ID: 907265564

View in Genome Browser
Species Human (GRCh38)
Location 1:53258224-53258246
Sequence TCTGGGACACAGTATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907265564_907265574 21 Left 907265564 1:53258224-53258246 CCAGCAGCATACTGTGTCCCAGA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 907265574 1:53258268-53258290 GGGTAGGGTCTGACACTGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 128
907265564_907265569 0 Left 907265564 1:53258224-53258246 CCAGCAGCATACTGTGTCCCAGA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 907265569 1:53258247-53258269 AGCCAAGGGAAGATTTCAGCAGG 0: 1
1: 0
2: 3
3: 29
4: 295
907265564_907265573 6 Left 907265564 1:53258224-53258246 CCAGCAGCATACTGTGTCCCAGA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 907265573 1:53258253-53258275 GGGAAGATTTCAGCAGGGTAGGG 0: 1
1: 0
2: 0
3: 26
4: 264
907265564_907265570 1 Left 907265564 1:53258224-53258246 CCAGCAGCATACTGTGTCCCAGA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 907265570 1:53258248-53258270 GCCAAGGGAAGATTTCAGCAGGG 0: 1
1: 0
2: 2
3: 23
4: 261
907265564_907265575 22 Left 907265564 1:53258224-53258246 CCAGCAGCATACTGTGTCCCAGA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 907265575 1:53258269-53258291 GGTAGGGTCTGACACTGCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 125
907265564_907265572 5 Left 907265564 1:53258224-53258246 CCAGCAGCATACTGTGTCCCAGA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 907265572 1:53258252-53258274 AGGGAAGATTTCAGCAGGGTAGG 0: 1
1: 0
2: 1
3: 27
4: 315
907265564_907265576 23 Left 907265564 1:53258224-53258246 CCAGCAGCATACTGTGTCCCAGA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 907265576 1:53258270-53258292 GTAGGGTCTGACACTGCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907265564 Original CRISPR TCTGGGACACAGTATGCTGC TGG (reversed) Intronic
900282758 1:1881830-1881852 CCTGGCACACAGTATTGTGCGGG + Intronic
906336679 1:44938136-44938158 TCTGGGAAACAGTGGACTGCAGG + Intronic
906617862 1:47247096-47247118 TCTTATAAACAGTATGCTGCAGG + Intergenic
907265564 1:53258224-53258246 TCTGGGACACAGTATGCTGCTGG - Intronic
907305540 1:53511002-53511024 CCTGGACCACAGGATGCTGCAGG + Intronic
907783321 1:57587400-57587422 TCTGAGACACAGATTGCTGTGGG + Intronic
912665040 1:111571223-111571245 TCTGGGGCACAGTATGGGGCAGG + Intronic
918308426 1:183267909-183267931 TGAGGGCCACTGTATGCTGCAGG - Intronic
918587858 1:186208401-186208423 TCTGTGGAACAGTATCCTGCAGG - Intergenic
923420580 1:233810828-233810850 TGTGTGACACAGCATGCTGAAGG - Intergenic
923468515 1:234269474-234269496 TCTGGGACACACTGGGCTGCAGG - Intronic
924315551 1:242791739-242791761 TCTGGGACTCAGTCTGATGAAGG + Intergenic
924359188 1:243218265-243218287 TCTGGAACACAGACTGCTGATGG + Intronic
1064806030 10:19134207-19134229 CCTGGGGCACAGCATGGTGCTGG - Intronic
1067350819 10:45474127-45474149 TCTGGCACACAGTTAGGTGCTGG + Intronic
1068615034 10:59104833-59104855 TCTGGGACAAAGGATGATCCTGG + Intergenic
1074350070 10:112728032-112728054 TCTGTGACACAGCAGGCTGCTGG + Intronic
1075136236 10:119788613-119788635 GCTGGGACACTGTACCCTGCTGG + Intronic
1075933846 10:126322939-126322961 TCTGCCACACAGGAGGCTGCTGG - Intronic
