ID: 907258559

View in Genome Browser
Species Human (GRCh38)
Location 1:53198263-53198285
Sequence CCACACATGGGGAAGAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907258559_907258565 11 Left 907258559 1:53198263-53198285 CCAGGCTTCTTCCCCATGTGTGG 0: 1
1: 0
2: 1
3: 26
4: 206
Right 907258565 1:53198297-53198319 ACAGGCCTCACCCGAGCTGCTGG 0: 1
1: 0
2: 0
3: 20
4: 136
907258559_907258566 12 Left 907258559 1:53198263-53198285 CCAGGCTTCTTCCCCATGTGTGG 0: 1
1: 0
2: 1
3: 26
4: 206
Right 907258566 1:53198298-53198320 CAGGCCTCACCCGAGCTGCTGGG 0: 1
1: 0
2: 3
3: 15
4: 206
907258559_907258564 -7 Left 907258559 1:53198263-53198285 CCAGGCTTCTTCCCCATGTGTGG 0: 1
1: 0
2: 1
3: 26
4: 206
Right 907258564 1:53198279-53198301 TGTGTGGAACATTGTGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907258559 Original CRISPR CCACACATGGGGAAGAAGCC TGG (reversed) Intronic
900923363 1:5687789-5687811 GCCCACTTGGGGAAGAACCCAGG - Intergenic
900994185 1:6111576-6111598 AGACACATAAGGAAGAAGCCGGG + Intronic
901849427 1:12006299-12006321 CCACACTCGGGGAAGCTGCCAGG + Intronic
904196215 1:28787626-28787648 TTACACAGGGGGAAGAATCCTGG - Intergenic
904612611 1:31733702-31733724 CCACACACAGAGAAGACGCCAGG + Intronic
906654773 1:47539991-47540013 CCACACATGGTGCAGCAACCAGG + Intergenic
907258559 1:53198263-53198285 CCACACATGGGGAAGAAGCCTGG - Intronic
907592168 1:55685719-55685741 CCAGAGATGGGGAAAACGCCTGG - Intergenic
907702443 1:56802145-56802167 TTCCAGATGGGGAAGAAGCCAGG - Intronic
909327093 1:74364518-74364540 CCTTACATGGGGAAGAATCAAGG + Intronic
909327113 1:74364611-74364633 CCTTACATGGGGAAGAATCAAGG + Intronic
911056444 1:93712363-93712385 CCACACATGGGCAGGAACACTGG + Intronic
912439216 1:109686142-109686164 ACACACATGGGTCAGGAGCCAGG + Intronic
912442532 1:109710584-109710606 ACACACATGGGTCAGGAGCCAGG + Intergenic
913408685 1:118526143-118526165 CCACACATGGAGAAGTCCCCTGG - Intergenic
917119623 1:171634106-171634128 GCACTCAGGGGGAAGAACCCAGG - Intergenic
918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG + Intronic
920042556 1:203111756-203111778 CCACTGATAGGGAGGAAGCCTGG + Intronic
922185603 1:223271567-223271589 CCCAACAAGGGGAAGAGGCCAGG + Intronic
922712420 1:227844247-227844269 CCACAGATGGGGAGGAGCCCAGG - Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1064004002 10:11686052-11686074 CTACAAAAGAGGAAGAAGCCAGG - Intergenic
1065755277 10:28925054-28925076 CCACACATGGGGAGGATGCGGGG - Intergenic
1067480964 10:46597434-46597456 CCACACGTGGGGAAGGCTCCTGG - Intergenic
1067613789 10:47744388-47744410 CCACACGTGGGGAAGGCTCCTGG + Intergenic
1070900318 10:80022706-80022728 CACCCCATGGGGGAGAAGCCTGG - Intergenic
1071629199 10:87204360-87204382 CCACACGTGGGGAAGGCTCCTGG + Intergenic
1072806230 10:98425496-98425518 CCCCACCTGGGGAAGAGGCAGGG - Intronic
1074381874 10:112987828-112987850 ACACACAGGAGGAAAAAGCCTGG + Intronic
