ID: 907267403

View in Genome Browser
Species Human (GRCh38)
Location 1:53271357-53271379
Sequence ACATGGGCTCCTGAAGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907267392_907267403 15 Left 907267392 1:53271319-53271341 CCATTGTTGTGCAGACACTCGTT 0: 1
1: 0
2: 6
3: 60
4: 806
Right 907267403 1:53271357-53271379 ACATGGGCTCCTGAAGGTCCAGG 0: 1
1: 0
2: 1
3: 17
4: 207
907267391_907267403 18 Left 907267391 1:53271316-53271338 CCGCCATTGTTGTGCAGACACTC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 907267403 1:53271357-53271379 ACATGGGCTCCTGAAGGTCCAGG 0: 1
1: 0
2: 1
3: 17
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907267403 Original CRISPR ACATGGGCTCCTGAAGGTCC AGG Intronic
900203722 1:1422188-1422210 ACAGGGTCTCCTGAGGGCCCTGG + Intergenic
901398465 1:8999743-8999765 ACATGGACTCCTGGAATTCCTGG + Intergenic
901764478 1:11491138-11491160 ACATGTGTCCCTGGAGGTCCGGG - Intronic
902107163 1:14047389-14047411 CCATGGGCTCCTGGGTGTCCAGG - Intergenic
902402343 1:16165177-16165199 ACATGGGATCCTGAAAAACCTGG + Intergenic
902531680 1:17094591-17094613 CCATGGGCTCCTTAAGGCCAGGG + Intronic
902650400 1:17833567-17833589 CCATGGCCTCCTGATGGGCCAGG - Intergenic
903683872 1:25116787-25116809 ACGTGGGCTCCTGGAGGGCCTGG - Intergenic
903684134 1:25118897-25118919 ACGTGGGCTCCTGAGGGCCTGGG - Intergenic
904352526 1:29918067-29918089 ACCTGGGTGCCTGAAGCTCCAGG + Intergenic
904438204 1:30512991-30513013 ACATAGGGTCCTGATGGTCATGG - Intergenic
905628979 1:39508326-39508348 ACGTGGTCTTCTGATGGTCCTGG + Intronic
906945213 1:50289218-50289240 ACATGAGCTCTTGAGGGTCCAGG - Intergenic
907213923 1:52846179-52846201 AGATGGGATTCTGGAGGTCCTGG - Intronic
907267403 1:53271357-53271379 ACATGGGCTCCTGAAGGTCCAGG + Intronic
907364781 1:53949159-53949181 ACCTGGGCTCCTCAAAATCCTGG - Intronic
907510321 1:54953098-54953120 ACATGGTTTCCTGCAGGTCTAGG + Intergenic
912509600 1:110179880-110179902 ACATGGTTTCCTGAACATCCAGG - Intronic
913355842 1:117921322-117921344 ACATATGCTCCTGAAGGGCAGGG - Intronic
915732861 1:158066618-158066640 CCATGTGCTCCTGTAGGTCAGGG + Intronic
917188639 1:172389916-172389938 ACCTGGGTTACTGAAGGTCTTGG + Intronic
917746191 1:178010222-178010244 ACATGGCCTCCTGAAATGCCGGG - Intergenic
921808889 1:219489111-219489133 ACCTGGGCCCCTGAAAGTACTGG - Intergenic
922717569 1:227885274-227885296 ACCTGGGCCCCTGAACTTCCAGG - Intergenic
923587820 1:235290844-235290866 ACTTGGCCTCCTGAAGCTCTGGG - Intronic
924515234 1:244760342-244760364 ACATGGGCACCTGAGGGTCTGGG - Intergenic
1062808181 10:440829-440851 ACACGGCCTCCTGAATGTGCCGG - Intronic
1063116522 10:3075650-3075672 CCTTGGGCTCCTGAAGGGCTGGG - Intronic
1063965152 10:11340715-11340737 GCATGGGGTCCTGGAGCTCCAGG - Intergenic
1064561092 10:16596069-16596091 CCATGGGCACCTGGGGGTCCTGG + Intronic
