ID: 907257445

View in Genome Browser
Species Human (GRCh38)
Location 1:53190612-53190634
Sequence AGCTTCCGCCACGGGAATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907257439_907257445 25 Left 907257439 1:53190564-53190586 CCAGCGGCCACCGTCACGTGGGG No data
Right 907257445 1:53190612-53190634 AGCTTCCGCCACGGGAATTCAGG No data
907257437_907257445 26 Left 907257437 1:53190563-53190585 CCCAGCGGCCACCGTCACGTGGG No data
Right 907257445 1:53190612-53190634 AGCTTCCGCCACGGGAATTCAGG No data
907257442_907257445 15 Left 907257442 1:53190574-53190596 CCGTCACGTGGGGATAACAAGAT No data
Right 907257445 1:53190612-53190634 AGCTTCCGCCACGGGAATTCAGG No data
907257435_907257445 27 Left 907257435 1:53190562-53190584 CCCCAGCGGCCACCGTCACGTGG No data
Right 907257445 1:53190612-53190634 AGCTTCCGCCACGGGAATTCAGG No data
907257441_907257445 18 Left 907257441 1:53190571-53190593 CCACCGTCACGTGGGGATAACAA No data
Right 907257445 1:53190612-53190634 AGCTTCCGCCACGGGAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907257445 Original CRISPR AGCTTCCGCCACGGGAATTC AGG Intergenic
No off target data available for this crispr