ID: 907251838

View in Genome Browser
Species Human (GRCh38)
Location 1:53144656-53144678
Sequence CTTATAAGCTTCCTGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 1, 2: 8, 3: 87, 4: 521}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907251838_907251841 1 Left 907251838 1:53144656-53144678 CCTGCCTTCAGGAAGCTTATAAG 0: 1
1: 1
2: 8
3: 87
4: 521
Right 907251841 1:53144680-53144702 AAGTGGAGAGACCCCAAGAACGG 0: 1
1: 0
2: 4
3: 13
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907251838 Original CRISPR CTTATAAGCTTCCTGAAGGC AGG (reversed) Intergenic
900921850 1:5677642-5677664 AATATAAGCTTCTTGAAGGTAGG - Intergenic
900939121 1:5786550-5786572 ATCATAAGCTTTCTGAAGGCAGG - Intergenic
900990981 1:6098229-6098251 CCTAGAACCTTCCTGAAGGGTGG - Intronic
902243979 1:15107223-15107245 TCTGTAAGCTTCGTGAAGGCAGG - Intronic
902990303 1:20183068-20183090 GTTATGAGCTCCTTGAAGGCAGG - Intergenic
903046774 1:20570233-20570255 CTTACTAGCTTCTTGAGGGCTGG - Intergenic
903055269 1:20632032-20632054 CTCATAATCTTCCTTAAGGGAGG - Intergenic
903496762 1:23773890-23773912 CTTAAAAGCTTCCAGAAAACGGG + Intergenic
903803258 1:25985635-25985657 ACTATAATCTTCCTGAAGGTAGG + Intronic
904010514 1:27387293-27387315 GCTGTAAGCTTCATGAAGGCAGG + Intergenic
904383799 1:30128754-30128776 CTGGTAAGCTTGCTTAAGGCTGG + Intergenic
904883892 1:33721292-33721314 AGCATAAACTTCCTGAAGGCAGG + Intronic
905339043 1:37265840-37265862 CCTAAAAGCCTCCTGAAGCCAGG + Intergenic
905683394 1:39890890-39890912 CTCATAAACTTCCAGAAGGAAGG + Intergenic
905787271 1:40768331-40768353 CCTATAAGATGCCTGAGGGCAGG - Intronic
906381883 1:45337837-45337859 AATATAAGCTCCCTGAGGGCAGG - Intronic
906568794 1:46818904-46818926 ACTACAAGCCTCCTGAAGGCAGG - Exonic
906729165 1:48066412-48066434 ATTATAAGCTTCTTGATGCCAGG + Intergenic
906931058 1:50169936-50169958 ATTATAAGCTCCCTGAATGCGGG + Intronic
907105122 1:51875891-51875913 ATTGTAAGCTCCCTAAAGGCAGG + Intronic
907251838 1:53144656-53144678 CTTATAAGCTTCCTGAAGGCAGG - Intergenic
907372735 1:54013772-54013794 GTTATTAGCTCCTTGAAGGCAGG + Intronic
907588949 1:55647330-55647352 ACTATAAGCTTCATGAGGGCAGG + Intergenic
907641957 1:56199627-56199649 GCTATAAGCTTCATGAAGGCAGG + Intergenic
907663709 1:56416231-56416253 CTTATCAGCCTCCCAAAGGCGGG + Intergenic
907678408 1:56540297-56540319 ATTGTAAGCTTCTTGAGGGCAGG - Intronic
907730991 1:57065502-57065524 TCTATAAGCTTGCTGAGGGCAGG + Intronic
908550857 1:65207358-65207380 CCTATAAGCTTCCTGAGGGCAGG + Intronic
908764461 1:67541808-67541830 TTTATAAACTCCATGAAGGCTGG - Intergenic
909592279 1:77363942-77363964 ATTGTAAGCTCCATGAAGGCCGG + Intronic
909686134 1:78351038-78351060 ATTATAAACTCCCTGAAGTCTGG - Intronic
910754290 1:90670356-90670378 ACTATAAGCTGCATGAAGGCAGG + Intergenic
910874587 1:91866519-91866541 GATATAAGCTCCCTGAGGGCAGG - Intronic
911147355 1:94565564-94565586 CATGTAAGCTCCCTGAAGCCAGG + Intergenic
911389445 1:97220498-97220520 CATGCAAGCTTCCTGAGGGCAGG + Intronic
911730364 1:101286547-101286569 GGTATAAGCTTCCTGATGGAAGG + Intergenic
911902105 1:103519637-103519659 CTAATAAGCTCCTTGAAGACAGG - Intergenic
912491056 1:110063088-110063110 TCTAGAAGCTTCCTGAAGGATGG - Intronic
912958170 1:114170837-114170859 TTTATAAGCTTCATGAAGACAGG - Intergenic
913009322 1:114667347-114667369 GTTATAAGCTTCTTAAAGACAGG + Intronic
913009824 1:114671478-114671500 CAAATAATCTTCCTGAATGCAGG - Intergenic
913279725 1:117174382-117174404 ACTATAAGCTTCTTGAGGGCAGG - Intronic
913480278 1:119281316-119281338 ATTGTGAGCTTGCTGAAGGCAGG + Intergenic
913528218 1:119713443-119713465 CTTACAAACTTCTTGAAGGCAGG - Intronic
913531328 1:119736249-119736271 ATCATAAGCTCCCTGAAGGCAGG + Intronic
914393990 1:147247403-147247425 CTTACTAGCTTCCAGAAAGCTGG + Intronic
914735465 1:150412158-150412180 ATTATAAGCATCCAGAAGACTGG - Intronic
914740321 1:150459169-150459191 CTAATAAGATTTATGAAGGCTGG - Intronic
915033588 1:152904382-152904404 ATTCTAAGCTACTTGAAGGCAGG + Intergenic
916496237 1:165350414-165350436 GCTATAAGCCTCCTGAAGGCAGG + Intronic
916933319 1:169602237-169602259 AATATAAGCTTCTTGAAGGCAGG - Intronic
917948957 1:180008707-180008729 ACTATAAGCTCCATGAAGGCAGG - Intronic
918384583 1:183992934-183992956 TTTATAAGCTCCATGAGGGCAGG + Intronic
919155161 1:193754916-193754938 CTTATAAGCTCCCTTTTGGCTGG + Intergenic
919399150 1:197087370-197087392 CTTAAAAGTTTACTGCAGGCTGG - Intronic
919548910 1:198960118-198960140 CTGATAGGCTTGCTGAAAGCAGG + Intergenic
919647790 1:200113186-200113208 CTTATATGTTTCCTGCAGCCTGG + Intronic
920298425 1:204974023-204974045 CTTAGGGGCTTCCTGAAGGAGGG + Intronic
920615575 1:207489354-207489376 CTTATGAGATGCCTGAAGCCAGG + Exonic
920831885 1:209472875-209472897 ATTTTAAACTTCCTGATGGCTGG + Intergenic
921248981 1:213278688-213278710 TTTATAAGATCCTTGAAGGCAGG - Intergenic
921264291 1:213409800-213409822 CTTATAAGCTCCTTGAAGGTAGG - Intergenic
923842880 1:237693017-237693039 ACTATAGGCTTCTTGAAGGCCGG - Intronic
923845429 1:237725759-237725781 ATGATAAGCTTCCTGGTGGCAGG + Intronic
924200966 1:241658053-241658075 AATATAAGCTCCCTGAGGGCAGG + Intronic
924502228 1:244648580-244648602 ATTATAAGCTTCATGAGGGTAGG + Intergenic
924599632 1:245477379-245477401 GATCTAAGCTGCCTGAAGGCAGG - Intronic
1062992155 10:1830423-1830445 CTTGTGAGCTTCTTGAAGCCTGG - Intergenic
1063778082 10:9287503-9287525 ACTGTAAGCTTCTTGAAGGCAGG - Intergenic
1063950409 10:11216954-11216976 ATTATAAGCTTCTTAAAAGCTGG - Intronic
1065377732 10:25060076-25060098 CTTCTCTGCTTCCTGAAGGCGGG + Intronic