1068887107 10:62109097-62109119 TCCTGGGGTCCTGCAGGTCCTGG - Intergenic
1069743792 10:70702167-70702189 CCCAGGGCTCCTCAAGGTCCTGG + Intronic
1069812191 10:71170256-71170278 ATGTGGGCTCCTGAGGGGCCAGG - Intergenic
1074221605 10:111443678-111443700 AAATAGGCTCTTGAAGGGCCCGG + Intergenic
1075681036 10:124331553-124331575 ATATGGACTTCTGAGGGTCCTGG - Intergenic
1076024637 10:127101309-127101331 ACCTGTTCTCCTGAAGGGCCGGG - Intronic
1076585861 10:131547264-131547286 CCATGGATTCCTGAAGGTCTTGG + Intergenic
1077695359 11:4388347-4388369 AGATGAGCTCCTGTAGGGCCTGG + Exonic
1078627250 11:12968815-12968837 ACATGGGCTCCAGCAAGTCCTGG + Intergenic
1079651824 11:22939325-22939347 ATATGGGCTATTGAAGGCCCTGG + Intergenic
1080211904 11:29795814-29795836 ACATTGGCTCCTGAGGCTTCTGG - Intergenic
1081560020 11:44205022-44205044 ACATGGGATTCTGAAGCTGCAGG + Intronic
1081803798 11:45878252-45878274 CCTTGGGCTCCTTAAGGCCCAGG + Intronic
1083971976 11:66083590-66083612 ACTTAGGCTCCAGAAGGGCCTGG + Intronic
1085039161 11:73316969-73316991 CCAGGGGCTCCTCAAGGGCCTGG + Intronic
1085457601 11:76674094-76674116 ACATGGGCCCCTGAGAGTCTGGG + Intergenic
1085653973 11:78295530-78295552 TCATGAGATCCTGAAGGACCTGG - Intronic
1088263102 11:107963363-107963385 ACATGTGCTGCTGATAGTCCAGG - Exonic
1090708460 11:129362468-129362490 AGATGTGCTTCTGAAAGTCCGGG - Intergenic
1092197165 12:6556289-6556311 CCATGGGGTACTGGAGGTCCTGG - Intergenic
1093243117 12:16702001-16702023 CCATGGGTTCCTGGAGGTCTTGG + Intergenic
1093277493 12:17148234-17148256 ACTGGGGAGCCTGAAGGTCCAGG + Intergenic
1094569183 12:31626960-31626982 GCATGGGCTCCTGAAGTGGCAGG + Intergenic
1096185628 12:49578744-49578766 GCATGGCCCTCTGAAGGTCCGGG + Intronic
1096550212 12:52367211-52367233 ACCTGGGCTCCTGCGGGCCCCGG - Exonic
1097145890 12:56939175-56939197 ATATGGGCTCGTGGAGGCCCTGG - Intergenic
1097151451 12:56982713-56982735 ATATGGGCTCGTGGAGGCCCTGG - Intergenic
1097571261 12:61335114-61335136 ACATGGAAACCTGAATGTCCAGG - Intergenic
1097750540 12:63347705-63347727 AGATGGGCTGCTGAAGCTGCTGG - Intergenic
1100452427 12:94720321-94720343 ACCTTGGCTGCTCAAGGTCCTGG - Intergenic
1101737784 12:107475941-107475963 ACATGGGCTCCAGAAGCCTCAGG - Intronic
1102253604 12:111404142-111404164 ACATGGTGTCTTGAAGGTCTTGG - Intergenic
1103211931 12:119173425-119173447 CCCTGGGCTGCTGAAGGTACAGG + Intergenic
1104779934 12:131413567-131413589 CCCTGGGCTCCTGCAGCTCCGGG + Intergenic
1105210406 13:18253844-18253866 ACAGGGGCTCCAGATGGCCCAGG + Intergenic
1113059280 13:106303911-106303933 AAATGGGCTCTTTAAGGTACTGG + Intergenic
1114662632 14:24357584-24357606 AGATGAGATCCTGAAGGACCAGG + Intergenic
1118325139 14:64775289-64775311 CCAGGCGCTCCTCAAGGTCCTGG + Exonic
1119387021 14:74263865-74263887 ACATGTGCCCCTCAGGGTCCTGG - Intergenic
