCTGGCTGCTGGCCTGG + Intergenic
935305664 2:101733918-101733940 CTGTGGCCAGGCTGTGGTTCAGG - Intronic
935961086 2:108426184-108426206 CTGGGGCCTGTCAGTGGGGCAGG + Intergenic
936194922 2:110362259-110362281 TAGGGGCATGGCTGTAGTGCTGG + Intergenic
936320449 2:111462724-111462746 CTGGAGGCTGGCTTTAGTGCTGG - Intergenic
936455866 2:112673883-112673905 CTGGGCCCTGGCTGCTGAGGAGG + Intergenic
937332297 2:121039047-121039069 CTGGGTCCTGGCAGGTGGGCGGG + Intergenic
938093825 2:128449107-128449129 CATGGGCCTGGCTGCTGTGTAGG + Intergenic
938639658 2:133266078-133266100 GTGGGGCCTCGCTTTTGTGTGGG - Intronic
939094221 2:137815046-137815068 CTGGGACATGGCTCTTCTGCTGG - Intergenic
940120698 2:150261421-150261443 CTGGAGCCTTGCTGATGTGGGGG - Intergenic
941501861 2:166289339-166289361 CTGGGGCCTGTCGGTGGTGGGGG - Intronic
941927218 2:170908280-170908302 CTGGGGCCTGTCTGGAGTGGGGG + Intergenic
942491086 2:176490415-176490437 CTGGGGACTGGGCCTTGTGCGGG + Intergenic
945165125 2:206935200-206935222 CTGGGATCTGGCTGGTGTGTTGG + Intergenic
948628532 2:239285434-239285456 CTGGGGCTTCGCTAGTGTGCGGG + Intronic
948766957 2:240227302-240227324 CTGAGGCCCGCCTGGTGTGCTGG - Intergenic
948903171 2:240966264-240966286 GTGGGGCCTGGCTGGGGGGCTGG - Intronic
949018699 2:241728333-241728355 CTGGGGCCGGGCAGCTGTGGAGG - Exonic
1170536843 20:17349076-17349098 CTGAGGGCTGACTGTTGCGCTGG - Intronic
1170935600 20:20806294-20806316 CAGGGGCCTGGTCCTTGTGCTGG + Intergenic
1171302486 20:24075792-24075814 CTGAGGCTTGGCTGTAGAGCTGG - Intergenic
1171420282 20:25013264-25013286 CATGGGCCTGGCTGCAGTGCAGG + Intronic
1172080638 20:32338145-32338167 CTGGGGACTTGCTGTTGGGCTGG + Intergenic
1172232683 20:33347746-33347768 CTGGGCCCTGGCTGTCATGTTGG + Intergenic
1172516060 20:35534377-35534399 CTGGGGCCTGCCTGGTGGGCAGG - Intergenic
1172815306 20:37681570-37681592 CTGGGCCCTGGCCTTGGTGCTGG - Intergenic
1173000510 20:39102136-39102158 CTGGAGTCTGGCTGTTGAGCAGG - Intergenic
1173279666 20:41617788-41617810 CTGGTGCCAGGCTGCTGTTCCGG - Intronic
1173548393 20:43915861-43915883 CTGGGACCTGGCTGGGGTGGGGG - Intronic
1173669613 20:44789580-44789602 ATAGGGCCTTGCTGTTGTCCAGG + Intronic
1175084514 20:56447346-56447368 CTTGGGCCTGCCTGCTGGGCTGG + Intronic
1175418896 20:58819019-58819041 CTGGGAACTGGCTGCTCTGCAGG - Intergenic
1175901459 20:62361470-62361492 CTGGAGCCTGGCTGGAGGGCCGG - Intronic
1176271944 20:64239924-64239946 CTGGGGGGTAGCTGTGGTGCCGG - Intronic
1176388500 21:6151518-6151540 CCGGGGCCTGGCTGCTGGGCGGG - Intergenic
1177425715 21:20920951-20920973 CTGGGGCCTGTCTGGTGTCGGGG - Intergenic
1179734972 21:43386730-43386752 CCGGGGCCTGGCTGCTGGGCGGG + Intergenic
1179918668 21:44495056-44495078 CTGGGGCTTTACTTTTGTGCTGG - Intergenic
1180582999 22:16859263-16859285 TAGGGGCATGGCTGTGGTGCTGG + Intergenic