1065779986 10:29158240-29158262 TGTAAAAGCTTCCTGAAGGTTGG - Intergenic
1068700404 10:60013941-60013963 CTGATAAGCTTGCTAAATGCAGG + Intergenic
1068850027 10:61727129-61727151 ATTATAAACTTCTTGAAGGCAGG + Intronic
1069985453 10:72279981-72280003 CATATAAGGTTCCTTTAGGCTGG + Intergenic
1070337912 10:75471264-75471286 CAGATGAACTTCCTGAAGGCAGG - Intronic
1070384412 10:75911755-75911777 CTTTTAAGCTCTTTGAAGGCAGG - Intronic
1070401579 10:76057464-76057486 ACTGTAAGCTTCTTGAAGGCAGG - Intronic
1070425239 10:76280872-76280894 TTGGTAAACTTCCTGAAGGCAGG - Intronic
1071534889 10:86420286-86420308 CATGTAAGCTTCATGAAGGCAGG - Intergenic
1072112747 10:92338839-92338861 ATTATAAGCTCCCAGAAGGTAGG + Intronic
1073786285 10:106893416-106893438 CCTATAAGCTCTCTGAGGGCAGG + Intronic
1074033651 10:109715567-109715589 CTTATAAGCTGCTTGAGGGAAGG - Intergenic
1074538905 10:114348748-114348770 CTTATAAGAATCCTGATGCCTGG + Intronic
1074816154 10:117142231-117142253 CTGCTAAGCTTCCTGCGGGCAGG + Intergenic
1075889599 10:125935272-125935294 ACTATAAGCTTCCTGAAGGCAGG + Intronic
1076446470 10:130517759-130517781 TTTAGATTCTTCCTGAAGGCGGG + Intergenic
1079349373 11:19679781-19679803 GGTATGAGCTTCCTGAGGGCAGG + Intronic
1080104457 11:28497501-28497523 CTTATAAGTCTTCTGAATGCAGG + Intergenic
1080335886 11:31195729-31195751 CTTATTAGCTTCATAAAAGCTGG + Intronic
1080403179 11:31955866-31955888 ACTATAAGCTTCGTGAGGGCGGG - Intronic
1080416217 11:32072324-32072346 CATTTGAGCTTCCAGAAGGCAGG - Intronic
1081605632 11:44525645-44525667 ATTGTAAGCTCCTTGAAGGCAGG + Intergenic
1081764587 11:45600745-45600767 AATATAAGCTCCATGAAGGCAGG + Intergenic
1081837215 11:46165712-46165734 ATTATAAGCTTATTGAGGGCAGG + Intergenic
1083024809 11:59541734-59541756 CTTTTAAGCTTCAAAAAGGCAGG - Intergenic
1083129721 11:60613817-60613839 AATATAAGCTCCCTGAAGGCAGG - Intergenic
1083354699 11:62057593-62057615 CTTGTAAGTTTCATGAAGTCAGG + Intergenic
1083547952 11:63563005-63563027 CTGCTAAGCCTCCTGAAGGCAGG - Intronic
1083589357 11:63884063-63884085 CTTTTAAGTTTCTGGAAGGCAGG + Intronic
1083662333 11:64257298-64257320 CTTAAAAGCACCCTGCAGGCTGG - Intronic
1085710127 11:78821942-78821964 ATTGTAAACTTCTTGAAGGCAGG + Intronic
1085876729 11:80416449-80416471 ATTACAAGCTCCATGAAGGCAGG - Intergenic
1086097170 11:83062054-83062076 AATATAAGCTTCATGAAGCCAGG - Intronic
1086224158 11:84487641-84487663 CTTTTGAGCATCCTAAAGGCTGG - Intronic
1086384309 11:86291448-86291470 CATATAAGCTTCAAGAGGGCAGG - Intergenic
1086935536 11:92742122-92742144 CTTACAAGCTAACTGAATGCAGG + Intronic
1086957992 11:92953776-92953798 CTTAGATGCTTCCTGGAGCCAGG + Intergenic
1087176518 11:95101017-95101039 ATTCTAAGTTCCCTGAAGGCAGG + Intronic
1087548712 11:99618305-99618327 CTTATAAACTAACCGAAGGCAGG + Intronic
1088612632 11:111592522-111592544 ATTATATGCTCCCTGAGGGCTGG + Intergenic
1088621111 11:111685042-111685064 CATTTAAGCTTCCTGAAGACAGG - Intronic
1088780575 11:113130384-113130406 TTAATAAGCTTAATGAAGGCAGG - Intronic
1089040650 11:115446088-115446110 ATTGTAAGCTCCTTGAAGGCAGG - Intronic
1089349552 11:117814653-117814675 CTTATAAGCTACATGAGGGAGGG - Intronic
1089501583 11:118934909-118934931 CTTATAAGCCCCTTGAAGGCAGG - Intronic
1090410049 11:126501809-126501831 ATTGTGAGCTCCCTGAAGGCAGG + Intronic
1090933667 11:131322734-131322756 ATTCCAAGCTTCTTGAAGGCAGG - Intergenic
1091642107 12:2245260-2245282 CTAAGAAGCTTCCTGGAGGGAGG - Intronic
1091894235 12:4088109-4088131 CCTCTTAGCTTCCTGAGGGCTGG + Intergenic
1093007996 12:14071763-14071785 ATTATAAACTTCCTGAGGCCAGG - Intergenic
1093227965 12:16508103-16508125 ATTATAAGCAACCTGATGGCAGG + Intronic
1093725318 12:22500601-22500623 AATATGAGCTTCATGAAGGCAGG + Intronic
1093953181 12:25187487-25187509 AATGTAAGCTTCATGAAGGCAGG + Intronic
1093957719 12:25240536-25240558 CTAATAAGCTCCATGAAGGCAGG + Intronic
1094355484 12:29573480-29573502 CTCATAAACTCCCTGAGGGCTGG - Intronic
1096226385 12:49869223-49869245 CTTATCAGCTTCCAGGCGGCTGG - Exonic
1096253622 12:50050000-50050022 CCCATAAGCTCCTTGAAGGCAGG + Intergenic
1096417760 12:51428301-51428323 GTTAGAAGCTTCTTGAGGGCAGG + Intronic
1096456970 12:51795525-51795547 GTTATAAGGTACCAGAAGGCAGG + Intronic
1096982541 12:55736746-55736768 GTTGTAAGCACCCTGAAGGCAGG - Intergenic
1097048704 12:56207299-56207321 GTTGTAAGCTACCTGAAGACAGG + Intronic
1097351470 12:58553729-58553751 CTCAAAAGCTTCCTGAGGACAGG - Intronic
1097847229 12:64379248-64379270 TTAAGAAGCTTCATGAAGGCAGG - Intronic
1098080232 12:66776561-66776583 ATTATAAGCTTCTTGAGAGCAGG - Intronic
1098097508 12:66974420-66974442 AATATAAGCTTCATGAAGGCAGG + Intergenic
1098224606 12:68308655-68308677 AATGTAAGCTTCATGAAGGCAGG + Intronic
1098419733 12:70282009-70282031 CTAATAAGCTTCTTGAAAACTGG + Intronic
1098524136 12:71467264-71467286 CTAATTTGCTTCCAGAAGGCTGG + Intronic
1099207672 12:79746799-79746821 TTTATAACCTCCATGAAGGCAGG - Intergenic
1099593669 12:84628804-84628826 GCTAAAAGCTTCATGAAGGCAGG - Intergenic
1099670891 12:85690598-85690620 AATATAAGCTTCATGAAAGCAGG - Intergenic
1100206968 12:92360854-92360876 TCTAGAAGCTCCCTGAAGGCAGG + Intergenic
1100386674 12:94110323-94110345 ATTATAAGTTGCATGAAGGCAGG + Intergenic
1100517189 12:95339730-95339752 GTTATAAGCTTCATAAAGGTGGG + Intergenic
1100922714 12:99506928-99506950 ACTATAAGCTCCATGAAGGCTGG + Intronic
1100944391 12:99764220-99764242 CCTATAAGCTCCTTGAAGACAGG - Intronic
1101282050 12:103268268-103268290 ATCATGAGCATCCTGAAGGCAGG + Intronic
