ID: 907249371

View in Genome Browser
Species Human (GRCh38)
Location 1:53127948-53127970
Sequence CCCGCCCAGACTGCTGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907249365_907249371 20 Left 907249365 1:53127905-53127927 CCTGGATTGCAGCCTAAGACTCT No data
Right 907249371 1:53127948-53127970 CCCGCCCAGACTGCTGGCCCAGG No data
907249364_907249371 30 Left 907249364 1:53127895-53127917 CCAGCGGACACCTGGATTGCAGC No data
Right 907249371 1:53127948-53127970 CCCGCCCAGACTGCTGGCCCAGG No data
907249367_907249371 8 Left 907249367 1:53127917-53127939 CCTAAGACTCTGAGCAGAGGACT 0: 1
1: 0
2: 2
3: 12
4: 172
Right 907249371 1:53127948-53127970 CCCGCCCAGACTGCTGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907249371 Original CRISPR CCCGCCCAGACTGCTGGCCC AGG Intronic
No off target data available for this crispr