ID: 907246718

View in Genome Browser
Species Human (GRCh38)
Location 1:53113663-53113685
Sequence CAGAAGGTTCAATCTGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907246718_907246724 29 Left 907246718 1:53113663-53113685 CCCTGGTCAGATTGAACCTTCTG 0: 1
1: 0
2: 1
3: 4
4: 119
Right 907246724 1:53113715-53113737 ACTCATTTTCTGTGGCCTTTAGG No data
907246718_907246723 21 Left 907246718 1:53113663-53113685 CCCTGGTCAGATTGAACCTTCTG 0: 1
1: 0
2: 1
3: 4
4: 119
Right 907246723 1:53113707-53113729 TGTATAAAACTCATTTTCTGTGG 0: 1
1: 0
2: 4
3: 43
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907246718 Original CRISPR CAGAAGGTTCAATCTGACCA GGG (reversed) Intronic
901026627 1:6281847-6281869 CATAAGATTCAATCCCACCAAGG - Intronic
901133249 1:6976121-6976143 CAGGAAGATCAATCTGATCATGG + Intronic
902115649 1:14118765-14118787 CAGAAGGATCAATTGGATCATGG + Intergenic
902232070 1:15034509-15034531 CAGCTGTGTCAATCTGACCAGGG - Intronic
904966452 1:34378115-34378137 CAGTAGTTTTAACCTGACCAGGG + Intergenic
907246718 1:53113663-53113685 CAGAAGGTTCAATCTGACCAGGG - Intronic
907509866 1:54950158-54950180 CAAAAGGTTGACTCTGATCACGG + Intergenic
908681766 1:66669791-66669813 GAGCAGTTTCAATCTGAACAAGG - Intronic
909517194 1:76524337-76524359 CAGAAGGTTCAAAATGCCCTGGG - Intronic
909666816 1:78143300-78143322 AAGGAAGTTCAATGTGACCAGGG - Intergenic
920239756 1:204537632-204537654 GAGAAGGTTCACTCTGTCCCTGG - Intronic
924670703 1:246121915-246121937 CTGAAGTTTCATTCTGAACATGG - Intronic
924826882 1:247549080-247549102 CAGGACGTTGCATCTGACCACGG - Intronic
1063329954 10:5147789-5147811 CAGAAGTTTCAAGCTGCCAAAGG + Intergenic
1064289355 10:14019676-14019698 CAGAAGGATCAATATAAACAGGG + Intronic
1078986348 11:16603477-16603499 CAGAAGCTGCAATCAGAGCACGG + Intronic
1079066117 11:17294703-17294725 CAAAAGCTTCAATCTAGCCATGG - Intronic
1085034891 11:73293771-73293793 CAGGAGGATCAGTCTCACCAGGG + Intronic
1087008239 11:93489586-93489608 TAGGAGGTTCAATTTAACCAGGG + Intronic
1090079047 11:123598822-123598844 CAGAAAGTTCATTCTGATCTTGG + Intronic
1091470813 12:725292-725314 CACAAGGGTCATTCTGACCCAGG - Intergenic
1092526687 12:9313964-9313986 CAGAAGATCCCAGCTGACCACGG - Intergenic
1092540586 12:9417815-9417837 CAGAAGATCCCAGCTGACCACGG + Intergenic
1093963654 12:25302744-25302766 TATCAGGTTAAATCTGACCAGGG - Intergenic
1094064163 12:26345724-26345746 CAGAAGGCTCAATCTGAGCAGGG + Intronic
1095368276 12:41435051-41435073 CAGAAGGTAGAATCTCTCCAGGG + Intronic
1095876170 12:47080999-47081021 CAGAAGGTGCAAGCCGAACAAGG + Intronic
1098131481 12:67355156-67355178 CAGAAGGTTTAAACTGCCCCTGG + Intergenic
1102931558 12:116866206-116866228 CAGCAGGTTGATTTTGACCAAGG + Intronic
1103938565 12:124489634-124489656 CAGAGGGTTCTCCCTGACCATGG + Intronic
1104414998 12:128590677-128590699 CAGGAGGTTCAGGCTGTCCAGGG + Intronic
1107119702 13:36782739-36782761 CATAAGCTTAAATATGACCATGG + Intergenic
1112588611 13:100743041-100743063 CATAAGGGGCAATCTGACTAAGG - Intergenic
1116064950 14:39970811-39970833 CAGAAGAAACAATTTGACCAAGG - Intergenic
1118887767 14:69880441-69880463 CAGAAACTCCAATCAGACCAAGG - Intronic