1180831695 22:18910072-18910094 CTTTGGCCTGGCTGCTCTGCTGG + Intronic
1180941010 22:19659458-19659480 CTGGGGCCTGGGTGTTCCCCTGG - Intergenic
1181068155 22:20316297-20316319 CTTTGGCCTGGCTGCTCTGCTGG - Intronic
1181594402 22:23904995-23905017 TGGGGCCCTGGCAGTTGTGCTGG - Intergenic
1183383302 22:37501320-37501342 AGGGGTCCTGGCTGTTGTCCAGG - Intronic
1183383844 22:37503822-37503844 CTGGGGCCTGGCTTTCTTGCCGG + Intronic
1184242988 22:43221203-43221225 CTCGTGCCTGGCTGTGGGGCCGG + Exonic
1184329580 22:43818704-43818726 CAGGGGCCTGCCTGTTGCCCAGG - Intergenic
1184683871 22:46087214-46087236 CTGTGCCCAGGCTGGTGTGCTGG + Intronic
1185376459 22:50484687-50484709 CTGGGGCCTGCCTGTGGTCAGGG + Exonic
1185380493 22:50505527-50505549 CTTGGGCCAGGCTGTGGGGCAGG + Exonic
1203281775 22_KI270734v1_random:135343-135365 CTTTGGCCTGGCTGCTCTGCTGG + Intergenic
949535008 3:4988829-4988851 CTGGGGCAGGGCAGTTCTGCTGG + Intergenic
950089668 3:10286743-10286765 CCAGGGCCTGGCTGTGCTGCTGG + Exonic
950273532 3:11639265-11639287 CTGGGGACTGGCTCTGGAGCTGG + Intronic
950548531 3:13653109-13653131 CTGGGAGCTGGCTGGGGTGCGGG + Intergenic
951853048 3:27164317-27164339 CTGGGGTATGGCATTTGTGCAGG - Intronic
953573299 3:44090636-44090658 CTGGGACCTGGCTGGTGGGGGGG + Intergenic
953798380 3:46002572-46002594 CTGGGAGCTGGCTGATGTGTAGG - Intergenic
954874636 3:53793645-53793667 CTTGGGCCTGGCTGTGTTGCTGG + Intronic
955398288 3:58573095-58573117 CTGAGGCCAGGCTGGTGTGGTGG + Intronic
956627510 3:71281202-71281224 ATGGGGTCTGACTGTTGTCCAGG - Intronic
956689693 3:71864200-71864222 CTGGGGCCTTGATGATTTGCGGG - Intergenic
957054802 3:75435244-75435266 CTGGGGGCGGGCTGTAGGGCGGG + Intergenic
957880172 3:86201560-86201582 CTGGGGCCTGTCTGGTGGGTGGG + Intergenic
958975858 3:100667331-100667353 CTGGGGCCTGTCAGTGGTGGGGG - Intronic
959783783 3:110268359-110268381 CTATGGCCAGGGTGTTGTGCAGG + Intergenic
961222642 3:125212529-125212551 CTGGGGCCAGGCCCGTGTGCCGG + Intronic
961330382 3:126134800-126134822 TTGGGGCCTGGCTCTTTCGCTGG - Intronic
961390124 3:126547634-126547656 CTGGGCCCTGCCTATAGTGCAGG + Intronic
961476139 3:127147507-127147529 CTGGGGCCGGGCTGATGGGTTGG - Intergenic
961724355 3:128916352-128916374 CTGGGACTTAGCTGTGGTGCAGG + Intronic
962133530 3:132708697-132708719 CAGGAGCCTGGCTGTTGCCCTGG - Intronic
962689851 3:137884143-137884165 CTGGGGCCTGTCAGTGGTGGGGG - Intergenic
966398196 3:179522862-179522884 CATGGTCCTGGCTGTTGTGTAGG + Intergenic
967983732 3:195080478-195080500 CTGGGGCCTGGCTGCCCAGCTGG - Intronic
968007247 3:195251409-195251431 CGGGGGCCTGGCTTCTGGGCTGG - Intronic
968762824 4:2451233-2451255 TTGGGGACTGGCTGTGGTGGGGG - Intronic
968907855 4:3462907-3462929 CTGTGGCCAGTCTGTTGTCCGGG + Intergenic