1076292898 10:129361407-129361429 CAACACCTGGGGAAGCTGCCAGG - Intergenic
1076658205 10:132037932-132037954 CCACAAATCTGGAAGAAGCCGGG + Intergenic
1079359759 11:19760587-19760609 CTACAGAGGGGAAAGAAGCCTGG - Intronic
1080029511 11:27646169-27646191 GAAAACACGGGGAAGAAGCCAGG + Intergenic
1081917766 11:46744489-46744511 ACACAAATGGGGAAGAAGTGGGG - Exonic
1083406231 11:62459103-62459125 CCACACAAGGGCAAGGAGCAGGG + Intronic
1085042074 11:73332336-73332358 ACACACACGGAGAAAAAGCCTGG - Intronic
1088278825 11:108116726-108116748 CCACACACAGGGGAGAAGACAGG + Intergenic
1088469729 11:110179147-110179169 CCACCCAAGGGCCAGAAGCCGGG + Intronic
1089603393 11:119628195-119628217 CCACATACGGTGAGGAAGCCTGG - Intronic
1090272962 11:125400651-125400673 CTACCCTTGGGGAAGAAGCTGGG - Intronic
1090937819 11:131360787-131360809 ACATACTGGGGGAAGAAGCCAGG + Intergenic
1091328626 11:134712841-134712863 CCACCTAAGGCGAAGAAGCCGGG + Intergenic
1092614612 12:10205490-10205512 CCACACATTGGAAAGACACCAGG + Intergenic
1093151291 12:15624901-15624923 TCACACAGTGGGTAGAAGCCTGG + Intronic
1093223633 12:16453780-16453802 ACGCACATGGGGAAAATGCCAGG - Intronic
1101080947 12:101183785-101183807 ACACACATGGGGCTGAAGCGTGG - Intronic
1101150852 12:101881080-101881102 CCACACATAGAGAAGAAGGCTGG + Intronic
1101682313 12:106981153-106981175 CCACACGTGGGGGAGGAGCGTGG + Intronic
1104289938 12:127457299-127457321 ACACACACGGGAAAGAGGCCGGG - Intergenic
1104587362 12:130058072-130058094 CCACACTTCTGGAAGACGCCTGG - Intergenic
1104725806 12:131075002-131075024 CCACACGTGGGGCAGAGGCGGGG + Intronic
1104731961 12:131111959-131111981 ACACACATGGGGAAAAATCCAGG - Intronic
1105986302 13:25570856-25570878 CCTCACCTGGGGAAGAGGCCTGG - Exonic
1106025129 13:25949036-25949058 CCACAGAGGGGGATGAAGTCAGG - Intronic
1106493954 13:30257476-30257498 CCAGCCATGGGCAAGCAGCCTGG - Intronic
1107128054 13:36865651-36865673 GCACACTTCGGGAGGAAGCCTGG + Exonic
1107908416 13:45083071-45083093 CAACAGAGGGAGAAGAAGCCAGG - Intergenic
1108826290 13:54416271-54416293 CCACACAATGGGAAGCAGCAGGG - Intergenic
1110031097 13:70614955-70614977 TGACACATAGGGAGGAAGCCAGG - Intergenic
1110269977 13:73578812-73578834 CCAGACATGTGGAAGAAGGAGGG - Intergenic
1113144886 13:107197542-107197564 CCACACATGAAGAAGCAGGCAGG - Intronic
1113312694 13:109147568-109147590 CCGCACATAGGCAAGAAGCCTGG - Intronic
1113469145 13:110531999-110532021 CAACACTTGGGGTAGAAGCCTGG - Intronic
1113960397 13:114122705-114122727 CCACACAGGGGGACGCAGCTAGG + Intronic
1114837289 14:26217995-26218017 ACACACTTTGGGAAGGAGCCAGG - Intergenic
1119433396 14:74582981-74583003 CCAGCCTTGGGGAAGAAGCCAGG + Intronic
1121117090 14:91351540-91351562 CCACCCATGGGGAAGGAGGCAGG + Intronic
1121736593 14:96222208-96222230 CCACACGTGGGGCAGGGGCCTGG + Intronic
1122007770 14:98719333-98719355 CCAGAGATGGAGAATAAGCCTGG + Intergenic
