ID: 907241460

View in Genome Browser
Species Human (GRCh38)
Location 1:53083563-53083585
Sequence CAGAGAAAACGGAAGACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 303}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907241460_907241469 22 Left 907241460 1:53083563-53083585 CCTCCAGTCTTCCGTTTTCTCTG 0: 1
1: 0
2: 0
3: 33
4: 303
Right 907241469 1:53083608-53083630 GACCAAAGGTATGGAGAAAATGG 0: 1
1: 0
2: 1
3: 33
4: 458
907241460_907241472 30 Left 907241460 1:53083563-53083585 CCTCCAGTCTTCCGTTTTCTCTG 0: 1
1: 0
2: 0
3: 33
4: 303
Right 907241472 1:53083616-53083638 GTATGGAGAAAATGGACAGGTGG 0: 1
1: 0
2: 2
3: 24
4: 309
907241460_907241466 8 Left 907241460 1:53083563-53083585 CCTCCAGTCTTCCGTTTTCTCTG 0: 1
1: 0
2: 0
3: 33
4: 303
Right 907241466 1:53083594-53083616 GGAGGTTCTCCGCAGACCAAAGG 0: 1
1: 1
2: 0
3: 3
4: 57
907241460_907241467 13 Left 907241460 1:53083563-53083585 CCTCCAGTCTTCCGTTTTCTCTG 0: 1
1: 0
2: 0
3: 33
4: 303
Right 907241467 1:53083599-53083621 TTCTCCGCAGACCAAAGGTATGG 0: 1
1: 0
2: 0
3: 4
4: 74
907241460_907241465 -10 Left 907241460 1:53083563-53083585 CCTCCAGTCTTCCGTTTTCTCTG 0: 1
1: 0
2: 0
3: 33
4: 303
Right 907241465 1:53083576-53083598 GTTTTCTCTGTGCAGCAGGGAGG 0: 1
1: 2
2: 23
3: 82
4: 388
907241460_907241471 27 Left 907241460 1:53083563-53083585 CCTCCAGTCTTCCGTTTTCTCTG 0: 1
1: 0
2: 0
3: 33
4: 303
Right 907241471 1:53083613-53083635 AAGGTATGGAGAAAATGGACAGG 0: 1
1: 0
2: 3
3: 35
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907241460 Original CRISPR CAGAGAAAACGGAAGACTGG AGG (reversed) Intronic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
903867299 1:26409235-26409257 CAGAGAGACCGGATGAGTGGGGG - Intergenic
904209070 1:28873872-28873894 AAGGGAAAAGGAAAGACTGGTGG + Intergenic
905346755 1:37316513-37316535 CAGAGAAGAAGGAACATTGGTGG - Intergenic
905604370 1:39284386-39284408 GAGAGAAAAAGGAAGAATTGAGG + Exonic
906112272 1:43331977-43331999 CAGAGAAAACGGAGGAGGGCCGG - Intergenic
907241460 1:53083563-53083585 CAGAGAAAACGGAAGACTGGAGG - Intronic
908757888 1:67485785-67485807 CAGAGAAGACTCAAGAGTGGAGG + Intergenic
909014569 1:70368619-70368641 GGGAGAAGAAGGAAGACTGGAGG - Intronic
909763390 1:79323101-79323123 GAGAGAAAAGGGAAGATTTGAGG - Intergenic
910574245 1:88740995-88741017 CTCAGAAAACGGAAGACTTCGGG - Exonic
911957511 1:104256346-104256368 GAGAGAAAAGGGAAGAATGAAGG - Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913363202 1:118005057-118005079 CAGAGCAAACACAAGACAGGAGG - Intronic
915865182 1:159491860-159491882 CAGATAAACCAGAAGACAGGTGG - Intergenic
917083694 1:171283997-171284019 TAGAGACAATGGAAGACTGATGG + Intronic
917443981 1:175091258-175091280 GAGAGAAAAGGGAAGGCAGGGGG + Intronic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
917737645 1:177935050-177935072 CAGAGAAACAGCAGGACTGGAGG - Intronic
917801440 1:178574205-178574227 CAGAGTAAATGTAAGACAGGAGG - Intergenic
919394664 1:197030280-197030302 CAGAGAAGAAGCAAGACTAGAGG + Intergenic
919735511 1:200947870-200947892 CAGAGAACAGGGAGGTCTGGAGG + Intergenic