1101327033 12:103724544-103724566 CTTATAAGCTCTTTGAGGGCTGG + Intronic
1101625892 12:106440815-106440837 CTTAGAAGCTTCACGAAGGCAGG + Intronic
1101880991 12:108625584-108625606 ACTATAAGCTTCCTGAGAGCAGG - Intronic
1101881820 12:108630850-108630872 CTCCTAAACTTCCAGAAGGCAGG + Intronic
1102037159 12:109777713-109777735 CTTATCCTCTTCCTGAGGGCTGG + Intergenic
1102328116 12:112006621-112006643 ATTATAAGCTGTCAGAAGGCTGG - Intronic
1102415868 12:112762183-112762205 ATTATAAGCTACCTGAGGGATGG + Intronic
1102778818 12:115545332-115545354 ATTATAATCTCCTTGAAGGCAGG - Intergenic
1102999392 12:117373885-117373907 AATATCAGCTTCATGAAGGCTGG - Intronic
1103820648 12:123695354-123695376 CTTATAACCATCCTGATGGCTGG - Intronic
1103873724 12:124110855-124110877 CTTATAAGATTCCAGAAAGTTGG + Intronic
1104444957 12:128825099-128825121 GGTGTAAGCTTCCTGATGGCAGG + Intergenic
1107111182 13:36699789-36699811 ATTATAAGCTCCGTGAGGGCAGG - Intergenic
1107270070 13:38605605-38605627 ATTATAAGCTTCATGAAGACAGG - Intergenic
1107391390 13:39968321-39968343 AATTTAAGCTCCCTGAAGGCAGG + Intergenic
1107477501 13:40753295-40753317 CTTCTAAGCTGCCTAAGGGCAGG + Intronic
1108225593 13:48285766-48285788 CTTGTAAGGTTCATGAAGGCAGG + Intergenic
1109182531 13:59230952-59230974 ATTGTAAACTTCTTGAAGGCAGG + Intergenic
1109200188 13:59421653-59421675 CTGATCAGCTTCCTGGAGGTGGG + Intergenic
1109225018 13:59683136-59683158 ATTGTAGGCTTCCTGAAGGCAGG - Intronic
1110336171 13:74333337-74333359 CATATAAGCTCCATGAATGCAGG + Intergenic
1110528970 13:76574484-76574506 TCTACAAGCTTCCTGAAGGCAGG + Intergenic
1111027410 13:82548834-82548856 TTTATTAGCGTTCTGAAGGCTGG + Intergenic
1111999316 13:95195387-95195409 CTCACTTGCTTCCTGAAGGCTGG - Intronic
1112203270 13:97299335-97299357 AATATAAGCTCCCTGATGGCAGG - Intronic
1112408901 13:99145365-99145387 GTTATAAGCCTCTTGAAGGCAGG + Intergenic
1112632017 13:101172236-101172258 CTCAGAAGCTCCCTGAGGGCAGG - Intronic
1113409102 13:110068503-110068525 AATCTAAGCTTCGTGAAGGCAGG + Intergenic
1114079924 14:19194964-19194986 CTTATTAACTTCCTGGAGGGAGG + Intergenic
1115372001 14:32626831-32626853 ATTATAAGCTCCTTGAAGGCAGG + Intronic
1115665553 14:35541339-35541361 CTTAAAAACTTTTTGAAGGCCGG - Intronic
1115714748 14:36090770-36090792 CCTGTAAGCTCCCAGAAGGCAGG - Intergenic
1115900761 14:38144958-38144980 CTATTAAGCCTCGTGAAGGCAGG - Intergenic
1116405210 14:44558143-44558165 TTAATATGCTTCCTGGAGGCGGG - Intergenic
1117237321 14:53792113-53792135 CTGAAGAGCTTCCTGAAAGCTGG - Intergenic
1117241782 14:53841045-53841067 ATTGTAAACTTCTTGAAGGCAGG + Intergenic
1117721827 14:58636424-58636446 TATGAAAGCTTCCTGAAGGCAGG - Intronic
1118141692 14:63090876-63090898 ATGATAAGATTCCTGAGGGCAGG + Intronic
1119033267 14:71209131-71209153 ATTATAAGCTCCATGAAGGCAGG - Intergenic
1119065076 14:71517277-71517299 ATTACAAGCTTACTGAAGACTGG - Intronic
1119133027 14:72192065-72192087 ATTATAAGCTCCATGAGGGCAGG + Intronic
1119530167 14:75354514-75354536 ATTATAAGCTCCGAGAAGGCAGG - Intergenic
1119564585 14:75617749-75617771 ATTATAAGCTCCATGAGGGCAGG - Intronic
1120068634 14:80076967-80076989 ATTGTAAGCTCCATGAAGGCAGG + Intergenic
1120724284 14:87920415-87920437 TTTATAAGCTCCATGAAAGCAGG - Intronic
1120756815 14:88252295-88252317 GTTATAAGCTCCAAGAAGGCAGG + Intronic
1121482242 14:94288159-94288181 GCTATAAGTTTCCTGAAGGCAGG - Intronic
1121805893 14:96822165-96822187 AATATAAGCTCCATGAAGGCAGG + Intronic
1121857238 14:97281513-97281535 AATATCAGCTTCCTGAAAGCAGG - Intergenic
1122453316 14:101829592-101829614 CTTATAATATTCCATAAGGCTGG + Intronic
1122721163 14:103723427-103723449 TTTAGATGCTTCCAGAAGGCTGG + Intronic
1122848794 14:104515502-104515524 CGTATGAGCATCCTGAGGGCGGG - Intronic
1124400399 15:29342822-29342844 CTTATAAACTTCTAGAATGCAGG + Intronic
1124788263 15:32701919-32701941 CTTTGAAGCCTCCTGAAGCCTGG + Intergenic
1124897118 15:33787833-33787855 ATTGTAAACTTCCTGAAGGAAGG - Intronic
1126000683 15:44206872-44206894 CTCAAAAGCTTCCTGAAGAAGGG - Intergenic
1126367541 15:47911364-47911386 GTAATATGCTTCCTCAAGGCAGG - Intergenic
1126426716 15:48535319-48535341 AATATAAGCTTCCAGAAAGCAGG + Intronic
1126475274 15:49059267-49059289 AATATAAGCTCCATGAAGGCAGG + Intergenic
1126541470 15:49829216-49829238 ATGATAAGCTCCATGAAGGCAGG - Intergenic
1126836080 15:52666774-52666796 AATATAAGCTTCATGAGGGCAGG - Intronic
1126999553 15:54486052-54486074 ATTATAAGCTCCATGATGGCAGG + Intronic
1127964072 15:63910852-63910874 TTTAAAACCTTCCTGTAGGCTGG - Intronic
1128040899 15:64572508-64572530 GATATAAGCTTCCTGAGGACAGG + Intronic
1128907264 15:71478227-71478249 CTTATATACTTCCTAGAGGCAGG - Intronic
1129556420 15:76514916-76514938 CTTACAAGCTTCCTAACTGCTGG + Intronic
1129912965 15:79243467-79243489 CTCACAACCTTCCTGCAGGCTGG + Intergenic
1130444098 15:83982644-83982666 CTCATAGGCTCCCTGAGGGCTGG - Exonic
1130772677 15:86940515-86940537 CTTATAAGTTCCCTGAAGGTAGG - Intronic
1132029138 15:98426473-98426495 ATTGTAAGCTCCCTGAAGTCAGG - Intergenic
1132107525 15:99074099-99074121 CCTGGAAGCTTCATGAAGGCAGG + Intergenic
1133442519 16:5832629-5832651 CCTGTAAGTTCCCTGAAGGCAGG + Intergenic
1133568185 16:7015034-7015056 GTTCTATGCTTCCTGAATGCAGG + Intronic
1134660227 16:15978575-15978597 ATTCTAAGCTTTCTGAGGGCAGG + Intronic
1135649918 16:24197140-24197162 AATATAAGCTCCATGAAGGCAGG - Intronic
1136475990 16:30513702-30513724 CTCAGAAGCTTCCTGGAGCCCGG + Intronic
1137321415 16:47386978-47387000 CAGATAACCTTCCTGAAGTCTGG + Intronic
1137814700 16:51387481-51387503 AATATAAGGTCCCTGAAGGCAGG - Intergenic
