ID: 907255572

View in Genome Browser
Species Human (GRCh38)
Location 1:53176158-53176180
Sequence GTACAACCCTGTGCTAAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907255569_907255572 5 Left 907255569 1:53176130-53176152 CCAAAAATCTCTAATAAGGGCTG No data
Right 907255572 1:53176158-53176180 GTACAACCCTGTGCTAAGGGCGG No data
907255566_907255572 23 Left 907255566 1:53176112-53176134 CCTCTTGTATTTCATTCACCAAA No data
Right 907255572 1:53176158-53176180 GTACAACCCTGTGCTAAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907255572 Original CRISPR GTACAACCCTGTGCTAAGGG CGG Intergenic
No off target data available for this crispr