920067087 1:203276725-203276747 CAGAGAAATCTGAAGATTTGGGG + Intergenic
920740665 1:208578536-208578558 CAGAGTAAAAGGAATAGTGGGGG - Intergenic
920823594 1:209403749-209403771 CAGAGAACACAGAACACTCGAGG + Intergenic
920828024 1:209440249-209440271 CAGAGAAAAGAAAAGACAGGAGG + Intergenic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
923239884 1:232073143-232073165 CAGAGAAAACCTAACACTGGAGG - Intergenic
923791871 1:237118525-237118547 CAGAGACAACGGTAGAATGGTGG + Intronic
924174910 1:241380675-241380697 CAGTGAAAAAGGAAGAGTAGAGG + Intergenic
924611209 1:245575179-245575201 CAAAGAAAAAGGTAGGCTGGGGG + Intronic
924749909 1:246876896-246876918 AAGAGAATAAGGAAAACTGGAGG - Intronic
1063731971 10:8708228-8708250 CAGAGAAAAGGGAACACTGTTGG - Intergenic
1065082272 10:22140313-22140335 CAGAGGAAAGGGAAGAGTGCAGG + Intergenic
1065413683 10:25460629-25460651 CAGAGAAAAGGGTAGATTTGGGG - Intronic
1066132967 10:32412488-32412510 CATAGAAAAGGGAGAACTGGTGG + Intergenic
1069760092 10:70804124-70804146 AAGAGAAAAGGAAAGAATGGAGG + Intergenic
1070493842 10:77002927-77002949 CAAAGAAAAAGAAAGAGTGGGGG - Intronic
1071901277 10:90122681-90122703 CAGAGGAAAAGCAAAACTGGAGG - Intergenic
1074164579 10:110863853-110863875 CAGAGGAAAGGTAAGTCTGGTGG + Intergenic
1076557408 10:131336281-131336303 CAGAGAAGTGAGAAGACTGGAGG + Intergenic
1077723423 11:4649741-4649763 CAGAAAAAAAGAAACACTGGAGG + Intronic
1078706097 11:13745632-13745654 TAGAGAAAAGGGGAGACTGGAGG + Intergenic
1079119950 11:17674913-17674935 CAGAGAAAGAAGAAGCCTGGAGG + Intergenic
1079199847 11:18367366-18367388 AAGAGAAATGGGAAGACTGAAGG - Intergenic
1079983728 11:27178463-27178485 CAGAGAAAATGGAAGACTTCAGG - Intergenic
1080994491 11:37582498-37582520 CAGAGAAGAAGGAGGAATGGAGG + Intergenic
1085060159 11:73438545-73438567 AAGATAAAAAGGTAGACTGGGGG + Intronic
1085859948 11:80221551-80221573 TAGAGAAAAGGAAAGACAGGAGG + Intergenic
1087848802 11:103004480-103004502 CAGAGGAAAAGGAACACTGTTGG + Intergenic
1088187672 11:107191072-107191094 TAGAGACAAAGGAAGGCTGGTGG + Intergenic
1088423268 11:109671940-109671962 GAGAGAAAATGGAAGATTAGAGG - Intergenic
1089743365 11:120600234-120600256 CTGAGAAGCCGGAAGCCTGGTGG - Intronic
1090931936 11:131305478-131305500 CAGAGAACACGGTGGAATGGTGG + Intergenic
1091024573 11:132130724-132130746 CAGAGAATAGGGAAGTCTGATGG + Intronic
1091951452 12:4596375-4596397 AAGACAAAAGGGAAGATTGGAGG - Intronic
1092279715 12:7090024-7090046 CAGAGAAAAGGGATCCCTGGGGG + Intronic
1094697470 12:32834686-32834708 AAGAGAAGAAAGAAGACTGGGGG + Intronic
1095362413 12:41359081-41359103 CAGAGAGAAGGAAAGACTTGCGG - Intronic
1095427468 12:42092588-42092610 AAGAGAAAACAGACAACTGGGGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096605123 12:52759614-52759636 CAGAGAAAACCTAGGACTTGAGG - Intergenic
1097437453 12:59568898-59568920 CAGAGAAAATAGAAGAGTCGAGG - Intergenic
1097968421 12:65606179-65606201 CAGAGAACATGTCAGACTGGAGG + Intergenic
1098049598 12:66439433-66439455 GAGAGAAAAGGGAAGACTTAAGG - Intronic