1137965661 16:52930585-52930607 ATTGTAAGCTTTATGAAGGCAGG + Intergenic
1138075627 16:54039613-54039635 CTTGTAATCTTCATGAGGGCGGG - Intronic
1138244396 16:55456096-55456118 ATTAAATGCTTCCTGAAGACTGG - Intronic
1138338735 16:56273705-56273727 TTTTTAAGCTTCATGAGGGCAGG + Intronic
1138822746 16:60281356-60281378 CCAGTAAGCTTCCTGAAAGCAGG + Intergenic
1139223909 16:65215363-65215385 CATGTAAGCTTCATGAGGGCAGG + Intergenic
1139359740 16:66390109-66390131 GGCATAAGCTCCCTGAAGGCAGG + Intronic
1139704109 16:68728597-68728619 CTTATGAGCTTCTTAAAGGCAGG + Intergenic
1139746694 16:69080840-69080862 CTAATAACCTTCCTCTAGGCCGG + Intronic
1140089546 16:71826347-71826369 ACTATAAGCTTCATGAGGGCAGG - Intergenic
1140680219 16:77377369-77377391 TAAATAAGCTTCCTGAAGGCAGG + Intronic
1140707758 16:77646700-77646722 CCCAAGAGCTTCCTGAAGGCAGG - Intergenic
1140833554 16:78773117-78773139 ATTGTAAGCTTCATGAGGGCAGG + Intronic
1141073353 16:80978783-80978805 CTTAAAAGCTTCATGGAGGCTGG + Intronic
1141308340 16:82888263-82888285 CATATAAGCTTCATGAAATCTGG + Intronic
1143238880 17:5426936-5426958 ATTTTAAGATTACTGAAGGCCGG - Intronic
1143795470 17:9332800-9332822 AATATAAGCTCCCTGAGGGCAGG + Intronic
1144401941 17:14913164-14913186 ATTATGAGCTTCCTGCAAGCAGG + Intergenic
1145794520 17:27647819-27647841 ATTATAAACTCCCTGGAGGCAGG - Intronic
1147010085 17:37438938-37438960 ACTATAAGCTTTCTGAAGACAGG - Intronic
1147302298 17:39539619-39539641 CCCAGAAGCTTCCTGAAGGTGGG - Intronic
1147561805 17:41513905-41513927 CTTTTCAGCTCTCTGAAGGCAGG + Exonic
1148472214 17:47901934-47901956 GATGTAAGCTTCCTAAAGGCAGG - Intronic
1148701108 17:49587526-49587548 CTGATAAGCTACCTGCATGCAGG + Intergenic
1150123025 17:62619030-62619052 GCTGTAAGCTTCCTTAAGGCAGG - Intergenic
1150302046 17:64055068-64055090 CTTAAAACCTTCTGGAAGGCAGG + Intronic
1150952995 17:69823089-69823111 CTAATAAGCTTCTAGAGGGCAGG + Intergenic
1151690200 17:75679290-75679312 CTTACAACTTGCCTGAAGGCCGG - Intronic
1152050995 17:77977151-77977173 ATTATAAACTCCTTGAAGGCAGG + Intergenic
1152930879 17:83109318-83109340 CATGTAATTTTCCTGAAGGCTGG - Intergenic
1153744711 18:8165779-8165801 ACTATAAGCTTCCAGAATGCTGG - Intronic
1154054653 18:11001185-11001207 GATGTAAGCCTCCTGAAGGCAGG + Intronic
1155327635 18:24681255-24681277 ATTATAAGCTTTTTGAGGGCAGG - Intergenic
1155499153 18:26469960-26469982 ATTATAAGGTTCTTGCAGGCAGG - Intronic
1156110294 18:33718181-33718203 ACTATAATCTCCCTGAAGGCAGG - Intronic
1156505300 18:37586879-37586901 CCTATCAGCTTCCAAAAGGCAGG + Intergenic
1156587775 18:38450980-38451002 CTTATCATCTTCCAGAATGCTGG + Intergenic
1157027186 18:43859028-43859050 CTTTAAAGCTTCTTGAAGTCTGG + Intergenic
1157269609 18:46262047-46262069 CACATAAGCTACCTGAGGGCTGG + Intronic
1157343978 18:46806683-46806705 ATTATAAGCTGCCTGATGTCTGG + Intergenic
1157527579 18:48396358-48396380 ATTGAAAGCTTCCTGAAGGCAGG - Intronic
1157651468 18:49336728-49336750 ATTGTAAGCTTCATAAAGGCAGG - Intronic
1157761907 18:50271715-50271737 ATTATAAGCTCCCTGAAGGTAGG + Intronic
1158224551 18:55187091-55187113 CTTCTCAGCTTCTTGAAGGCAGG - Intergenic
1158338681 18:56441539-56441561 AATATAAGCTTCATGAAAGCAGG + Intergenic
1159212102 18:65337118-65337140 CTTATATGGTTCCTTAAGGTAGG - Intergenic
1159861110 18:73650806-73650828 ATTCTAAGCTTCTTGAGGGCAGG - Intergenic
1159967513 18:74610066-74610088 CTTGTAAGCTTCTTGGAGGCAGG + Intronic
1162985013 19:14264358-14264380 CTTATAAGCTCCAGGAAGGTGGG - Intergenic
1163057964 19:14735682-14735704 CCTAAAAGCTCCATGAAGGCAGG + Exonic
1165113230 19:33514019-33514041 CATGTAAGCTCCCTGAGGGCAGG + Intronic
1165896775 19:39146177-39146199 ATTATAAGCTCCATGAAGGCAGG - Intronic
1165929363 19:39346137-39346159 ATTGTGAGCTCCCTGAAGGCAGG - Intronic
1166037762 19:40181575-40181597 CTTATAGGCTCCCTGAATGGAGG + Intergenic
1167639647 19:50673626-50673648 CCTAGAAACTCCCTGAAGGCGGG + Intronic
925792652 2:7508064-7508086 CTTAAAATCTCCTTGAAGGCAGG + Intergenic
925988188 2:9232587-9232609 ATCATAAGCTTCCTGGGGGCAGG + Intronic
926399063 2:12476770-12476792 CTTGTAAGCATCTTGAGGGCAGG + Intergenic
926463238 2:13159558-13159580 ATTATAAGTTCCCTCAAGGCAGG + Intergenic
926745529 2:16153820-16153842 ATTGTAGGCTTCCTGAGGGCAGG + Intergenic
926826205 2:16907375-16907397 AATATAAGCTTCATGAGGGCAGG - Intergenic
926904298 2:17791694-17791716 CTTATAAACATCTTGAAGGGAGG - Intronic
927292124 2:21415036-21415058 ATTACTAGCTCCCTGAAGGCAGG + Intergenic
927369229 2:22335477-22335499 AATGTAAGCTCCCTGAAGGCAGG - Intergenic
928705309 2:33943299-33943321 ATTATAAGCTTCTTTAGGGCAGG + Intergenic
929199721 2:39221975-39221997 ATTTTAAGCTTCTTGAGGGCAGG + Intronic
929723975 2:44404084-44404106 ACTGTAAGCTTCCAGAAGGCAGG + Intronic
929892652 2:45931325-45931347 ACTATAAGCTCCCTGAAAGCAGG - Intronic
929938655 2:46313803-46313825 TATGTAAGCTTCATGAAGGCAGG + Intronic
930383266 2:50658846-50658868 TGTATAAGCTTCCTGAGAGCTGG + Intronic
931206864 2:60156041-60156063 ATTGTAAACTTCTTGAAGGCAGG - Intergenic
931493602 2:62777686-62777708 TTTATAAGCTTCTTGAGGACAGG - Intronic
931764498 2:65442791-65442813 ATTGTAAGCTTACTGAGGGCAGG + Intergenic
931902286 2:66803249-66803271 ATTATAAGCTTCTTGAAGGAAGG - Intergenic
933253352 2:80053701-80053723 CTTACAACCTCCCTGAATGCTGG + Intronic
933495499 2:83045866-83045888 ATTGTAAGCTTGATGAAGGCAGG - Intergenic
933527928 2:83467373-83467395 ACTCTAAACTTCCTGAAGGCAGG - Intergenic
933858839 2:86443847-86443869 CTTATAACCTTTCTGTAAGCTGG + Intronic