1121310109 14:92931347-92931369 GCATGGGCTCCGGGAGGGCCTGG - Exonic
1121430037 14:93880012-93880034 AAATGAGCCCCTGAGGGTCCTGG - Intergenic
1123143496 14:106105907-106105929 ACCTGGGATCCTGAAAGTCCAGG - Intergenic
1124372498 15:29111595-29111617 ACCTGGGGGCCTGAAGGGCCCGG - Intronic
1124552661 15:30696119-30696141 AGATGGGGTCCTGAAGAACCGGG - Intronic
1124678582 15:31709551-31709573 AGATGGGGTCCTGAAGAACCGGG + Intronic
1125603749 15:40928825-40928847 ACAAGGGCTCCAGAAGCTCCAGG + Intergenic
1125930482 15:43596139-43596161 ACATGGGCTCTGAAAGGCCCAGG + Intronic
1125943650 15:43695971-43695993 ACATGGGCTCTGAAAGGCCCAGG + Intronic
1129199615 15:73991250-73991272 ACTTGGGCTCCTGAATCTCCAGG - Intronic
1132852649 16:2031663-2031685 ACAGGGGCTCCAGGAGGTCAGGG + Intronic
1132978589 16:2722701-2722723 ACTTGGGCTCCTGAAGAACAAGG + Intergenic
1135423809 16:22322516-22322538 TCCTGGGCTCCTTGAGGTCCCGG + Intronic
1137038003 16:35583289-35583311 AGATGGCCTCCTGAATTTCCAGG - Intergenic
1137044578 16:35643380-35643402 CCTTGGGCTCCAGGAGGTCCTGG + Intergenic
1137470239 16:48747966-48747988 ATATGAGCTCCTGAAGGGCAGGG + Intergenic
1142427666 16:90009293-90009315 ACCGGGGCTCCTGCAGGTCACGG - Exonic
1146545905 17:33738343-33738365 AAAGGGGATCCTGAAGGTCTGGG - Intronic
1147374677 17:40016526-40016548 CCAGGGGCTCCTGCAGGCCCTGG + Exonic
1148037703 17:44680476-44680498 ACATGAGTTCCTGAAGGTAAAGG + Intronic
1149438867 17:56657857-56657879 ACATGGCCTCCTTAGAGTCCAGG - Intergenic
1149568493 17:57655572-57655594 ACATGAGCTCCTGATGGTGGTGG + Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150561503 17:66299398-66299420 ACATGGGTTAATGAAGGCCCTGG - Intergenic
1151345487 17:73498881-73498903 GCTTGGGGTCCTGAAGATCCTGG + Intronic
1153796158 18:8624057-8624079 ACATGGGCACCTGCTGGCCCGGG + Intronic
1156476762 18:37410387-37410409 TCCTGGGCACATGAAGGTCCAGG + Intronic
1160624122 18:80191253-80191275 ACATTTTCTCCTGCAGGTCCTGG - Intronic
1162019962 19:7863867-7863889 ACCTGGGCTCCTCAGGGCCCCGG + Intronic
1162688424 19:12407904-12407926 CCTTGGCCTCCTAAAGGTCCTGG - Intronic
1163321594 19:16577876-16577898 ACCTGGGACCCTGAAGGTCTGGG - Intronic
1163437613 19:17304698-17304720 TCAAGGGCTCCTCAAGGGCCAGG - Intronic
1163715459 19:18870082-18870104 ACCTGGTCTCCTGGGGGTCCCGG + Exonic
1164576688 19:29409285-29409307 AGCTGGGCTCCTGCAGGGCCTGG + Intergenic
1164752236 19:30665575-30665597 AAAGTGGCTCCTGAAGATCCTGG + Intronic
1167051851 19:47084269-47084291 ACATGGCTTCCAGAAGGTTCTGG - Intronic
1167608402 19:50493843-50493865 TCATGTGGTCCTGAAGGGCCTGG - Intergenic
1167775667 19:51553096-51553118 ACAGGGATTCCTGAAGGCCCCGG + Intergenic
1168057976 19:53874045-53874067 ACCCGGGCTGCTGAAGGTGCTGG + Exonic
1168273707 19:55265019-55265041 ACAGCGGCTCCAGAAGGACCAGG - Intronic