968964453 4:3762953-3762975 TTGGGCCCTGGCTGCTGTGCCGG - Intergenic
970190484 4:13511562-13511584 CTGGGGCATGGCTGTCTTCCAGG - Intergenic
972136708 4:35902450-35902472 CTGGGCCCTGGATCTTTTGCAGG - Intergenic
973712161 4:53640963-53640985 CTGAGGCCTGGCCGTTGTTTGGG + Intronic
975667257 4:76744429-76744451 CTAAGGTCTGGCTGCTGTGCAGG - Intronic
976161980 4:82211315-82211337 CTGAGGCCTGGCTATTGGGCAGG - Intergenic
976207639 4:82637999-82638021 CTGGGGCCTGTCAGTGGGGCAGG - Intronic
977619656 4:99121822-99121844 CTGGGGCCTGTCTGGGGGGCAGG - Intergenic
981371178 4:143960663-143960685 CTGGGGCTTGTCTGTAGTGGCGG + Intergenic
985012791 4:185601249-185601271 ATGGGGCCAGGCTGTTGGGTAGG + Intronic
985266887 4:188159196-188159218 CTGGGGCCTGTCGGTGGGGCAGG - Intergenic
985355836 4:189117515-189117537 CTGGAGCCTGGCAGCTCTGCTGG + Intergenic
985903219 5:2813486-2813508 CTGAGGCCTGGCCGATGTGCTGG - Intergenic
986061618 5:4197000-4197022 CTGGGGCCTGGGAGTTGTGCCGG - Intergenic
986172715 5:5326968-5326990 CTGAGGAGAGGCTGTTGTGCAGG - Intergenic
986334384 5:6742315-6742337 CTGGGGCCTGGGAGTCGTCCTGG + Intronic
986974730 5:13381806-13381828 CAGGGGTGGGGCTGTTGTGCTGG - Intergenic
989040814 5:37226304-37226326 CTGTGTCCTGGCTGTTGCACAGG + Exonic
989139540 5:38189250-38189272 CCGGGGCCTGGGTGTTGGCCCGG + Intergenic
989288815 5:39737362-39737384 CTGGAGCCTGGTTGGTGTGGTGG + Intergenic
990327682 5:54694340-54694362 CTGGGGCCTGCCAGCTGGGCAGG + Intergenic
990931675 5:61098412-61098434 CTGGGGCCTGGGTACTGTGCTGG - Intronic
991556314 5:67898536-67898558 CTGGGGCCTGTCTGCTCTTCTGG - Intergenic
992335392 5:75762838-75762860 CTGGGGCCTGTCAGTGGGGCAGG - Intergenic
992445811 5:76832476-76832498 CTGTGGCCTGGCTGTTTAGGAGG + Intronic
992682248 5:79164946-79164968 CTGTGGCCAGGCTGGAGTGCAGG - Intronic
996793238 5:127316028-127316050 CTGGGGCCTGCCTGTGGGCCTGG - Intronic
997453975 5:134004478-134004500 CGCGGGCCTGGCTGGTGAGCGGG - Intronic
999539001 5:152551169-152551191 CTGAGGCCTGCCTCTTGTCCTGG + Intergenic
1001982605 5:176047095-176047117 CTGGGGCCTGGGTGTTTTCCTGG + Intergenic
1002168007 5:177359942-177359964 CTGGGGCCAGGCAGTTCTGGGGG - Intronic
1002234858 5:177796962-177796984 CTGGGGCCTGGGTGTTTTCCTGG - Intergenic
1002445659 5:179288465-179288487 CTGTGGCCAGGCTGCTCTGCAGG + Intronic
1002522318 5:179798634-179798656 CTGGGCCCTGGGTGCTGTGCTGG - Intronic
1002564059 5:180100155-180100177 CTGGGGCCTTGCTGTGGTCCTGG + Intergenic
1002767544 6:255443-255465 CTGTGGCCTGGCTGACGTGGAGG + Intergenic
1003815529 6:9836132-9836154 CTGGGGCCTGTCGGGGGTGCGGG - Intronic
1003965457 6:11248583-11248605 AAGGGGCTTGGCTGTTCTGCTGG + Intronic
1004752415 6:18576355-18576377 CTGGGGCCTGTCTGTGGGGCGGG - Intergenic
1005852552 6:29832638-29832660 CAGGGAGGTGGCTGTTGTGCTGG + Intergenic