934607515 2:95708344-95708366 CATAGAGGCTTCCTGAGGGCAGG + Intergenic
934711909 2:96521735-96521757 ATTATAAGCTTTTTGAAGTCAGG + Intergenic
935602170 2:104933872-104933894 ATTGTAAGCTTCCTGAAGGTGGG - Intergenic
935817927 2:106864689-106864711 ATTAAAATCTTCCTGAAGGCGGG - Intronic
937185360 2:120035416-120035438 AATATGAGCTTCTTGAAGGCAGG + Intronic
937552546 2:123112563-123112585 CTTACAAGTCTCCTGACGGCAGG - Intergenic
937705181 2:124912273-124912295 CATCTAGGCTTCCAGAAGGCAGG - Intronic
938984686 2:136562785-136562807 GTTATAGGCTCCCTGAGGGCAGG + Intergenic
939219892 2:139288219-139288241 CTTTTAAGCTCCATGAGGGCAGG + Intergenic
940333019 2:152495752-152495774 CGTATATGCTTCCTGGAGGCAGG - Intronic
940958713 2:159758019-159758041 TTTATGAGCTCCTTGAAGGCAGG + Intronic
941635751 2:167933304-167933326 ATTGTTAGCTTCCTGAGGGCAGG - Intergenic
941666975 2:168251857-168251879 AATATAAGCTCCCTGAGGGCAGG + Intergenic
942143127 2:172998087-172998109 ATTATAAGCTTCCTGAAGGCAGG - Intronic
942169220 2:173273529-173273551 ATTATAAGCTTCTTGAAGGTAGG + Intergenic
942231234 2:173862542-173862564 AGTATAAGCTTCTTGGAGGCAGG - Intergenic
942544676 2:177051056-177051078 ACTATAAGCTCCATGAAGGCAGG - Intergenic
944986818 2:205187003-205187025 CCTACCAGCTTCCTGAAGACAGG - Intronic
945159543 2:206875097-206875119 ACTATAAGCATCCTGAGGGCAGG - Intergenic
945279915 2:208026261-208026283 CCTATAAACTCCCTGAGGGCAGG + Intergenic
945901265 2:215540160-215540182 ACTATAAGCTCCATGAAGGCAGG + Intergenic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
946216257 2:218186080-218186102 CATATAAGCTTCACGAAGGCAGG + Intergenic
947138515 2:226999094-226999116 ATTGTAAGCTTCATGAGGGCAGG + Exonic
948104839 2:235405392-235405414 CTTAAAACCTTCCACAAGGCCGG + Intergenic
948314555 2:237017303-237017325 ATTCTAAGCTCCTTGAAGGCAGG - Intergenic
1169845735 20:9989489-9989511 CTTCAAAGCTTCCTCAAGTCTGG + Intronic
1169998009 20:11580979-11581001 ACTATAAGTATCCTGAAGGCAGG - Intergenic
1170181973 20:13541623-13541645 ATGATAGGCTTCATGAAGGCAGG + Intronic
1170278013 20:14614540-14614562 ATTATAAACTTCCTGAGGGCAGG + Intronic
1170388273 20:15844284-15844306 ATTATAAGCTTCCTGACTGCAGG - Intronic
1171354397 20:24533165-24533187 CGTATAAGCTGCCTGATTGCAGG - Intronic
1172617129 20:36296655-36296677 GATGTAAGCTTCATGAAGGCAGG + Intergenic
1173187281 20:40850070-40850092 ATTATAAACTCCATGAAGGCAGG - Intergenic
1173691117 20:44961910-44961932 ACTATAAGCTTTCTGAGGGCTGG + Intergenic
1174786508 20:53437902-53437924 AGTAAAAGCTTCCTGAGGGCTGG + Intronic
1175079260 20:56404959-56404981 CTAAAAAGCTTCAGGAAGGCTGG - Exonic
1175490726 20:59379609-59379631 ATTTCAAGCTTCCTGAGGGCAGG - Intergenic
1175522446 20:59610718-59610740 ATTGTAAGCTCCCTGAGGGCAGG + Intronic
1178474074 21:32920976-32920998 ATTATAAACTCCCTGAGGGCAGG - Intergenic
1179541090 21:42083656-42083678 AATATAAGTTCCCTGAAGGCTGG + Intronic
1179773896 21:43646924-43646946 CCTAAAAGCACCCTGAAGGCAGG + Intronic
1180500846 22:15927736-15927758 CTTATTAACTTCCTGGAGGGAGG - Intergenic
1182081258 22:27530405-27530427 CATAGAAGTTTCCTGAGGGCAGG + Intergenic
1182301986 22:29342109-29342131 GTTCTAAGCACCCTGAAGGCAGG + Intronic
1182942630 22:34292227-34292249 GGTATAAGCTTCCTGAGAGCAGG + Intergenic
1183854730 22:40623629-40623651 CTTATAAGCTTTGTGATGCCAGG - Intronic
1184517222 22:44970195-44970217 ATTAAAAGCGTCCTGAAGGGAGG + Intronic
949293374 3:2492111-2492133 CTTGAAATCTCCCTGAAGGCAGG + Intronic
949718138 3:6957304-6957326 CTTGTCAGCTTGCTGAGGGCAGG + Intronic
949783836 3:7718908-7718930 CTTAGAAGTCTCTTGAAGGCTGG + Intronic
950841105 3:15969460-15969482 CTAATAAGCTTCCTAAACACTGG - Intergenic
951008441 3:17647277-17647299 CTTGTAAGCTTCATGAGGGTAGG - Intronic
951088737 3:18546307-18546329 TTTGTAAGCTTACTGGAGGCGGG + Intergenic
951517747 3:23580343-23580365 CTGATCAGGTTACTGAAGGCTGG - Intronic
951863331 3:27278286-27278308 ATTATAAGCTTCATTAAGACAGG + Intronic
952828248 3:37541780-37541802 CATGTAAACTACCTGAAGGCAGG + Intronic
954033825 3:47839588-47839610 AATATAAGAATCCTGAAGGCTGG - Intronic
954547110 3:51446314-51446336 CTTATAAGCTTACTTAAGGCTGG + Intronic
955147623 3:56335896-56335918 ACCATAAGCTTCCTGAAGGCTGG - Intronic
955188773 3:56740615-56740637 GTTTTAAGCTTCTTGAAGGCAGG - Intronic
955467939 3:59255776-59255798 ATCATAATCTTCATGAAGGCAGG - Intergenic
955469606 3:59273025-59273047 AATATAAGCTTCATGAGGGCAGG - Intergenic
955766958 3:62355010-62355032 AGTGTAAGCTTCGTGAAGGCAGG - Intergenic
956463271 3:69493715-69493737 ATTATAAGCTTCACGAAGGCAGG + Intronic
956609575 3:71108840-71108862 CTCATAAGCCTCCTGAAGGCAGG + Intronic
956962783 3:74422144-74422166 CTTATGAGCTTCTTGAGGGCAGG - Intronic
959684899 3:109134437-109134459 ATTATGTGCTTCCTGAAGGCTGG - Intergenic
960406093 3:117261810-117261832 CTGAAAAGCTTCCTGAAAGTGGG + Intergenic
960427287 3:117524329-117524351 ATTATAAGCTTCCGGAGAGCAGG - Intergenic
960691739 3:120353094-120353116 TTTCTAGGCTTCCTGAAGGCAGG + Intergenic
960801484 3:121545025-121545047 CTCATAAGATTCTTGAAGTCAGG - Intronic
961915339 3:130368484-130368506 CCTATAAACTCCTTGAAGGCAGG - Intronic
962364592 3:134769734-134769756 GTTATAATCTTCCAAAAGGCTGG - Intronic
962725499 3:138222496-138222518 CTAATAAGCTTCCTTTAGGCAGG + Intronic
962793026 3:138828548-138828570 AATATAAGCTTCATGATGGCAGG - Intronic
962848993 3:139293925-139293947 ACTATAAGCTCCCTGAAGGCAGG - Intronic
963122990 3:141792065-141792087 ACTGTAAGCTTCATGAAGGCAGG - Intronic
963265031 3:143231431-143231453 ATTATAACCTTCTTGAAGACAGG + Intergenic