1120245460 14:82000862-82000884 CAGAATATTCAATGTTACCAGGG + Intergenic
1121837569 14:97105991-97106013 CAGAGGGCTCAATGTGACCCTGG + Intergenic
1125430317 15:39587376-39587398 CAGGAGGTCCACTCGGACCATGG - Exonic
1126360514 15:47841050-47841072 AAGAAGGTTCATTCTGACATTGG + Intergenic
1126530998 15:49710961-49710983 TACAAGGCTCACTCTGACCAAGG - Intergenic
1127655427 15:61051134-61051156 CAGAAGGCTGCATCTGAGCAGGG + Intronic
1128100879 15:64998880-64998902 CAAAAGGTTCTATCTGGCAAGGG + Intergenic
1129188387 15:73923988-73924010 CACAAGGTTCACCCTGAGCAAGG + Intergenic
1131194661 15:90345962-90345984 CAGAAGCTGCAATCTAACCTTGG - Intergenic
1133495641 16:6314676-6314698 GAAAAGGTTGAACCTGACCATGG + Intronic
1134337550 16:13315071-13315093 CAGCAGGTTCTATTTGACAAGGG - Intergenic
1134677414 16:16100263-16100285 CAGAAGCTCCCAGCTGACCATGG + Intronic
1137002195 16:35238938-35238960 CAGAAGGTTCCATATGATGAAGG - Intergenic
1138773507 16:59692768-59692790 CAGGAGGTGAAATCTGACCTGGG - Intergenic
1138998923 16:62484925-62484947 CAAAAGTTCCAATCTGAACATGG + Intergenic
1141043268 16:80690647-80690669 CAGTGGGTCCAACCTGACCAAGG + Intronic
1144821553 17:18078272-18078294 CTGAAGGTTGACTCTGACCCAGG - Intergenic
1145050490 17:19656074-19656096 CAAATGGTTGAATTTGACCAGGG - Intronic
1145204047 17:20971271-20971293 CAGCAGGTTCTATGTGACAAGGG - Intergenic
1148954009 17:51338393-51338415 CAGAAGGTTCAAGCTCAGGAGGG - Intergenic
1149031312 17:52085790-52085812 CAGATAGTTCAGTCTGACTAGGG - Intronic
1158748829 18:60234934-60234956 CAGAAAGTTGAATCTTAACATGG + Intergenic
1160147127 18:76374900-76374922 CAAAAAGATCAATTTGACCAAGG + Intronic
1161862623 19:6809592-6809614 CACAAAGTTCAACCTCACCACGG - Intronic
1164794596 19:31015607-31015629 CAGAAGGGGCAACATGACCAGGG + Intergenic
1165857299 19:38887435-38887457 CAGAAGGTTTATTCTGAGCCCGG + Intronic
1167771243 19:51520479-51520501 CAGAAGGTTCATTCGAACCCAGG - Intronic
1168244800 19:55106864-55106886 CAGGAGCTGCCATCTGACCAAGG + Intronic
925319335 2:2950135-2950157 CAGAAGGGACAGTCAGACCATGG - Intergenic
926427880 2:12756077-12756099 TAGAAATTTCAATCTGACCCTGG - Intergenic
926802234 2:16668598-16668620 CAGAAGGTTGATTCTATCCAGGG + Intergenic
929311025 2:40425423-40425445 AATAAGGTCCAATCTGATCAAGG - Intronic
932065691 2:68557067-68557089 CAGAAAGTACAATCTGTCCCTGG + Intronic
932832990 2:75008553-75008575 CACAGGGTTCAATACGACCATGG + Intergenic
934065588 2:88338089-88338111 CAGATGGTACAATATGTCCATGG - Intergenic
937076964 2:119114134-119114156 CAGAAGGTTCACTTTGACTGGGG - Intergenic
939950648 2:148468641-148468663 GAGATGGTTCAATCTCTCCAAGG + Exonic
945649768 2:212542468-212542490 CAGTAGCTTCATTCTTACCACGG - Intergenic
947346419 2:229194133-229194155 CAGAAGGTTCAATATATCCTTGG - Intronic
948190192 2:236052259-236052281 CAGAAGATTCATTCTGACAGTGG + Intronic
1170072870 20:12387829-12387851 GAGGAGTTTCAAACTGACCATGG + Intergenic
1172040453 20:32040902-32040924 CAGAAGGGACAACCTGACAAAGG - Intergenic
1172707845 20:36895807-36895829 CAGTTGGTTGAATCTGCCCATGG - Intronic
1179073869 21:38099564-38099586 CAGAAGGCTCAGTCTGACTGTGG + Intronic
1183191147 22:36322730-36322752 AAGTAAGTTCAAACTGACCAAGG - Intronic