1006913078 6:37576786-37576808 CTGTGTGCTGGCTGTTGCGCAGG + Intergenic
1006932611 6:37697059-37697081 CGGGGCGCTGGCTGCTGTGCCGG - Exonic
1007278338 6:40691818-40691840 CAGAGGCCTGGCTGTTATACTGG + Intergenic
1007955206 6:45911838-45911860 CTGGGCCTTGGCTGCTGAGCTGG + Intronic
1008597159 6:53054119-53054141 CTGGGGCCTGGCTGAGGCACTGG - Intronic
1012067109 6:94561580-94561602 CTGCCACCAGGCTGTTGTGCAGG + Intergenic
1012247783 6:96945376-96945398 CTGGGGCATGCCTGTGGGGCAGG + Intronic
1014560089 6:122879461-122879483 CTGGGGCCTGTCAGTGGTGGGGG - Intergenic
1019031975 6:169021340-169021362 CAGGGGCCTGCCTTTTGTGTCGG + Intergenic
1019360635 7:602584-602606 CTGGGGCCTGGCGCTGGGGCAGG + Intronic
1019419761 7:945572-945594 CTGCGGCATGGCTGATGTGGTGG + Intronic
1019749048 7:2717408-2717430 CGGGGGCCTGGCTGCCGTCCTGG + Intronic
1019918842 7:4150211-4150233 CTGGGGCCTGTCTGGTTCGCAGG + Intronic
1020257268 7:6509148-6509170 CCGGGGCCTGGCTGTGGGGAGGG + Exonic
1021011643 7:15475528-15475550 CTGGGGCCTGTCGGATGTGGGGG + Intronic
1022117330 7:27273633-27273655 CTGGGGGGTGGCGGGTGTGCAGG + Intergenic
1023700624 7:42888700-42888722 CTGGGGCCTGGGTGGTGGGCGGG + Intergenic
1024059079 7:45685126-45685148 CTGGGTCCTGGCTTCTGGGCTGG - Intronic
1026530060 7:71189489-71189511 CTGGTGACTAGCTGGTGTGCAGG + Intronic
1027829110 7:83155271-83155293 CCGGGTCCTGCCTGTTGAGCTGG + Exonic
1030084124 7:105802780-105802802 CTAGAGCCAGGCTGCTGTGCAGG - Intronic
1032083997 7:128874228-128874250 CTGGGGCCCTGCTGTGGTGAGGG - Intronic
1032439111 7:131928332-131928354 CTGAGGCTTGGCTGGGGTGCTGG - Intergenic
1032768474 7:135023728-135023750 CTGGGGCATGTCTGTTCTTCAGG + Intronic
1035279390 7:157767791-157767813 CTGGGGCCTGGCTCTGCTCCAGG - Intronic
1037961495 8:23101799-23101821 CTGGGGCCTGGCAGGTGCCCAGG + Intronic
1037974385 8:23199593-23199615 CTGGGGCCAGGCCCTGGTGCTGG + Intronic
1038612524 8:29069362-29069384 CTGGGGCCTGGCGGCTGGGCTGG - Exonic
1040497278 8:47977381-47977403 CTGGGGCATGGTTTGTGTGCTGG + Exonic
1043435026 8:80229644-80229666 CTGTCGCCAGGCTGTAGTGCAGG - Intronic
1043693244 8:83184265-83184287 CTGGGGCCTGTCAGGGGTGCGGG - Intergenic
1043761612 8:84075768-84075790 CTGGGGCATGTTTGTTATGCTGG - Intergenic
1044186128 8:89254069-89254091 CTGGGGTATGACTGTTCTGCAGG - Intergenic
1045346130 8:101295112-101295134 CTGGGGCTTGGCCGTTTTGAGGG + Intergenic
1048033452 8:130654424-130654446 CTGGGGCCTGTTTGTAGTGAGGG + Intergenic
1049183335 8:141234822-141234844 CTGGAGCCTGGCTGTGCTGGGGG - Intronic
1049599243 8:143499369-143499391 CTGGGGCCTGGCTGCTGGGCGGG - Intronic
1049671763 8:143873137-143873159 CTGGGGCCTGGGGGGCGTGCCGG + Exonic
1049771210 8:144382878-144382900 CTGGTGCCGGGCTTTGGTGCAGG + Intronic
1050564875 9:6871742-6871764 TTAGGGCCTGGCTGTGGAGCAGG + Intronic