963934363 3:151036880-151036902 CCTATAAGCTCCATGAGGGCAGG + Intergenic
965406623 3:168276966-168276988 GATGTAAGCTTCATGAAGGCAGG + Intergenic
965644275 3:170863541-170863563 ATTGTAATCTTCATGAAGGCAGG + Intergenic
965698805 3:171438553-171438575 ATTATAAGCTTCTTAAGGGCAGG - Intronic
966367010 3:179199996-179200018 ATAGTAAGCTTCTTGAAGGCAGG + Intronic
967013823 3:185463963-185463985 ATTATAAGCATCTTGAAGCCAGG - Intronic
967532582 3:190566113-190566135 ATTTTAAGCTGCCTGAGGGCAGG + Intronic
968427036 4:531130-531152 ATTATTAGCTCCCTGAAGCCTGG + Intronic
968627291 4:1631789-1631811 CTTAAAAGCTTCCTGAGGACGGG + Intronic
968867758 4:3224870-3224892 CTTATGAGCTCCTTGAAGGCTGG - Intronic
969064268 4:4465848-4465870 CTTAGCAGCTCCATGAAGGCAGG + Intronic
969199431 4:5590844-5590866 ACTATAAGTTTCCTGAGGGCTGG - Intronic
969407135 4:7001006-7001028 ACTCTAAGCTTCCTGAGGGCAGG + Intronic
970273486 4:14371649-14371671 CCTGTAAGCTTTGTGAAGGCAGG - Intergenic
970537743 4:17046523-17046545 AATATAAGCTTCATGAAGACAGG - Intergenic
970597943 4:17616972-17616994 ATTACAAGCTTCCTGAAGGCAGG - Intronic
970879982 4:20917489-20917511 GCCATAAGCTTCCTGAGGGCAGG - Intronic
971128599 4:23781075-23781097 ATTAGAAGTTTCTTGAAGGCAGG + Intronic
972135540 4:35888387-35888409 ATTATAAGCTTCATGACAGCAGG + Intergenic
972218033 4:36919141-36919163 CATATAAGCTACCTGATGGCTGG - Intergenic
972713266 4:41620055-41620077 ATTGTAAGATTCTTGAAGGCAGG - Intronic
973026543 4:45280428-45280450 CTTATGAGCTTCTTAAGGGCTGG + Intergenic
973607258 4:52600153-52600175 ATTATAAGCTTTGTGAGGGCAGG + Intronic
973906261 4:55534634-55534656 AACATAAGCTCCCTGAAGGCAGG + Intronic
974011778 4:56613644-56613666 GTTTTAAGTTTCCTGAAGCCAGG - Intergenic
974155229 4:58062817-58062839 ATTATAAGCTCCCAGAAGACAGG + Intergenic
975532519 4:75415466-75415488 ATTATAAATTTCCTGAAGGCTGG - Intergenic
976087746 4:81423456-81423478 AGTTTAAGCTTGCTGAAGGCTGG + Intergenic
976279180 4:83310064-83310086 TTTTCTAGCTTCCTGAAGGCTGG - Exonic
976542620 4:86295477-86295499 ATTATAACCTTCATGAAGGCAGG + Intronic
977463986 4:97359712-97359734 CATATATGCTTCATGAAGGCAGG + Intronic
977767212 4:100813246-100813268 ATTATAAACTTTCTGAAGGCAGG - Intronic
977985730 4:103380358-103380380 CTGCTAAGCTGCCTGGAGGCAGG - Intergenic
978020303 4:103801490-103801512 ATTATAAACTTTATGAAGGCAGG + Intergenic
978167089 4:105622371-105622393 CATTTTAGCTTCCTGGAGGCTGG - Intronic
978235681 4:106455897-106455919 ATTATAAGCTTGATGATGGCAGG + Intergenic
978649028 4:110978158-110978180 CCTATAAGCTTTCTGAAGGCAGG + Intergenic
978981083 4:114946304-114946326 AATGTAAGCTCCCTGAAGGCAGG - Intronic
981496947 4:145404470-145404492 ACTATAAGTTTCATGAAGGCAGG + Intergenic
982093716 4:151901186-151901208 ACTATAAGCTCCTTGAAGGCAGG - Intergenic
982730524 4:158951105-158951127 GTTATAAGCTTCTTGATGGTAGG + Intronic
982736844 4:159015898-159015920 ATTATAAGCTTTCTGAGGACTGG - Intronic
982992431 4:162295278-162295300 TGTCTAAGCTTCCTGAAGACTGG + Intergenic
983494733 4:168429899-168429921 ATTATAAGTTCCCTGAAGGCTGG + Intronic
984376288 4:178934862-178934884 TTTATAAGTTTCCCAAAGGCTGG + Intergenic
984904229 4:184611800-184611822 CTAATAAGTTGACTGAAGGCTGG - Intergenic
985208263 4:187564176-187564198 CTTTTAAGAGTCCTCAAGGCTGG - Intergenic
986612066 5:9578859-9578881 CTCATAAGCTCCCTGAAGGCAGG + Intergenic
986848358 5:11781426-11781448 ATTATAAGCTTCCTAAAGGGCGG - Intronic
987040731 5:14059854-14059876 AATATAAGCTTCCTGAGGGCAGG - Intergenic
988934957 5:36072286-36072308 ATCATAAGCTCCATGAAGGCAGG - Intergenic
990075412 5:51840484-51840506 ATTGTAAGCTTCTTAAAGGCAGG + Intergenic
990636286 5:57731580-57731602 AATATAAGCTTCATGAAAGCAGG - Intergenic
991478103 5:67045090-67045112 ATTATAAACTTCTTGAAGGCAGG + Intronic
992664582 5:78994627-78994649 TCTATAAACTTCATGAAGGCAGG + Intergenic
993077342 5:83250519-83250541 TTTATAAGCTCCATGAAGGCAGG - Intronic
993880701 5:93357303-93357325 CTTTTAAGCTCACTCAAGGCAGG - Intergenic
994194823 5:96910920-96910942 ATTGTAAGCTTCTTGAAGGTAGG - Intronic
994388090 5:99156606-99156628 TTTATAAGCTCCAAGAAGGCAGG - Intergenic
994534581 5:101012116-101012138 AATATAAGCTTACTGAAGGCAGG - Intergenic
994738243 5:103585184-103585206 CTTATGAATTTCTTGAAGGCAGG - Intergenic
995659340 5:114463692-114463714 CTTGTAAGCTCCATGAAGGCAGG - Intronic
995838956 5:116425004-116425026 CTTATGAGTTCCCTGAAGGAGGG + Intergenic
997604952 5:135168189-135168211 GATATAAGCTCCATGAAGGCAGG - Intronic
997967451 5:138370076-138370098 CTTGTAAGTTACTTGAAGGCAGG + Intronic
998007111 5:138664375-138664397 GTAATAAGCTCCATGAAGGCGGG + Intronic
998019526 5:138757696-138757718 CTTGTAAGCTCCTTGAAGGCAGG + Intronic
998295204 5:140963092-140963114 ATTATAAGCAACCTGAAAGCAGG - Intronic
998602334 5:143597777-143597799 ATTATAAGCTTCTTGAGGGCAGG + Intergenic
998910908 5:146959349-146959371 ACTGTAAGCTTTCTGAAGGCAGG - Intronic
999707749 5:154289488-154289510 ACTGTAAGCTTCTTGAAGGCAGG - Intronic
1000364375 5:160477468-160477490 CTCATGAGCTTCCAGAGGGCAGG + Intergenic
1000770271 5:165344299-165344321 AATATAAGTTTCCTGAAGGTAGG + Intergenic
1001110768 5:168894291-168894313 ATTATTAGCTTCGTGTAGGCAGG + Intronic
1001145434 5:169179938-169179960 ATTGTAAGCTTCTTGAATGCAGG - Intronic
1001259673 5:170217437-170217459 ATTATAGGCTTCATGAAGACAGG - Intergenic
1004087583 6:12465769-12465791 AATATAGGCTTCCTGAGGGCAGG + Intergenic
1005133260 6:22537042-22537064 ATTATAAGCTCACTGAAGCCAGG + Intergenic
1005618168 6:27595221-27595243 CTGATAGGATTCTTGAAGGCAGG - Intergenic