1098632138 12:72737177-72737199 AAAAGAAAACTGAAGCCTGGAGG - Intergenic
1098833891 12:75397282-75397304 AAGAGAAAACAGGACACTGGGGG - Intronic
1098881542 12:75922265-75922287 GAGAGGAAATGGAAGAATGGTGG - Intergenic
1098958767 12:76715994-76716016 AAGAGAAAACGGAAGTCAGCTGG + Intergenic
1098968996 12:76829080-76829102 CAGAGAAAAAGGAACGCTGTTGG + Intronic
1099511381 12:83543177-83543199 GAGAGGAAAGGCAAGACTGGTGG - Intergenic
1099927129 12:89031993-89032015 CAGAGAAAAGTCAAGCCTGGTGG + Intergenic
1100739792 12:97579460-97579482 AAGAGGAAAGGGAAGAATGGAGG - Intergenic
1100962558 12:99979358-99979380 CAGAGTAAAAGGAAAACTGTGGG + Intronic
1102230098 12:111256436-111256458 CAGAAGAAGCTGAAGACTGGTGG - Intronic
1103336108 12:120190995-120191017 ATGAGAAAACTGAAGATTGGGGG - Intronic
1105680201 13:22718150-22718172 CAGAGAAAACGGAAGCGAGATGG + Intergenic
1108085886 13:46793008-46793030 CAGAGAAAACTGACAACTTGAGG - Intronic
1108208151 13:48112017-48112039 CAGGGAGAAAGGAAGACTGCAGG + Intergenic
1108488813 13:50957725-50957747 CAGAGAAAAGGGAACACTTTTGG - Intronic
1108561147 13:51645523-51645545 GAGAGAAAAGGGAAGGCTGGGGG - Intronic
1109342860 13:61084092-61084114 CAGAGTAGAAGGAAGAGTGGGGG + Intergenic
1110766938 13:79290999-79291021 AAAAGAAAACGGAAAACTGTTGG - Intergenic
1110776784 13:79416924-79416946 AAGAGAAAAGGAAAGAATGGTGG - Intergenic
1114301732 14:21384720-21384742 CAGAGGAAACAGATGACTTGAGG + Intergenic
1115070154 14:29312363-29312385 CAGAGACAATCGAAGGCTGGAGG + Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115450073 14:33537836-33537858 CAGAGAAGAGGGGAGCCTGGGGG + Intronic
1116316109 14:43394540-43394562 CCCAGAAAAGGGAAGAATGGGGG - Intergenic
1116584964 14:46691870-46691892 AATAGAAAATGGAAGTCTGGAGG - Intergenic
1117183361 14:53215081-53215103 GAGAGAAAAAGGAAGAGTTGAGG - Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1118065409 14:62185322-62185344 CAGAGAAATCTGAACACTGCTGG + Intergenic
1118380134 14:65211368-65211390 CACAGAGAAGGGAAGACTGCTGG - Intergenic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120249827 14:82049834-82049856 GAGAGGAATGGGAAGACTGGTGG + Intergenic
1120554981 14:85918632-85918654 AAGAGAAAGCGGAAGGATGGAGG + Intergenic
1122761600 14:104032895-104032917 CAGAGAAATCTGAGGCCTGGCGG + Intronic
1123184203 14:106499048-106499070 CAGTGAAAAGGGAACACTGGCGG - Intergenic
1123979483 15:25587490-25587512 GAGAGAAAACTATAGACTGGGGG + Intergenic
1124151785 15:27186628-27186650 CAGAGAAAAGGGAATATTGTTGG - Intronic
1124642734 15:31406525-31406547 CAGAAAAAAAGAAAGAATGGAGG + Intronic
1125181543 15:36885337-36885359 TAGAGAAAAAGGAAGGCAGGTGG + Intergenic
1125313706 15:38408339-38408361 AAGAGAAAATGGAAAACTGAAGG + Intergenic
1126491666 15:49243637-49243659 CAGAGAAAACAGGAAACTAGAGG + Intronic
1126851432 15:52799269-52799291 GAGAGAGAAAGGAAGACGGGAGG - Intergenic
1129684267 15:77676279-77676301 CAGAGGAGAAGGGAGACTGGGGG + Intronic
1130282695 15:82532018-82532040 CAGAGAAAAGGGAAGCCTGACGG - Intergenic
1130634982 15:85609824-85609846 CAGAGAAAATGGAAGAGAGGAGG - Intronic