1050948524 9:11558310-11558332 CTGGGGCCTGACCATGGTGCTGG - Intergenic
1051445459 9:17135105-17135127 CTGGGGCCCAGCTGTCGCGCTGG - Exonic
1052650023 9:31290713-31290735 CTGGGGCATATCTGTTCTGCAGG + Intergenic
1054757460 9:68973745-68973767 CTGGGGCCTGGCTGGTGTTCAGG - Intronic
1055908435 9:81319777-81319799 CTGGGGCCAGGCAGCTGGGCAGG - Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056303708 9:85268750-85268772 CAGGGACCTGGCTGTTCTGGGGG + Intergenic
1056505408 9:87253719-87253741 CTTGGTCCTGGCTGTTGGCCAGG - Intergenic
1056764632 9:89437165-89437187 CAGGGCCCTGGCTGCTCTGCGGG + Intronic
1056812834 9:89777608-89777630 AGGGGGCCAGGCTGGTGTGCGGG - Intergenic
1057437425 9:95055273-95055295 CTGTGGCCTGGCTAGTGTGTGGG + Intronic
1059923815 9:119186488-119186510 CTTGGGCATGGCTTTTCTGCTGG - Intronic
1059964416 9:119599733-119599755 CTGGGGCCTGCATGATGTGTGGG + Intergenic
1060204935 9:121676868-121676890 CTGGTGCCACGCTGTTGTGGGGG + Intronic
1061296691 9:129680682-129680704 CTGGGGGCGGGGTGTTGGGCTGG - Intronic
1061558939 9:131390250-131390272 CTGGGGCCATGCTGTTGAACTGG - Intergenic
1062102961 9:134737984-134738006 CTGGGGCCTGACGGTGGTCCTGG + Intronic
1062273559 9:135720551-135720573 CAGGGGCCAGGCTGGTGTGTGGG - Intronic
1062276926 9:135735678-135735700 CTGGGCCCTGGCTGTTGGTTGGG + Intronic
1062523236 9:136968255-136968277 ATGGGGCCCGGCTGGTGTGCAGG - Intergenic
1062547923 9:137072060-137072082 CGGGGGCTTGCGTGTTGTGCTGG - Intergenic
1185612165 X:1399156-1399178 CAGAGGCCTGGCTGCTCTGCAGG + Intergenic
1186247663 X:7631589-7631611 CTGGGGCATGTCTGTTATGCAGG + Intergenic
1186822516 X:13305038-13305060 CTGGAGCCTTGCTGATGTGGTGG + Intergenic
1187478329 X:19631543-19631565 CTGCAGCCTGGCTGCTGTGGAGG + Intronic
1189831038 X:44973264-44973286 CTGGGGCATAGCTGCTGTCCTGG + Intronic
1190561510 X:51690745-51690767 CTGGAGCCTGGTTGTAGTGGTGG + Intergenic
1190562781 X:51702570-51702592 CTGGAGCCTGGTTGTAGTGGTGG - Intergenic
1190650427 X:52563538-52563560 CTACGGCCTTGCTGTCGTGCAGG - Intergenic
1191963023 X:66724567-66724589 CTGGAGCCTGTCAGTTGTGGGGG + Intergenic
1193871078 X:86799252-86799274 TTGGGGTCTGGCTGTTGGGAAGG - Intronic
1194827088 X:98577223-98577245 CTGGGAGCTGGCTGTAGTGGAGG + Intergenic
1196324610 X:114388729-114388751 CTGTGGCCTGCCTGGTGTGGTGG - Intergenic
1196419977 X:115511202-115511224 CAGGGGCCTAACTGTTGTCCTGG + Intergenic
1198307661 X:135398941-135398963 CTGTGGCATGGCTGCTGTGTAGG - Intergenic
1199416376 X:147587514-147587536 ATGGTGCCTGGCTGTTTTCCAGG - Intergenic
1200047896 X:153412164-153412186 CTGGTGCCTCGCGGTGGTGCGGG + Intergenic
1200215455 X:154366238-154366260 CTGGGGCCTGGGAGCTGAGCAGG - Intronic
1201349489 Y:13023875-13023897 CTGGGGCATGTCTGTCCTGCAGG - Intergenic
1202097220 Y:21264242-21264264 CTTGGGCATGTCTGTTTTGCAGG - Intergenic