1076406277 10:130214317-130214339 TCTGGGACCCAGTGTGTTCCAGG + Intergenic
1078068497 11:8093530-8093552 TCTGGGACACAAGAAGCTACAGG - Intronic
1080769577 11:35328097-35328119 TCTTGGACAATATATGCTGCTGG + Intronic
1081142079 11:39513906-39513928 GCTGGGAAACTTTATGCTGCAGG - Intergenic
1084334334 11:68447844-68447866 TCTGGGCCACAGTTGGGTGCAGG + Intronic
1089052610 11:115558705-115558727 TCTGGGACAAAGTCTGCTCTAGG + Intergenic
1089150810 11:116362757-116362779 TCTGGAACACAGTCTGCTCTCGG + Intergenic
1090717468 11:129442853-129442875 TCTGGGACTCACTCAGCTGCAGG + Exonic
1092051704 12:5475406-5475428 TCTGGGAGACAGCATGTGGCTGG + Intronic
1094426098 12:30318845-30318867 TTTTGGAAACAGTCTGCTGCTGG - Intergenic
1101176155 12:102153890-102153912 TCTGGCAAACAGTATGCAGTAGG + Exonic
1102540068 12:113612265-113612287 TCTGGCCGACAGTTTGCTGCAGG - Intergenic
1103012016 12:117465135-117465157 TCAGGCACTCAGTAGGCTGCTGG + Exonic
1104473777 12:129053558-129053580 TCAGGAACACAGAATCCTGCAGG + Intergenic
1104506440 12:129336773-129336795 TGTGGGAAACAGCATGCAGCCGG + Intronic
1105280384 13:18959641-18959663 TCTGGGACAGTGTTTCCTGCTGG - Intergenic
1105286753 13:19010857-19010879 TTTGGGACACAGGGTGCTTCAGG - Intergenic
1106356601 13:28989569-28989591 TCTGGGTCACAGTTTGGTGAGGG + Intronic
1107951093 13:45462911-45462933 TGGGGAACACAGCATGCTGCTGG + Intergenic
1108534412 13:51358905-51358927 TCTGGGACAGAGAATGGTGTGGG + Intronic
1110253805 13:73409753-73409775 TCTGGGCCACAGGTTGGTGCTGG + Intergenic
1112619181 13:101037062-101037084 TCTGTGACACCGGATGCTCCTGG - Intergenic
1116064437 14:39964638-39964660 TGTGGTACACTGTATGCTGCTGG + Intergenic
1121489724 14:94349167-94349189 CCTGGGACTCAGTATTTTGCAGG - Intergenic
1121940898 14:98069807-98069829 TCTGGCAGCCACTATGCTGCAGG - Intergenic
1122861318 14:104583642-104583664 TCTGGGGCACAGAGTTCTGCCGG - Intronic
1124916936 15:33985027-33985049 TGTGGGATACAGAATGCTGTGGG - Intronic
1125333928 15:38608985-38609007 TCAGGGACAGAGTTTGCTGGAGG + Intergenic
1126445156 15:48734608-48734630 TCTGGAAGACAGTATAGTGCTGG - Intronic
1126983410 15:54273484-54273506 TCTAGCACTCAGTTTGCTGCTGG + Intronic
1132957155 16:2600419-2600441 TCTGGGACACAGTTGGGGGCTGG + Exonic
1132969498 16:2678831-2678853 TCTGGGACACAGTTGGGGGCTGG + Intergenic
1134436291 16:14261250-14261272 TCCGAGACCCAGTTTGCTGCAGG + Exonic
1137734105 16:50711513-50711535 TCTGGGACCCAGTCTTCTTCGGG + Exonic
1139667868 16:68470952-68470974 TCTGCCACACAGTCTGCTGTGGG - Intergenic
1142099934 16:88265691-88265713 CCTGGGTCACAGGGTGCTGCAGG + Intergenic
1142218841 16:88842932-88842954 GCTGGGACACAGGGTGGTGCTGG - Intronic
1142433169 16:90041313-90041335 GCAGGGACACTGTTTGCTGCTGG + Intronic
1146032136 17:29375304-29375326 TACTAGACACAGTATGCTGCTGG - Intergenic
1147616753 17:41833733-41833755 TTTGGGACACAGCATGTTGGTGG + Intronic
1148458925 17:47826706-47826728 TGTGGGGCACAACATGCTGCTGG - Exonic
1153472283 18:5460296-5460318 TCTGGGAAACAGCACACTGCAGG + Intronic
1155512560 18:26592906-26592928 TCTGTGACATAGTATTTTGCAGG + Intronic
1155678299 18:28457722-28457744 TCTGAGACAGAGTATTGTGCAGG + Intergenic
1155993602 18:32306231-32306253 TCTGGGACACCATATGCTCCTGG + Intronic