1131322552 15:91408748-91408770 CAAAGAAATCGGAGGGCTGGAGG + Intergenic
1131976346 15:97949644-97949666 CATAGAAAAAGGAACACTGTTGG - Intergenic
1133302621 16:4792085-4792107 CAGAGAGACAGGAAGACTGAGGG + Intronic
1133443023 16:5836508-5836530 CAGAGAATAAGGAAGTATGGAGG - Intergenic
1137399601 16:48142480-48142502 CAGAGAGAACGGCAGAGAGGTGG + Intronic
1138158694 16:54731783-54731805 GAGAGCAAAAGGAGGACTGGAGG - Intergenic
1138263109 16:55639785-55639807 GAGAGAAAAAGAAAGATTGGAGG + Intergenic
1138717485 16:59040580-59040602 AAGAGAAAACAGAAAACTGAGGG + Intergenic
1141284833 16:82661738-82661760 CAGAGAACACGGAGTATTGGGGG + Intronic
1141816206 16:86410883-86410905 CAGAGCAAGGGGATGACTGGAGG + Intergenic
1144036109 17:11367436-11367458 CAGAGAACAGGGAACACTGGAGG + Intronic
1148125211 17:45233194-45233216 CCGAGAACAGGGAAGGCTGGTGG - Intronic
1148250938 17:46079588-46079610 CAGATAAAAAGGAAGAATGCAGG - Intronic
1148907648 17:50921361-50921383 CAGAGAAAGCAGAAGTGTGGAGG - Intergenic
1149197319 17:54136675-54136697 CAGACAGAACTGAAGACTGAAGG + Intergenic
1149344305 17:55718772-55718794 CAGATAAAAGGGAAGACTTCCGG + Intergenic
1150225219 17:63520999-63521021 CAGAGAATAGGGAAAACTTGAGG + Intronic
1150608392 17:66713797-66713819 CAGAGAAAACCAGTGACTGGGGG - Intronic
1151857730 17:76735123-76735145 CAGTGTAAACGGAGGACTTGGGG - Exonic
1151921965 17:77163763-77163785 AAGAAAAAACGGAAGGCTGGGGG - Intronic
1152103438 17:78315767-78315789 CAGGGAAAATGGAAGGCGGGCGG + Intergenic
1152463882 17:80455113-80455135 CAGGGAAAACGGGCGACCGGGGG - Intergenic
1153153879 18:2127293-2127315 CAGAGAGACATGAAGACTGGAGG - Intergenic
1153428604 18:4991712-4991734 GAAAGAAAAGGAAAGACTGGAGG + Intergenic
1153506834 18:5809232-5809254 CAGAGAAAGGGGAACACTGTTGG - Intergenic
1154043322 18:10880295-10880317 CAGAGAAGAAGCAAGACAGGTGG + Intronic
1154324390 18:13379667-13379689 CAGAGAGCAGGGAAGACTGTGGG + Intronic
1154352876 18:13601490-13601512 CAGAGAAAAGGGAACACTTCCGG + Intronic
1157048376 18:44130570-44130592 CACAGAACACGGACCACTGGTGG + Intergenic
1157448224 18:47764332-47764354 CAGAGAAAACAGAATGCTGTTGG + Intergenic
1157560582 18:48642846-48642868 CAGAGAAAAAGGAGCTCTGGAGG + Intronic
1158159961 18:54469839-54469861 CAGTGAAAAGTGAAGACTTGTGG + Intergenic
1159048642 18:63395818-63395840 CAGACAAAACAGAACACAGGAGG + Intronic
1159505837 18:69334004-69334026 GAGAGAAAGAGGAAGAGTGGGGG - Intergenic
1160243561 18:77139837-77139859 CAGAGAACAAGGAAGTTTGGGGG - Intergenic
1160290977 18:77593325-77593347 CAGAGAAAATGGAAAGTTGGAGG - Intergenic
1161898234 19:7098901-7098923 CGGAGAAAACTGAAGCCGGGCGG + Intergenic
1163214608 19:15866730-15866752 CAGAGAAAAGGGAACACTGCTGG - Intergenic
1164923901 19:32110752-32110774 CAGAGAAATCACAAGACAGGTGG + Intergenic
1166622543 19:44314777-44314799 GAGAGAAAAGGAAAGACTGATGG - Intergenic
1166776873 19:45318426-45318448 GAGAGAACACTGAGGACTGGTGG + Intronic
1167649465 19:50721486-50721508 CTTGGAAAACGGAAGGCTGGAGG + Intergenic
1168703977 19:58457674-58457696 GAGACAAAAGGGTAGACTGGGGG + Exonic