1122588442 14:102827200-102827222 CCGCACAGGAGGAAGAACCCGGG - Intronic
1122796243 14:104207593-104207615 TCGCACATGGGGAGGAGGCCTGG - Intergenic
1123042156 14:105494708-105494730 CCATCCCTGGGGAAGATGCCTGG - Intronic
1124585562 15:31002871-31002893 CCTCACATTCAGAAGAAGCCCGG + Exonic
1126531776 15:49718772-49718794 GCACACATGGGGAAGCACCAGGG + Intergenic
1126729026 15:51662592-51662614 CCAAAAATGGGGAAGAAGGGTGG - Intergenic
1127844303 15:62856410-62856432 CCACAGAGGGAGAAGAAGCTGGG + Intergenic
1128074958 15:64820162-64820184 CCAAACATGGGGAATAAGCAGGG + Intronic
1128522153 15:68382553-68382575 CCACAGATGGTGAAGAAGAAAGG - Intronic
1128932816 15:71720732-71720754 CCAGAAATGGCAAAGAAGCCAGG + Intronic
1130008153 15:80123212-80123234 GCACACATGGGGAAGAAAAAAGG - Intronic
1130056893 15:80533797-80533819 GCACACAGTGGGCAGAAGCCTGG + Intronic
1131145605 15:90009616-90009638 CCAGACCTAGGGAGGAAGCCAGG - Intronic
1131403058 15:92141933-92141955 CCACACATGGGGAGCAGGCTGGG - Intronic
1131421165 15:92306563-92306585 CCACAATTGGGGAAGAGGACGGG + Intergenic
1131510081 15:93044942-93044964 CCACACATGGGGAAGCCGAGAGG + Exonic
1133276515 16:4641297-4641319 CCACACATGGAGAAGAAACACGG - Intronic
1135571430 16:23552286-23552308 CCACCCAGGTGCAAGAAGCCTGG + Exonic
1137446636 16:48536153-48536175 CCACACAGTGGGAAGAAGTAAGG + Intergenic
1138710491 16:58965407-58965429 CCCTATATGGGGAAGAAGGCAGG - Intergenic
1139609853 16:68048137-68048159 CCACACATGGCAAAGAACACAGG - Intronic
1141703543 16:85653065-85653087 CCCCACATGGGGAAGATGCTGGG + Intronic
1141884478 16:86882383-86882405 GCACAACTGGGGAAGAGGCCAGG + Intergenic
1143119343 17:4597373-4597395 CCCCACCTGGGGAAGAAGTTGGG - Intronic
1143712014 17:8741808-8741830 CCACCCATGGGGCAGAAGAGGGG + Intronic
1143869582 17:9948799-9948821 CCACACAATGGGGAAAAGCCAGG - Intronic
1146685500 17:34838832-34838854 CCACACATGGAGAAGAAGAAAGG - Intergenic
1146729719 17:35183155-35183177 CCACACCAGGGGAAGGAGGCAGG - Intronic
1147974863 17:44241259-44241281 CCCCAAAACGGGAAGAAGCCAGG - Intergenic
1148231914 17:45941473-45941495 ACACCCCTGGGGTAGAAGCCAGG - Intronic
1151259622 17:72906300-72906322 CCACAAATGGCCAGGAAGCCAGG + Intronic
1151582882 17:74990112-74990134 CCAGAAATGGGAAAGGAGCCAGG + Intronic
1151975379 17:77481172-77481194 CCACACACGGGTCAGAGGCCTGG - Intronic
1157477761 18:48034396-48034418 GCACACACGGGGAAGGAGCCAGG - Intronic
1158956290 18:62542958-62542980 CCAATCATGGGTAAGAAGACAGG - Intronic
1160225707 18:77009273-77009295 CCACACAAGGAGAAGAGGACAGG + Intronic
1160627969 18:80225984-80226006 CCATACATGTTAAAGAAGCCTGG - Intronic
1162194184 19:8971632-8971654 GCACACTTGGGGAAGGAGCAGGG + Intronic
1163444657 19:17339360-17339382 CCAGACATGGGGTAGAACCTGGG + Intronic
1165935254 19:39385021-39385043 CCAGGGAGGGGGAAGAAGCCAGG + Intronic
1166083869 19:40462231-40462253 TCACACATGGGGGAGCAGCAGGG + Intronic