1157814597 18:50721668-50721690 TCTGAGACACAGAATGCTAGGGG + Intronic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1164404925 19:27936314-27936336 TCTGGGACACTGTGAGCTGTGGG + Intergenic
1167998055 19:53422744-53422766 TCAGAGACACAGGATCCTGCAGG - Intronic
1168007529 19:53503338-53503360 TCAGAGACACAGGATCCTGCAGG - Intergenic
925148335 2:1598201-1598223 GCTGGGACACAGCAAGCTGGTGG + Intergenic
929049740 2:37826003-37826025 TCTGGGACACAGGACACTTCTGG - Intergenic
929829370 2:45334762-45334784 TCTGGGGCACAGAATGGGGCTGG - Intergenic
930461329 2:51681321-51681343 TCTAGCAAACAGCATGCTGCAGG - Intergenic
930543698 2:52740565-52740587 GCTGGGACAGACTATTCTGCTGG + Intergenic
931165471 2:59742664-59742686 TCTGGCACAAAGTATGCTCTAGG + Intergenic
932047048 2:68360177-68360199 TCTGGTACGCAGGATGCTTCAGG + Intergenic
932498062 2:72157142-72157164 TTTGGGACAGAGTAGGCTCCAGG + Intergenic
936685503 2:114822137-114822159 TCAGGGGCAAAGTCTGCTGCAGG - Intronic
936909418 2:117575034-117575056 TCTAGGCCAAAGTGTGCTGCAGG - Intergenic
937477924 2:122231402-122231424 TCTGGCCCACAGCCTGCTGCTGG + Intergenic
937504707 2:122524030-122524052 TCTGTGGCACAGTATGCTCCTGG + Intergenic
938540058 2:132278416-132278438 TCTGGGACACAGGAAGCCGCCGG + Intergenic
945099444 2:206250764-206250786 TTTGGGAGACCGTATGCTCCGGG + Intergenic
945711439 2:213301626-213301648 TCTGAGCTACAGCATGCTGCTGG + Intronic
946752320 2:222904912-222904934 CCTGGGACACAGGATCCTGCTGG - Intronic
947430653 2:230024724-230024746 TCTAGCACAAAGTGTGCTGCTGG + Intergenic
948797271 2:240411491-240411513 TCTGGGGGACAGGAAGCTGCAGG + Intergenic
1169774424 20:9236999-9237021 TCTGTGACACAGTATCATGAAGG - Intronic
1171195937 20:23199421-23199443 TCTGGGTCACAGAAGGATGCTGG + Intergenic
1171376143 20:24695296-24695318 TCTGGGCCACTGCCTGCTGCAGG + Intergenic
1171868989 20:30511437-30511459 TCTGGGACACAGGGAGCCGCCGG + Intergenic
1184799667 22:46751912-46751934 TTTGGGACACAGCCTGCTGCAGG + Intergenic
949692076 3:6651993-6652015 TCTGGAACCCTGAATGCTGCTGG + Intergenic
950726258 3:14918935-14918957 TCTGGGTCAAAGTATCCTTCTGG + Intronic
954111117 3:48433706-48433728 TCTCGAGCACAGGATGCTGCAGG - Exonic
954286822 3:49625244-49625266 TATGGGACACAGCGTGCTGCTGG - Exonic
956387770 3:68738893-68738915 TCTGACACACAGAATGATGCCGG + Intronic
960814831 3:121661757-121661779 TCAGGGACCCAGTCTGCTGGAGG - Intergenic
962496454 3:135945148-135945170 GCTGAGACACATTATGCTGTAGG - Intergenic
962909943 3:139838796-139838818 TCAGTTACACAGCATGCTGCTGG - Intergenic
966396119 3:179505019-179505041 TCTGGGACACACTATTCTTTTGG - Intergenic
970614916 4:17760028-17760050 TAGGGGACACAGCATGATGCAGG - Intronic
980564925 4:134527217-134527239 TCTAGGATACTGTATGCTTCTGG + Intergenic
982282484 4:153699152-153699174 TGTGGGACACTGTGTGCTACAGG - Intergenic
983222074 4:165053144-165053166 TCAGGGACACAGTGTGGGGCAGG + Intergenic
983401185 4:167268279-167268301 TCTGGGTCACAGGATGATGTAGG + Intergenic
983634988 4:169888503-169888525 TGTGGGCCACAGGATTCTGCAGG - Intergenic
984737964 4:183128813-183128835 TCTGGGACACATTATTTTGGAGG - Intronic
986195515 5:5533861-5533883 TCTGGGCCTCAGTTTCCTGCAGG - Intergenic
986286905 5:6365808-6365830 TGTGAGTCACAGGATGCTGCTGG + Intergenic