1006137349 6:31903071-31903093 CTTAGGAGCGTCTTGAAGGCTGG + Intronic
1006750154 6:36371963-36371985 CATATAAGCTCCCTGAGGGCAGG - Intronic
1006916419 6:37596847-37596869 ACTAGAAGCTCCCTGAAGGCAGG + Intergenic
1006917098 6:37601775-37601797 ACTAGAAGCTCCCTGAAGGCAGG + Intergenic
1007016566 6:38473706-38473728 ATTGTAAGCTCCATGAAGGCAGG - Intronic
1007149173 6:39671075-39671097 ACTATAAGCTTCTTGAAGTCAGG - Intronic
1007229570 6:40338916-40338938 CTTGTAAGCTCCCTGAGGGCAGG + Intergenic
1007391581 6:41552470-41552492 CTCAGAGGCTTCCTGAAGGAGGG - Intronic
1007834368 6:44663474-44663496 CACATAAACTTCTTGAAGGCTGG - Intergenic
1008493693 6:52111633-52111655 ACTGTAAGCTTCCTGAGGGCAGG - Intergenic
1008697411 6:54055904-54055926 ATTCTAAGCTTCATGAAAGCAGG - Intronic
1009336983 6:62503531-62503553 ATTGTAAGCTACCTGAAGCCAGG - Intergenic
1010946282 6:81976771-81976793 ATTGTAAGCTTCCTGAGGCCAGG + Intergenic
1012024492 6:93971503-93971525 GTGACAAGCTTCCTGATGGCAGG - Intergenic
1012290247 6:97446769-97446791 AATAGAAGCTTCCTCAAGGCAGG - Intergenic
1012469005 6:99548689-99548711 CCTATAATCCTCCTGTAGGCAGG + Intronic
1012884244 6:104826313-104826335 ACTATAAACTTCTTGAAGGCAGG - Intronic
1012932454 6:105331272-105331294 CTTATAACCTTTCAGAAGGAAGG + Intronic
1012992336 6:105938826-105938848 CCTATATCCTTCCTGAAGACAGG - Intergenic
1013312823 6:108913348-108913370 ATTTTAAGCATCTTGAAGGCAGG - Intronic
1013324708 6:109032986-109033008 ATTATAAGGTTCCTTAGGGCTGG - Intronic
1013790088 6:113826660-113826682 GTTATAAGCTCCTTGAAGGTAGG - Intergenic
1013837773 6:114353038-114353060 CTTCTTAGCTTCCAGAAGGCAGG - Intergenic
1013996221 6:116311302-116311324 AATATAAGCATCCTGAGGGCAGG + Intronic
1014159094 6:118146682-118146704 CCTCTAAACTTCCTGGAGGCAGG + Intronic
1014876431 6:126666678-126666700 CTTACAAGATTTTTGAAGGCTGG - Intergenic
1015090901 6:129357141-129357163 TTTTTAAGTTTCTTGAAGGCAGG - Intronic
1015188863 6:130450953-130450975 CTTGTAAGCTCCTTGAAGGATGG - Intergenic
1015485557 6:133766219-133766241 ATTATCAGCTCCTTGAAGGCAGG - Intergenic
1015555825 6:134460261-134460283 AATATAAGCTTCATGAAGGCAGG + Intergenic
1015579282 6:134705732-134705754 ACTATAAGCTCCATGAAGGCAGG + Intergenic
1015747927 6:136530388-136530410 CTTAAAAGATTGCTGAAGTCCGG - Intronic
1015767958 6:136738984-136739006 ATCATAAGCTTTCTGAGGGCAGG - Intronic
1016801758 6:148175928-148175950 GCTGTAAGCTTCCAGAAGGCAGG - Intergenic
1017161658 6:151371286-151371308 CTTGTAAGTTTCTTGAGGGCAGG - Intronic
1017405960 6:154118739-154118761 CTTCTAAGCTTGGTGAAGGTCGG - Exonic
1017410600 6:154163548-154163570 AACATAAGCTTCCGGAAGGCAGG + Intronic
1017912672 6:158807758-158807780 AATATAAGCTTCTTGAAAGCAGG + Intronic
1017917871 6:158846605-158846627 CCTACAAGCTTCTTAAAGGCAGG + Intergenic
1018158414 6:161012416-161012438 CTTATAAATTCTCTGAAGGCAGG - Intronic
1018205036 6:161429316-161429338 ACTATAAGCTCCCTGAGGGCAGG - Intronic
1020677305 7:11197428-11197450 CTTAACTGCTTCCTGATGGCAGG - Intergenic
1021359664 7:19695570-19695592 CAAATAAGTTTCCTGAGGGCTGG - Exonic
1021821877 7:24506548-24506570 ACTATAAGCTTCTTGAAGGCAGG - Intergenic
1021846162 7:24764919-24764941 GTTGTAAGCTTCTTAAAGGCAGG - Intergenic
1021908576 7:25361337-25361359 AATGTAAGCTTCTTGAAGGCAGG + Intergenic
1021974810 7:26001548-26001570 GTTGTAAGCTTCTTGAAGACAGG + Intergenic
1022006150 7:26267294-26267316 ACTATGGGCTTCCTGAAGGCAGG - Intergenic
1022748252 7:33195132-33195154 TCTATAAGCTTCCTGAGGGCAGG + Intronic
1023068126 7:36400298-36400320 CCTATAAGGTTTCTTAAGGCAGG + Intronic
1023202862 7:37717765-37717787 ATTATAAGCTCCTTGAGGGCAGG + Intronic
1023729324 7:43175428-43175450 CTTTTAACCTTCCTGTATGCTGG - Intronic
1024977386 7:55126238-55126260 ATGGTAAGCTTCCTGAGGGCAGG + Intronic
1025072888 7:55916524-55916546 AATATAAGCTTCATAAAGGCAGG + Intronic
1026311622 7:69190731-69190753 GTTGCAAGCTCCCTGAAGGCAGG + Intergenic
1027196151 7:76031898-76031920 ACTATAACCTTCATGAAGGCAGG - Intronic
1027441168 7:78220428-78220450 ATTATAAGCTTCTTGAGGGCAGG + Intronic
1027613820 7:80395898-80395920 ATTATGAGCTTCTTGAAGGCAGG - Intronic
1027616303 7:80428750-80428772 ATTAAATGCTTTCTGAAGGCAGG - Intronic
1028726606 7:94095195-94095217 ATTAAAAGCTTCCTGAAGTATGG + Intergenic
1030217747 7:107063439-107063461 ATTATAAGCTCCATGAGGGCAGG - Intronic
1030773676 7:113506893-113506915 ATTATAAGTTCCATGAAGGCAGG - Intergenic
1031244253 7:119287868-119287890 AGTAAAAGCTTCCTGAATGCTGG - Intergenic
1032275594 7:130452528-130452550 CCTATCAGCTCCTTGAAGGCAGG + Intergenic
1033434320 7:141319321-141319343 CTCATAAGCCTGTTGAAGGCAGG - Intronic
1033599692 7:142880125-142880147 CTTATATGCTTGCTGAAAGTTGG - Intronic
1033991136 7:147288289-147288311 AATATAAGCTCCCTGAGGGCAGG + Intronic
1034514201 7:151561634-151561656 CTTAAAAGCTTCATGATGGCCGG + Intronic
1034644383 7:152632041-152632063 ATTATAAGCTTTTTGAAAGCAGG - Intergenic
1035149729 7:156859880-156859902 CCTATAAGTCTCCTGAAGTCAGG - Intronic
1035279955 7:157771556-157771578 GTTGTAAGCTCCCTGAGGGCAGG - Intronic
1036183146 8:6601998-6602020 ATGATGAGCTTCCTGAATGCAGG + Intronic
1036286885 8:7450690-7450712 AATATAAGCTCCCGGAAGGCAGG - Exonic
1036334593 8:7860834-7860856 AATATAAGCTCCCGGAAGGCAGG + Intronic
1037048151 8:14335842-14335864 GTTATAAGCTTATTGCAGGCAGG + Intronic
1037478166 8:19277964-19277986 GCTATAAGCTTCAAGAAGGCAGG + Intergenic
1037487133 8:19358311-19358333 AATATAAGCTCCCTGAAGGCAGG - Intronic
1038054531 8:23845946-23845968 ACTGTAAGCTTACTGAAGGCAGG + Intronic