927522496 2:23707874-23707896 CTGAGAAAAGGGAAGCCAGGAGG + Exonic
929857051 2:45646293-45646315 GAGAGAAAAAGGATGTCTGGAGG - Intergenic
931460166 2:62443438-62443460 CAGAGAACCCGGAACACTAGAGG + Intergenic
931853795 2:66280652-66280674 CAGAGAAATGAAAAGACTGGAGG - Intergenic
932155984 2:69418096-69418118 GAAAGAAAACTGAAGAATGGGGG + Intronic
932158326 2:69438071-69438093 TAGAGAAAACGGAATACTCCAGG - Intergenic
932796122 2:74697861-74697883 AAGAGAAGGGGGAAGACTGGGGG - Intergenic
933674247 2:85039696-85039718 CAGATAAAAAGCAAGACTGATGG + Intronic
936172802 2:110191011-110191033 CAGAGAAAAAGGAACACTTGGGG + Intronic
936407123 2:112214725-112214747 CAGAGGAAAGGGGAGAATGGAGG + Exonic
937753000 2:125500352-125500374 TAGAGAAAAGGGAACACTGGTGG - Intergenic
938996063 2:136679598-136679620 CAGAGTAAACAGAAGACTTTTGG + Intergenic
939682525 2:145156204-145156226 AAGAGAAAACTGAACACTGTGGG - Intergenic
940136807 2:150446377-150446399 GAGAGAAAACTGAAGCCTGTGGG - Intergenic
942863848 2:180648693-180648715 GAGGGAAATTGGAAGACTGGGGG - Intergenic
946353829 2:219172591-219172613 CTGGGAAAACGAAAGACTTGAGG + Exonic
947136405 2:226980410-226980432 AAGAGAAAACGGGAGATTTGGGG + Intronic
947776426 2:232714700-232714722 CACAGAAAACAGAACAGTGGTGG - Intronic
948741635 2:240051282-240051304 CAGATGACAAGGAAGACTGGGGG + Intergenic
1168975481 20:1962508-1962530 CAGACAAAGGGGAAGCCTGGGGG + Intergenic
1169584991 20:7071692-7071714 CACAGAAGACGGAAGACGAGAGG - Intergenic
1170347639 20:15404705-15404727 TAGAGAGAAAGGAAGACTGTGGG - Intronic
1171030164 20:21669712-21669734 AAGAGCAAAGGGAAGCCTGGGGG + Intergenic
1171105024 20:22424825-22424847 AATAGAAAATGGTAGACTGGAGG - Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1171568999 20:26227952-26227974 AAGAGAAAAGGGATGAATGGTGG - Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172644792 20:36462477-36462499 CAGAGAGAAGGGGAGACAGGGGG - Intronic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173197317 20:40926428-40926450 CAGGGAAAAAGGAAGAGTGCTGG + Intergenic
1174250673 20:49217263-49217285 GAGAGAGAACGGAGCACTGGAGG - Intergenic
1174462136 20:50690590-50690612 CACAGAATACAGAATACTGGGGG + Intronic
1177923469 21:27183959-27183981 GAGAGAAAACTCAAGATTGGTGG + Intergenic
1178197386 21:30362933-30362955 CAGAGAAAAGGGAACACTGTTGG + Intronic
1178376539 21:32072246-32072268 CAGAAAAAAGGGGAGAATGGAGG - Intergenic
1178935500 21:36858439-36858461 TACAGAAAACAGAAGATTGGGGG + Intronic
1180079174 21:45478636-45478658 CAAAGAAAAAGGAAGTCGGGCGG + Intronic
1180149213 21:45939154-45939176 CAGAGAAAGCCCCAGACTGGAGG - Intronic
1180281929 22:10707695-10707717 AAGAGAAAAGGGATGAATGGTGG + Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1182698297 22:32211122-32211144 CAGATAAAAAGGAAGACAGAGGG + Intergenic
1183037044 22:35148329-35148351 CTGAGAAAACGGAAAACTGAAGG - Intergenic
1185211692 22:49574184-49574206 CAGAGAAAACTGGAGAGTGATGG + Intronic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949121258 3:387323-387345 CAGAGGGAAGGGAAGGCTGGTGG + Intronic