986306350 5:6519781-6519803 TCTGGGATACAGGATGCTCTGGG - Intergenic
987140162 5:14937702-14937724 ACTGGGACACGGGGTGCTGCTGG + Intergenic
990375518 5:55166682-55166704 TCTGGGACACAGAGTGCTACAGG + Intronic
992176351 5:74152781-74152803 TCTGGGACTCAGGATGGTGGAGG + Intergenic
994634029 5:102321332-102321354 TTTGGGACACAGAATGCTGTAGG + Intergenic
996121723 5:119680731-119680753 TGTGGGGCACAACATGCTGCTGG + Intergenic
997037144 5:130206387-130206409 TCTAGGAGACAGAATTCTGCTGG - Intergenic
997815927 5:137017020-137017042 TGGGGGCCACAGCATGCTGCAGG - Intronic
998358021 5:141557808-141557830 TCAGGGACACACCTTGCTGCAGG - Intronic
999410236 5:151344056-151344078 TCTGGGACACAGCTTGGTGCGGG - Intronic
1003458798 6:6309885-6309907 TCAGGGACACATTATCATGCAGG - Intronic
1005042980 6:21616091-21616113 TCTCGGACACAGGGTGCTCCTGG - Intergenic
1005180186 6:23095798-23095820 TCTAGGCCAAAGTGTGCTGCAGG + Intergenic
1010929586 6:81784904-81784926 TCTGGGACTCAGACTGGTGCAGG + Intergenic
1011165758 6:84444098-84444120 TCTGGGACACGGTATGACACAGG + Intergenic
1022564669 7:31385810-31385832 TCTGGGGGACAGTATGCTTCAGG + Intergenic
1024493805 7:50018853-50018875 CCTGGCACACAGTAGGCTCCTGG - Intronic
1025172137 7:56768845-56768867 TCTGCAACACAGTATGTGGCAGG + Intergenic
1026520481 7:71113537-71113559 TGTGGGACACAGAGTCCTGCTGG + Intergenic
1028161954 7:87496226-87496248 TCTGGCACACAATATCCTTCAGG + Intergenic
1031326728 7:120409115-120409137 TTTGGAAAACAGAATGCTGCTGG + Intronic
1034461568 7:151200508-151200530 TCTGAGAGACAGGCTGCTGCAGG - Intronic
1035484613 7:159212968-159212990 CCTGGGTCACCTTATGCTGCTGG - Intergenic
1036761971 8:11515450-11515472 TCTGGGACGAAGTAAGCAGCCGG + Intronic
1036999988 8:13706434-13706456 TCTGGGGCACAGACTGCTTCAGG - Intergenic
1037551394 8:19975114-19975136 TCTGGGCAACAGAATGCTGGGGG - Intergenic
1039172949 8:34769395-34769417 TCAGGGACACAGTGTTCTGTTGG + Intergenic
1041103282 8:54417909-54417931 GCTGGGACACAGGTTGCAGCTGG - Intergenic
1042715956 8:71772982-71773004 TCTGCCACACAACATGCTGCAGG + Intergenic
1043583637 8:81741081-81741103 TGTGTGACACAGTTTGCTGATGG + Intronic
1044103755 8:88175222-88175244 TCTGGGTCACATTATACTGTTGG + Intronic
1048412114 8:134185942-134185964 TCACGGACACAGTCTGGTGCTGG + Intergenic
1049071810 8:140361301-140361323 CCTGGGAAACAGCATGCTGGTGG + Intronic
1052036851 9:23692592-23692614 TCTGGGAGACAGAGTACTGCAGG - Exonic
1055135576 9:72825109-72825131 TCTAGGACACAGTAAAGTGCTGG + Intronic
1056790795 9:89624165-89624187 TCCTGAACACAGTGTGCTGCTGG + Intergenic
1060130101 9:121087883-121087905 TCTGGGACACCGCATTCTCCTGG - Intronic
1060406337 9:123374858-123374880 TCTGTGATACAGACTGCTGCTGG + Intronic
1061830007 9:133285721-133285743 TCTGGGACACAGCAAGGAGCAGG + Intergenic
1185876716 X:3707984-3708006 TCTGTCACACAGCATGCTGCCGG - Intronic
1194533417 X:95077790-95077812 TCTGTGAAATAATATGCTGCGGG + Intergenic
1197061309 X:122184713-122184735 TCTAGGAAAGAGTTTGCTGCAGG - Intergenic
1201219179 Y:11750098-11750120 TCTGGGACTCAGTCTGATGAAGG + Intergenic
1201289026 Y:12404586-12404608 TCTGTGACACTTTATGCAGCAGG + Intergenic
1201644567 Y:16215635-16215657 TCTTGGGCACAGAATTCTGCTGG + Intergenic
1201658248 Y:16369686-16369708 TCTTGGGCACAGAATTCTGCTGG - Intergenic