1184048708 22:41988627-41988649 CTGATGGTTCATTCTGACCAGGG - Intronic
955236468 3:57144050-57144072 CTGAAGCTTCAATCAGCCCAGGG + Intronic
960077105 3:113498731-113498753 CATAAGCTTCAATATGAACAAGG + Intronic
962929930 3:140026832-140026854 CAGCAATGTCAATCTGACCAGGG - Intronic
966096542 3:176211319-176211341 TAGAAGGATTAATCTGACCAAGG - Intergenic
967235035 3:187375944-187375966 CAGAAGTGGCAATATGACCATGG - Intergenic
970216583 4:13765105-13765127 CAGAATCTTCAATGTGTCCAAGG - Intergenic
976350987 4:84059758-84059780 CTGAAGCTTCAATCAGATCATGG + Intergenic
983006788 4:162493635-162493657 CAGATGGTTCAAGCTGTCAATGG - Intergenic
986041492 5:3998424-3998446 CCGATGGTTCCATCAGACCAGGG - Intergenic
989137056 5:38166365-38166387 CATAAAGTTAAATCAGACCAGGG + Intergenic
989366983 5:40667175-40667197 CAGATGTTTCATTCTGAACAAGG - Intergenic
998164717 5:139836452-139836474 CAGCAGCTTCAGTCTGGCCACGG + Intronic
999133795 5:149304279-149304301 CAAAAGGTGCAATCAGCCCAAGG - Intronic
1003521239 6:6860517-6860539 CAGAAGTTTCCATATGACCTTGG + Intergenic
1013013141 6:106137636-106137658 AAGAAAGATTAATCTGACCATGG - Intergenic
1013163115 6:107565345-107565367 CTGCAGGTTCAGTCAGACCAAGG + Intronic
1014137220 6:117904375-117904397 GAGAAGATTCAATCTGACTTAGG + Intergenic
1015895978 6:138017373-138017395 CAGAAGGTCAAATGTGACAATGG + Intergenic
1021398980 7:20187606-20187628 CAGAGTGTTCAATTTCACCAAGG - Intronic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023729781 7:43179916-43179938 ATGAAGGTTCAATTTGACCAGGG + Intronic
1028833165 7:95347212-95347234 CAGAAGGTACAAAGTGTCCAAGG + Intergenic
1029874852 7:103739604-103739626 CAGAAGCTTCATTCTCATCAAGG + Intronic
1031083571 7:117281105-117281127 CAGAAGGTTCTATCTTGCCCAGG - Intronic
1033719433 7:144042176-144042198 CAGAATGTTCAATATCCCCAAGG - Intergenic
1037128899 8:15384230-15384252 CAGAAAGTTGAATTTAACCAAGG - Intergenic
1042100865 8:65273741-65273763 CAGAGGGTTTAATCTAAACAGGG - Intergenic
1044402017 8:91783593-91783615 CAGAACGTTCCTTCAGACCAAGG - Intergenic
1046215536 8:111141070-111141092 CAGAAGGTTCCCTCTGGCCCAGG + Intergenic
1046508373 8:115165666-115165688 CAGTAGGTTCAAAATGGCCAAGG + Intergenic
1047188671 8:122658200-122658222 AAGGAGGTTTATTCTGACCATGG + Intergenic
1047540180 8:125757432-125757454 CAGTAGGTTGACTCTGAACATGG + Intergenic
1056315031 9:85380156-85380178 CATAAGCTGCAATCTGACAATGG + Intergenic
1059063535 9:111058680-111058702 CAGAACATTCAATGTGATCATGG + Intergenic
1059449795 9:114363384-114363406 CAGAAGATTAGATGTGACCAGGG - Intronic
1059996860 9:119919218-119919240 CAAAAGGATCAATATGACCTGGG + Intergenic
1060629807 9:125145526-125145548 CAGAAAATTCAATCTGTTCAGGG + Intergenic
1185840378 X:3383862-3383884 AAGAAGGTTCATTCTGACCCAGG - Intergenic
1189302723 X:39964186-39964208 AGGAAGGATCAATATGACCAGGG + Intergenic
1190737236 X:53263680-53263702 CAGAAGGACCAACCTGCCCAGGG - Intronic
1191072651 X:56418506-56418528 GAGAAGGTTAAAACTGTCCAAGG + Intergenic
1191145006 X:57156501-57156523 CAGAAGATTCAGTATGAACAAGG - Intergenic
1194852855 X:98890710-98890732 TAGAAGGGTCATTCTGGCCAAGG + Intergenic
1195393782 X:104389748-104389770 CAGATTGTTCCATCTGACCCGGG + Intergenic