949433367 3:4002497-4002519 AAGAGAAAAAGCAAGGCTGGGGG + Intronic
949493033 3:4607550-4607572 CTGACTAAATGGAAGACTGGAGG + Intronic
949725768 3:7042515-7042537 CAGAGAAAAAGAAAGAATGGGGG - Intronic
950216653 3:11164576-11164598 CAGAGAAAAAGTAAGCATGGAGG - Intronic
950406583 3:12808848-12808870 CAGAGACAGGGGAAGACTTGGGG + Intronic
951163307 3:19453194-19453216 CAGGAAAAGTGGAAGACTGGAGG + Intronic
952445142 3:33373815-33373837 CAGAGAAAACAAAAGACAGCTGG - Intronic
954559692 3:51546338-51546360 CAGATAAAAAGGAAAACTGAAGG + Intronic
956629069 3:71296874-71296896 AAGAGAAAAAGGAAGCTTGGAGG - Intronic
957109849 3:75940378-75940400 AAGAGAAAAGGGATGAATGGTGG + Intronic
957115567 3:76019973-76019995 CAGAGAAAACCGAAGCATGTGGG - Intronic
957194667 3:77052040-77052062 AAGAGAAAACGGAAGAATCTGGG - Intronic
957882945 3:86245360-86245382 CAGAGAAAATTGAAGACTAAAGG + Intergenic
962894395 3:139700840-139700862 AAGAGAGAACAGAAGATTGGTGG + Intergenic
962920335 3:139944526-139944548 CAGAGAAAATAAAGGACTGGTGG - Intronic
963428971 3:145171986-145172008 CAGAAGAGAAGGAAGACTGGAGG + Intergenic
963870134 3:150407971-150407993 CCGAGACAGTGGAAGACTGGAGG - Intergenic
964637122 3:158870318-158870340 CAAAGAAGACGGAAGCTTGGGGG - Intergenic
965015948 3:163156713-163156735 CAAAGCAAACGGAACACTTGAGG - Intergenic
965432262 3:168604294-168604316 CACAGACAAAGGAAGACAGGAGG - Intergenic
965496895 3:169409876-169409898 CAGAGAAAACGCAATATTGTGGG + Intronic
966331473 3:178819477-178819499 CAGAGAGGAAGGGAGACTGGAGG - Intronic
966531144 3:180981814-180981836 CAGAGAAAGCTGAAGCCTCGAGG + Exonic
968089136 3:195889186-195889208 CACAGCAAGCGGAAGACAGGAGG + Intronic
969680326 4:8639747-8639769 CAGAGAAAACAGAGGCCAGGAGG - Intergenic
970398328 4:15694082-15694104 CAGAGAACAAAGGAGACTGGGGG + Intronic
972901351 4:43687947-43687969 CAAACAAAACAGAAGACAGGTGG + Intergenic
973104016 4:46309248-46309270 AAAAGAAAACGGAAGAATGGTGG - Intronic
977783216 4:101003814-101003836 CAAAGAAAAATGAAGAGTGGAGG - Intergenic
979833531 4:125331069-125331091 AAGAGAAAAACGAAAACTGGAGG - Intronic
980346552 4:131629227-131629249 CATAGAAAAAGGAAGAGTTGGGG - Intergenic
980567362 4:134561035-134561057 CAGAGAAATCCTAAAACTGGAGG - Intergenic
980689014 4:136267571-136267593 CAGAAAAAAGGGAAAACTCGGGG + Intergenic
980954761 4:139417036-139417058 CAGAGGAAATGGATGAATGGAGG - Intronic
982928710 4:161373833-161373855 CACATAAAACAGAAGACTGTGGG - Intergenic
983336973 4:166408562-166408584 CAGAGGAAAAGAAACACTGGAGG + Intergenic
984056364 4:174934089-174934111 CAGAGAAAAGGGAACACTGTTGG - Intronic
985723395 5:1502416-1502438 CAGAGAAGACGGCAGAATGAAGG + Intronic
986220319 5:5763217-5763239 CAGAGAACAAGGAAGCCTGTTGG - Intergenic
986441392 5:7785482-7785504 CAGAGAAAATGCAAGAGGGGTGG - Intronic
987183864 5:15395513-15395535 CTGAGAAAATGGAAGACATGGGG - Intergenic
987221823 5:15798363-15798385 CAAAGAAAAGGGGAAACTGGAGG - Intronic
987447500 5:18038486-18038508 CAGAGGAGAGGGAAGACTGATGG - Intergenic
987765660 5:22226062-22226084 AAAAGAAAAGGGAAGACTGTGGG - Intronic