1167143871 19:47670864-47670886 TGACACAGGGGGAGGAAGCCTGG + Intronic
1167720902 19:51179661-51179683 CCACAGGTGTGGAGGAAGCCAGG - Intergenic
1167843482 19:52140707-52140729 CCACACATGGGTGAGAATCAAGG - Intergenic
1168130627 19:54316326-54316348 TCAGACATGGGGAAGACGCTGGG - Intergenic
926214309 2:10894785-10894807 CCACAAATGGGGATGCAGTCAGG - Intergenic
926326257 2:11786736-11786758 CTACGCATGGCGCAGAAGCCAGG - Intronic
926400019 2:12487644-12487666 CCACACATGGGGCGAATGCCTGG - Intergenic
926957026 2:18312753-18312775 CCACATATGGGAAAAGAGCCTGG + Intronic
929332855 2:40704895-40704917 AGACACATGGGGAAGATGCATGG - Intergenic
930037906 2:47099345-47099367 TCACACCTGGGGCAGCAGCCTGG - Intronic
932634016 2:73372163-73372185 TCACAAATGGGGATGAAGTCTGG - Intergenic
934930918 2:98422046-98422068 ACACACATGGGGAAAAAAACAGG + Intergenic
938768348 2:134479015-134479037 TCTCACATGGGGAAGAAGCAAGG - Intronic
941159308 2:162017844-162017866 CCATACCTGGGGATGAATCCTGG + Intronic
946166625 2:217868356-217868378 TCACACCTGGGGATGGAGCCTGG + Intronic
946999390 2:225436453-225436475 ACACACATGGGGAAAATGCCAGG - Intronic
948630656 2:239300620-239300642 CCACCCATGTGGATGAAGCCAGG + Intronic
1168951272 20:1803595-1803617 CCCCAGGTGGGGAAGAAGCGGGG - Intergenic
1169746783 20:8951314-8951336 CCACACCAGGAGAAGCAGCCGGG + Intronic
1170429109 20:16260557-16260579 ACACTCATGGGGAAGAGGCAGGG + Intergenic
1170582107 20:17706996-17707018 CCACACAGAGGGAAGAGACCGGG + Intronic
1170793726 20:19528607-19528629 CCACTCATGGGCAAGCAGCAGGG - Intronic
1173657700 20:44711758-44711780 CCACGTATGGTGAAGAAGACAGG - Intergenic
1174464149 20:50704159-50704181 CCACAAATGGGAAAGAAGCTGGG + Intergenic
1176075903 20:63248120-63248142 CCACACCTGGGGCTGCAGCCGGG - Intronic
1176264980 20:64204438-64204460 CCACGCAGGGAAAAGAAGCCGGG - Intronic
1179095478 21:38310846-38310868 CAAAACATGGAGAGGAAGCCAGG - Intergenic
1179574537 21:42299605-42299627 ACACCCATGGGGCAGAAACCGGG + Intergenic
1179943498 21:44654720-44654742 CCACCCACGAGGAAGATGCCAGG - Intronic
1179978084 21:44882068-44882090 TGAGACATGGGGAAGAAGCACGG - Intergenic
1182008844 22:26983636-26983658 ACAGAGAAGGGGAAGAAGCCAGG - Intergenic
1183035059 22:35135005-35135027 CCAGACTTGGGGAAGGTGCCTGG + Intergenic
1184656921 22:45946576-45946598 CGACACATGAGGAATAGGCCTGG + Intronic
1184966022 22:47972898-47972920 CCCCACATGAGGACGCAGCCAGG - Intergenic
1185304731 22:50108318-50108340 CAACACATGCAGGAGAAGCCTGG - Intronic
949362468 3:3245849-3245871 CCACACAGAGGGAAGAAGCTGGG - Intergenic
949699253 3:6737102-6737124 CCATAAATGGGGAAGAAGTGAGG + Intergenic
950129214 3:10530443-10530465 CCTCACTTGGGGAGGAAGCGTGG - Intronic
951243498 3:20314071-20314093 AGACACATGGAGAAGAATCCAGG - Intergenic
954695199 3:52420773-52420795 CCACACATGGGGAAGAGGAGAGG - Intronic
955003434 3:54947991-54948013 CCACAGATGGGGGAGATTCCAGG + Intronic