1038364708 8:26919351-26919373 ATTATAAACTCCATGAAGGCAGG - Intergenic
1038446551 8:27608582-27608604 TAGATAAGCTTCCTGAAGGTTGG + Intronic
1038453306 8:27653811-27653833 ATTATAAGCTCCATGAAGGCAGG - Intronic
1038697728 8:29820952-29820974 GCTATAAGCTCCCTGAGGGCTGG + Intergenic
1038753595 8:30319480-30319502 CATGTAAGTTTCTTGAAGGCTGG - Intergenic
1039996477 8:42538661-42538683 CCTTTAAGCTCCCTGAATGCAGG - Intronic
1040536619 8:48316417-48316439 GTTGTAGGGTTCCTGAAGGCAGG - Intergenic
1040676996 8:49762390-49762412 CTTGTAAGCTGCTTAAAGGCAGG + Intergenic
1041767210 8:61431680-61431702 AGTATAAGCTCCTTGAAGGCAGG + Intronic
1041861546 8:62519119-62519141 ATTAGAAGCTCACTGAAGGCAGG - Intronic
1042562778 8:70085543-70085565 CTTTTAAGCTTTGTGAGGGCAGG - Intergenic
1043063348 8:75533002-75533024 ATTATAAGCTCCATGAGGGCAGG + Intronic
1043554716 8:81417854-81417876 TTGATAAGCTTCCTGAAAGCTGG - Intergenic
1043872681 8:85452177-85452199 CTTAAAATCTCCCTGGAGGCAGG - Intergenic
1043927888 8:86058588-86058610 ATTATAAGCTCCTTAAAGGCAGG - Intronic
1044373631 8:91444188-91444210 GATATAAGCTTCTTGAGGGCAGG + Intergenic
1044531995 8:93317644-93317666 ATTATAAGGTTCTTGAGGGCAGG + Intergenic
1044778202 8:95715808-95715830 ATTAGAAGCTTCCTGAATACAGG - Intergenic
1044778535 8:95719997-95720019 ATTAGAAGCTTCCTGAAGACAGG - Intergenic
1044937939 8:97310988-97311010 CTTATTAGCTTCTGGATGGCAGG - Intergenic
1045295833 8:100871136-100871158 CGTGTAAGCTTCCTGAAGGCAGG - Intergenic
1046007004 8:108499327-108499349 TTTATAAGCTTCCAGAAACCAGG - Intergenic
1046219415 8:111193455-111193477 CTTTTCACTTTCCTGAAGGCAGG - Intergenic
1047204214 8:122790450-122790472 ACTATGACCTTCCTGAAGGCAGG - Intronic
1047407871 8:124600484-124600506 TCTGTGAGCTTCCTGAAGGCAGG + Intronic
1048101214 8:131353484-131353506 TGTATAAGTTTCATGAAGGCAGG + Intergenic
1048236235 8:132693562-132693584 AATATAAGCTTCTTGAGGGCAGG - Intronic
1049239327 8:141528941-141528963 CTTGTAAGCCTCCTGAAGGGTGG + Intergenic
1049386423 8:142345177-142345199 CGGACCAGCTTCCTGAAGGCAGG + Intronic
1050159201 9:2699464-2699486 CATATAAGATTCCGGAAGGCAGG - Intergenic
1050331906 9:4554366-4554388 GTTTTAAGCTCCATGAAGGCAGG - Intronic
1050609038 9:7331978-7332000 CATATAAGCTGATTGAAGGCAGG + Intergenic
1051114972 9:13684181-13684203 TTTAGAAGCTTCCTGAAAGAAGG + Intergenic
1055721061 9:79175316-79175338 CTTATAAGCTGTTTGAGGGCAGG + Intergenic
1056327060 9:85488923-85488945 ATTATAATCTCCATGAAGGCAGG + Intergenic
1056432705 9:86544184-86544206 AATATGAGCTTCTTGAAGGCAGG - Intergenic
1056605286 9:88080290-88080312 CTAATCAGCTTTCTGAACGCTGG - Intergenic
1057698823 9:97348412-97348434 AGTAAAAGCTCCCTGAAGGCTGG + Intronic
1057731672 9:97614482-97614504 TTTATAAGCTTCATGAGGACAGG - Intronic
1058001965 9:99875204-99875226 ATTATAAGCTCCTTAAAGGCAGG - Intergenic
1058397466 9:104570855-104570877 CATATAAGCTCCCTGAGGGTAGG + Intergenic
1058795441 9:108493461-108493483 AATATAAGCTTCTTGAAGACAGG - Intergenic
1059446442 9:114341252-114341274 GTTATAAGCTCCCAGAGGGCAGG + Intronic
1059507032 9:114808900-114808922 AATATAAGCTTCATGAAAGCAGG - Intergenic
1059770279 9:117417256-117417278 ATTATAAGCTTTCCAAAGGCAGG - Intergenic
1060573338 9:124664814-124664836 CTTGTTAGCTCCATGAAGGCAGG - Intronic
1061141164 9:128767828-128767850 ATTGAAAGCTTCCTGAGGGCAGG + Intronic
1186106375 X:6211947-6211969 CTTAAAAGCCTCCTTGAGGCTGG + Intronic
1186237693 X:7531412-7531434 TCTATAAGCTTCCAGAGGGCAGG - Intergenic
1186556033 X:10559770-10559792 ACTATAAGCTCCATGAAGGCAGG + Intronic
1186950554 X:14619794-14619816 ATTATAAGCTCCATGAAGGCAGG + Intronic
1186974445 X:14886043-14886065 CTAATAAGCTCCATGAAGTCAGG - Intronic
1187590356 X:20711040-20711062 GGTGTAAGCTCCCTGAAGGCAGG + Intergenic
1188252731 X:27918630-27918652 AATATAAGCTTCCTGTGGGCAGG + Intergenic
1189114220 X:38327080-38327102 TTGATGAGCTTCTTGAAGGCAGG - Intronic
1189230133 X:39445611-39445633 CTTAAAAGCTTCCAGAAGAATGG - Intergenic
1189976284 X:46463599-46463621 CTTAAAAGCTTCCAGAAAGGTGG - Intronic
1190909613 X:54758881-54758903 CTTATCATCTTCCTGACGGATGG - Exonic
1191880585 X:65840803-65840825 GTTATAAGCTTCCTGAGAGCAGG + Intergenic
1191931839 X:66382154-66382176 CTTGCAGGGTTCCTGAAGGCAGG + Intergenic
1192173167 X:68869297-68869319 CCTGTAAGCTCCATGAAGGCGGG + Intergenic
1192590657 X:72356878-72356900 TTTAAAAGCTTGCAGAAGGCTGG - Intronic
1194655355 X:96566684-96566706 AGTATAAGCTCCTTGAAGGCAGG - Intergenic
1195402704 X:104478538-104478560 CTTCTAAGATTCCTCAAGGTGGG - Intergenic
1195859456 X:109367345-109367367 TTTACAAGATTCTTGAAGGCAGG - Intergenic
1195959251 X:110368713-110368735 AATATAAGCTTCAGGAAGGCAGG + Intronic
1196107453 X:111911983-111912005 CTTGTAAGCTCCATGAAAGCAGG + Intronic
1196201597 X:112892302-112892324 ATTATGGGCTTCCTGAAGGCAGG + Intergenic
1196624244 X:117860016-117860038 AATATAAGCTCCATGAAGGCAGG - Intergenic
1196981646 X:121220969-121220991 CTTATAAGTTCCATTAAGGCAGG + Intergenic
1197251076 X:124217024-124217046 CTTATAACCTCTCTAAAGGCAGG + Intronic
1198486683 X:137094374-137094396 ACTATAAGCTACGTGAAGGCAGG + Intergenic
1198757485 X:139996633-139996655 CTCACAGACTTCCTGAAGGCAGG - Intergenic
1199141529 X:144319524-144319546 CAAATAAGCTTCCTGAGGTCAGG - Intergenic
1199430559 X:147754606-147754628 CTTGTAAGCTCCATGAAAGCAGG + Intergenic
1199522760 X:148754848-148754870 ATTATGAGCTTCCGGAGGGCAGG - Intronic
1200311914 X:155086653-155086675 TTTGTAAGCTTCCTCAAAGCAGG + Intronic
1201605365 Y:15778390-15778412 CTATTGAGCTTCCTGAAGCCAGG - Intergenic