988001204 5:25351467-25351489 AAGACAAAAGAGAAGACTGGAGG + Intergenic
988679657 5:33472445-33472467 CAGAGAAAAAAAATGACTGGTGG - Intergenic
988927978 5:36008359-36008381 CAGAGAAAAAGGAAGGCAGGGGG + Intergenic
990955545 5:61334644-61334666 CATAGAAAAGGCAACACTGGGGG - Intronic
992095061 5:73355323-73355345 CACAGAAACAGAAAGACTGGTGG - Intergenic
992597301 5:78359993-78360015 CAGAGAGACCGGAAGATGGGAGG + Intergenic
993050943 5:82925136-82925158 CAGAGAAAGCAGGAAACTGGAGG - Intergenic
994333601 5:98537895-98537917 AAGAGAAGACTGAAAACTGGAGG + Intergenic
997878232 5:137567984-137568006 AAAAGAAAAAGGAAGACAGGGGG + Intronic
997934323 5:138097337-138097359 CAGAGAAAGCAGAGGTCTGGGGG - Intergenic
998641808 5:144020294-144020316 GAGAGAAAAGGGAAGACTTCAGG + Intergenic
1000865988 5:166515259-166515281 AAGAGATAACCGAAGAGTGGAGG - Intergenic
1001165270 5:169359799-169359821 CAGAGAAAAGGGAACACTGTTGG + Intergenic
1002968498 6:1991180-1991202 CAGAAAGAAGGGAAGACTGGTGG - Intronic
1003166363 6:3682411-3682433 GAGAGGAACCAGAAGACTGGAGG - Intergenic
1003990125 6:11478279-11478301 CAGAGAAAAGGGAACACTTTTGG + Intergenic
1004893164 6:20121443-20121465 CAAAGAAAAGGGAAGCATGGGGG + Intronic
1004943333 6:20584953-20584975 CAGAGAAAGCAGAAAACTGCAGG - Intronic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005631597 6:27713276-27713298 CAGAGAAAAGTGAAGACGGGTGG + Intergenic
1006678381 6:35779616-35779638 CAGGCAAAAGGGGAGACTGGAGG + Intergenic
1007071485 6:39041431-39041453 CAGAGAAAAAGGCAGACAAGTGG + Intergenic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1010619534 6:78056923-78056945 CAGAGAAAAAGGAATACTGATGG - Intergenic
1011329957 6:86193076-86193098 CAGGGAGAAATGAAGACTGGAGG + Intergenic
1012533556 6:100268065-100268087 GAGAGGAAAAGGAAGGCTGGTGG - Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1013289461 6:108708110-108708132 CACAGAAAATGGTAAACTGGGGG - Intergenic
1014321697 6:119937613-119937635 CAGAGAAAAGGGAATGCTGGTGG - Intergenic
1014531551 6:122564864-122564886 CAGAGAAACCCTAACACTGGCGG - Intronic
1016449420 6:144166484-144166506 CAGAAAGAAAGGAAGACTGAGGG - Intronic
1017385267 6:153875817-153875839 CACAGAAAAAGGAAGCCTCGAGG + Intergenic
1017656473 6:156634082-156634104 GAGAGAACACGGAGGGCTGGTGG + Intergenic
1017837323 6:158190264-158190286 CTGAGCAAATGGAAGACTGGAGG - Intronic
1019162177 6:170076054-170076076 GAGAGAGAACGCAAGACGGGAGG + Intergenic
1020979001 7:15044587-15044609 CAAAGAAAACAGCAGACTAGAGG - Intergenic
1024886657 7:54149746-54149768 CAGAGCAGACAGAAGCCTGGGGG + Intergenic
1027158083 7:75782528-75782550 GGGAGAAAAAGGAAGAATGGAGG - Intronic
1029611403 7:101628462-101628484 AAAAGAAAACAGAAAACTGGAGG + Intronic
1029884951 7:103858958-103858980 CAGAGAAAGAAGAAGACTGGAGG + Intronic
1031750524 7:125566774-125566796 CAGAGAAAAGTGAAGACATGAGG + Intergenic
1031908505 7:127488319-127488341 AAGAGAGAAAGGAAGACAGGAGG + Intergenic
1033477404 7:141703767-141703789 CAGAGAAAAGGTCAGACTAGTGG + Intergenic