955026582 3:55173387-55173409 CTACCCATGAAGAAGAAGCCAGG - Intergenic
956134073 3:66081845-66081867 CCCCACATGAGGATGCAGCCTGG + Intergenic
959947141 3:112137135-112137157 CCACACATGGAGCAGCATCCAGG - Intergenic
962963086 3:140329475-140329497 GCAGACATGGGGAGGAGGCCAGG - Intronic
964517974 3:157533380-157533402 TCACATATGGGGAATAGGCCCGG + Intronic
965939262 3:174157746-174157768 CCAAGCATGGGGAAGAAGCAAGG + Intronic
967086362 3:186098401-186098423 CCTCCCCTGGGGAGGAAGCCAGG - Intronic
967466455 3:189811756-189811778 CCAAGGATGGGGAAGAATCCAGG + Intronic
967759368 3:193206177-193206199 CCTCACATGGGGAAGCACCGAGG + Intergenic
968555666 4:1245383-1245405 CCCCACATGTGGTAGGAGCCAGG - Intronic
969423399 4:7109948-7109970 CAAGACATGGGGAAGCATCCTGG - Intergenic
969509326 4:7608691-7608713 CCACAGATGGCACAGAAGCCTGG - Intronic
970375285 4:15451028-15451050 CCAGAAGTAGGGAAGAAGCCAGG + Intergenic
972975964 4:44636561-44636583 CCAAATATGTGGAAGCAGCCAGG + Intronic
973580555 4:52340284-52340306 CCACACATGGTGAAGAGGAGAGG - Intergenic
974168730 4:58238775-58238797 CCAGACATAGAGAAAAAGCCTGG - Intergenic
976184805 4:82432628-82432650 CAAAACGTGGGGAAGAGGCCGGG - Intronic
980483888 4:133427186-133427208 CCCCAAATGCTGAAGAAGCCAGG - Intergenic
981469391 4:145113155-145113177 CCACTCATGGGCAAGAAGCAAGG + Intronic
985275778 4:188236183-188236205 TCACAAATTGGGAAGAAGCTAGG + Intergenic
986249602 5:6044372-6044394 CCACCCACAGGGAAGCAGCCAGG + Intergenic
990211318 5:53483256-53483278 CCACACTTGGCTAAGAAGTCTGG - Intronic
991417816 5:66409883-66409905 GCACACAGAGGGCAGAAGCCAGG + Intergenic
991528175 5:67586788-67586810 TCACATATGTGAAAGAAGCCAGG + Intergenic
992618635 5:78570811-78570833 GCACACTTGGGGAATAGGCCAGG + Intronic
992772773 5:80063980-80064002 CCACACAGGTGGTAAAAGCCAGG - Intronic
993501249 5:88669886-88669908 CCAGACATGGGGACCAGGCCCGG - Intergenic
995474480 5:112534119-112534141 TCACACATGGGGTGGCAGCCTGG - Intergenic
996582652 5:125048656-125048678 TCACACATGGGGTAGAAACTGGG + Intergenic
997633038 5:135384491-135384513 CCTGACCTGGGGAAGAAGCAGGG - Intronic
1002538832 5:179893064-179893086 CCCCACTTGGGAAGGAAGCCAGG - Intronic
1003594920 6:7465908-7465930 CCACTCCTAGGTAAGAAGCCTGG + Intergenic
1004016477 6:11736600-11736622 CCACACAGGGAGAGGAAGCAGGG - Intronic
1006749846 6:36370125-36370147 CCACAGAGTGGGCAGAAGCCTGG - Intronic
1007589072 6:43010720-43010742 CCTCACCTGGGGATTAAGCCGGG - Exonic
1009632440 6:66215690-66215712 ACACACAGAGGGTAGAAGCCAGG - Intergenic
1009922726 6:70082887-70082909 CCACTCATGGCGAAGAATCTAGG - Intronic
1009934366 6:70216842-70216864 CCACGCCTGGTGAAGGAGCCTGG - Exonic
1016030344 6:139330972-139330994 CCACACATGGGAAAAAACACAGG + Intergenic
1018761790 6:166899717-166899739 ACACACATGGGGGAGAACGCCGG + Intronic
1019025806 6:168962246-168962268 CCAGACCTGGGGAATAGGCCTGG - Intergenic
1019557823 7:1641366-1641388 CCACACATGGGGCAGGGGGCAGG - Intergenic
