ID: 907257042

View in Genome Browser
Species Human (GRCh38)
Location 1:53187406-53187428
Sequence GACTGAAGACCACTGGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907257038_907257042 2 Left 907257038 1:53187381-53187403 CCAGATGACTCTAGTGTTCAGCC No data
Right 907257042 1:53187406-53187428 GACTGAAGACCACTGGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907257042 Original CRISPR GACTGAAGACCACTGGCCTA AGG Intergenic
No off target data available for this crispr