1036790806 8:11718028-11718050 CAGAGAAAAGGGAACACAGAGGG - Intronic
1038144799 8:24885520-24885542 CATAGAAAATGGAAGAATGGGGG - Intergenic
1039118473 8:34118909-34118931 CAGAGAAACCTGAAGGCAGGTGG - Intergenic
1040449229 8:47527304-47527326 CAGAGAAACAGGAAGGCTGGAGG - Intronic
1040500152 8:47998431-47998453 CAGAGGAACCAGAAGCCTGGAGG + Intergenic
1040866450 8:52053158-52053180 CAGAGAAAATAGAATACTAGAGG - Intergenic
1041254743 8:55970590-55970612 CAGTGAAAAAGGAAGACTATAGG - Intronic
1042346932 8:67737036-67737058 CATTGAAAAGGGAAGATTGGAGG - Intronic
1042819529 8:72915339-72915361 CAGAAAACAAGCAAGACTGGAGG + Intronic
1044799732 8:95941961-95941983 CATAGAAAATGTAAGAATGGAGG - Intergenic
1046083900 8:109407895-109407917 CAGAAAAGAAGGAAGAATGGGGG - Intronic
1046350621 8:113006341-113006363 CAGAGTTAAAAGAAGACTGGTGG + Intronic
1048338810 8:133523237-133523259 CAGAGAACATGGGAGACTGGAGG + Intronic
1049226996 8:141458865-141458887 TAGTGAAAATGGAAGACAGGAGG + Intergenic
1050672302 9:8011169-8011191 CAGAGAAAGCGAGAGACTGGGGG + Intergenic
1050957440 9:11682421-11682443 AAGAAAAAAAGGAAGACTGAGGG + Intergenic
1051887285 9:21906569-21906591 CAGAGAAAATGGAGGATTAGTGG + Intronic
1052492178 9:29183861-29183883 CAGTGTGAACGGAAGACTGAGGG - Intergenic
1054803997 9:69380780-69380802 TAAAGAAAACCGAAGACTGAGGG + Intronic
1055997819 9:82180877-82180899 CAGAACAAAGGGAAGACTTGAGG - Intergenic
1056286427 9:85091971-85091993 CAGAGAAAATGGGAGGCAGGGGG + Intergenic
1056785814 9:89591848-89591870 AAGAGAAAACGGAACATTAGAGG - Intergenic
1057839855 9:98477523-98477545 CAGAGAAAATGGAGGTGTGGTGG - Intronic
1057883790 9:98813039-98813061 CAGAGAAAATGGTAAACTTGTGG - Intronic
1059244625 9:112839193-112839215 GAGAGAACAGGGAAGACTGAGGG + Intronic
1059251826 9:112892647-112892669 CAGAGAACTCAGAAGCCTGGGGG - Intergenic
1059802130 9:117760980-117761002 CATAAAAAAGGGATGACTGGGGG - Intergenic
1185627965 X:1495834-1495856 CACAGAATACCGTAGACTGGGGG - Intronic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1187993657 X:24902647-24902669 AAGAGGAGAGGGAAGACTGGTGG - Intronic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188767404 X:34112441-34112463 CAGAGATAACGGAGGGGTGGGGG - Intergenic
1192980029 X:76329590-76329612 CAGAGACAACTTAAGATTGGAGG + Intergenic
1194031815 X:88826181-88826203 CAGAGAAAAGTGAAAAGTGGGGG - Intergenic
1197072610 X:122317998-122318020 CAGAGATCACAGAAGGCTGGTGG - Intergenic
1197224317 X:123941277-123941299 CAGAGAAAAAGGAATAAAGGTGG + Intergenic
1198156283 X:133963996-133964018 CAGAGAGAAAGGAACCCTGGGGG - Intronic
1200137573 X:153882497-153882519 CAGACAAACAGGAATACTGGAGG + Intronic
1200179062 X:154139349-154139371 AACAGAAAAAGGAAGACAGGAGG - Intergenic
1201679584 Y:16629184-16629206 CAGAGGAACCAGAAGACAGGAGG + Intergenic
1202372730 Y:24209496-24209518 CAGAGAAGACGGAACCCTGAGGG + Intergenic
1202376888 Y:24246220-24246242 CAGAGAAGAGGGAAGCCTGAGGG + Intergenic
1202493892 Y:25423901-25423923 CAGAGAAGAGGGAAGCCTGAGGG - Intergenic
1202498052 Y:25460624-25460646 CAGAGAAGACGGAACCCTGAGGG - Intergenic