1019823309 7:3262557-3262579 CCACACATGGGGAAGCAGACAGG - Intergenic
1020370199 7:7423722-7423744 CCACACATGGGAAAGCAAGCGGG + Intronic
1021622197 7:22559965-22559987 GCCCACATGGGGCAGAACCCTGG + Intronic
1022196245 7:28069931-28069953 CCACAGACTGGGATGAAGCCAGG + Intronic
1022792459 7:33702594-33702616 CCACACGCTGGGCAGAAGCCAGG - Intergenic
1023505046 7:40890473-40890495 CCTCAGATGGGGCAGAAGCCTGG - Intergenic
1024709833 7:52003001-52003023 CCACGCATTGGGATGAAGCAAGG - Intergenic
1026479981 7:70769795-70769817 CCAAAGATGGAGAATAAGCCTGG + Intronic
1026674366 7:72416783-72416805 CCCCAAATCGGGATGAAGCCCGG - Intronic
1030616374 7:111742379-111742401 AAATACATGGGAAAGAAGCCTGG - Intronic
1033004396 7:137545894-137545916 ACTCACATGGTGAAGGAGCCGGG + Intronic
1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG + Intergenic
1036106615 8:5847258-5847280 CCCCACATGTGGAAGGAACCAGG - Intergenic
1038592274 8:28850581-28850603 AAACACATGGGAAAGAAGACAGG - Intronic
1041267043 8:56075322-56075344 CTACACCTGAGCAAGAAGCCGGG + Intergenic
1042863109 8:73333398-73333420 CCACACAAAGGGAAGAAGCATGG + Intergenic
1042938757 8:74086801-74086823 TCTCACATGGGGAAGGAGCAAGG - Intergenic
1049908113 9:237738-237760 CCACACATTGATAAGCAGCCGGG + Intronic
1052787137 9:32839219-32839241 AGACACATGGGGCAGAATCCAGG - Intergenic
1055561554 9:77526549-77526571 GCAGACACAGGGAAGAAGCCAGG + Intronic
1056266489 9:84901766-84901788 ACATACATGGAGAAGAAGCCAGG - Intronic
1056528918 9:87469821-87469843 CCACCCATGGTGAAGGAGCTAGG + Intergenic
1056832526 9:89928598-89928620 CCACACTTGGGGCAGAAGATGGG + Intergenic
1057848893 9:98549239-98549261 CAAAACATGGAAAAGAAGCCAGG - Intronic
1059349891 9:113657025-113657047 CCCAGCCTGGGGAAGAAGCCCGG - Intergenic
1060785734 9:126450502-126450524 CCTCACATGGGGATGGAGCAGGG - Intronic
1061147484 9:128808394-128808416 ACACACACGGAGAAGATGCCTGG - Exonic
1062033394 9:134372104-134372126 CCATAAATGGGGAAGTAGCAAGG - Intronic
1062342588 9:136100360-136100382 CCATACTTGGAGTAGAAGCCAGG + Intergenic
1186656164 X:11614205-11614227 CAACACTTGGGGGAGAAGGCTGG - Intronic
1187829406 X:23365628-23365650 CCACCCATGGGGAGGGAGCTGGG + Intronic
1188247408 X:27853111-27853133 GCACACACTGGGAAGAAGCAAGG - Intergenic
1189160788 X:38805868-38805890 CCACACTTGGGAAAGCAGCCCGG + Exonic
1189776512 X:44474703-44474725 AGATACATGGGGAAGAATCCTGG - Intergenic
1190146655 X:47898000-47898022 CCACACATGTGGAAGCACCAAGG + Intronic
1191256029 X:58280011-58280033 ACACACCTTGGGAGGAAGCCAGG + Intergenic
1194126334 X:90021651-90021673 CCCCACATGGGAAAGAAACAAGG + Intergenic
1194648087 X:96482796-96482818 CCACACTAAGGGAAGAAGCATGG - Intergenic
1195613874 X:106897458-106897480 CCACGTATGGGGAAGAGGACTGG + Intronic
1198363173 X:135915660-135915682 CCTCACATGTTGAAGAAGCATGG - Intergenic
1200780426 Y:7210679-7210701 CCACACCTGGCTAAGAAGACTGG - Intergenic