1168273741 19:55265129-55265151 ACAGGGGCTCCAGGAGGACCAGG - Intronic
925191610 2:1889372-1889394 ACATGGGCTCCAGAGGGGTCAGG + Exonic
925296256 2:2779581-2779603 GCAGGGGGTCCTGAAGCTCCTGG - Intergenic
925303871 2:2835691-2835713 ACATGGGCCTCTGTGGGTCCTGG + Intergenic
926353866 2:12022072-12022094 ATGTGGTCTCCTGAAGGACCTGG + Intergenic
928775366 2:34754798-34754820 TCATGGACTACTGAAGGTGCTGG - Intergenic
930186999 2:48420455-48420477 ACAGAGGCTTCTGAAGGTCGAGG + Intergenic
931318965 2:61157921-61157943 ACTTGGGCTCCAGATGGTCCAGG - Intronic
932277055 2:70459536-70459558 AGATGGGCTACTGATTGTCCTGG + Intronic
932411642 2:71551199-71551221 GCCTGGGCTCCTGAGGGACCTGG - Intronic
935212975 2:100954198-100954220 ACATGAGAGCCTGAAGGACCTGG + Intronic
935356093 2:102201112-102201134 ACATGGGCCCCTGAAGGTGGAGG + Intronic
935396280 2:102612674-102612696 ACATAGGGTCCTGGAGGCCCTGG - Intergenic
936077840 2:109413018-109413040 ACCTGCACTCCTGAAGTTCCAGG - Intronic
940021499 2:149160901-149160923 GAATGGACTCCTGAAAGTCCCGG + Intronic
942103416 2:172608840-172608862 AGATGGGCTTTTGTAGGTCCTGG + Intergenic
945369934 2:209004200-209004222 TCATGGGCTCATTAAGTTCCAGG - Intergenic
945829642 2:214767618-214767640 TCATGGGCACCTGAAGGTAGTGG - Exonic
945908670 2:215622011-215622033 ACATGGGCTCCTGGAGGGCATGG + Intergenic
947709449 2:232303379-232303401 ACATGGGCCCCTTAAGGGTCTGG - Intronic
948231250 2:236351202-236351224 AGGTGGGCTCCTGGAGGTCAGGG - Intronic
948310389 2:236981448-236981470 ACAGGGGAGCCTGAATGTCCTGG + Intergenic
1170092011 20:12599643-12599665 GCATGTGCTTCTGAAGGTACTGG + Intergenic
1171291544 20:23985534-23985556 ACAGGGGCTCCAGATGGCCCAGG + Intronic
1171953280 20:31440409-31440431 ACACCGGCTCCGGAAGGTCAGGG - Intergenic
1172370475 20:34386054-34386076 GCATGGGCTACTGAAGGTATTGG - Intronic
1173118256 20:40266841-40266863 ACCTGGGCTTCTCACGGTCCAGG - Intergenic
1174429978 20:50460694-50460716 ACTTGGACTCCTGTAGATCCGGG - Intergenic
1174742799 20:53032341-53032363 ACATATGCTCCTGAAGGTTATGG - Intronic
1175811711 20:61861938-61861960 ACATCCGCTCCTCAAGGTGCAGG + Intronic
1175998617 20:62822144-62822166 ACAGGGGGTCCGGGAGGTCCTGG - Exonic
1176019032 20:62953252-62953274 ACCTGGCCTCCTGACTGTCCTGG - Intronic
1177559314 21:22729864-22729886 AAGTGGGCACCTGAAGGTCAAGG + Intergenic
1178971675 21:37183802-37183824 ACTAGGCCTCCTGAAGGTTCAGG + Intronic
1180765852 22:18345559-18345581 ACAGGGGCTCCAGATGGCCCAGG - Intergenic
1180780459 22:18516819-18516841 ACAGGGGCTCCAGATGGCCCAGG + Intronic
1180813177 22:18774140-18774162 ACAGGGGCTCCAGATGGCCCAGG + Intergenic
1180933866 22:19611406-19611428 CCATGGGCTCCTGAAGTTCGAGG - Intergenic
1181199352 22:21208456-21208478 ACAGGGGCTCCAGATGGCCCAGG + Intronic
1181283470 22:21735974-21735996 ACGTGGGCTCCTGCCCGTCCCGG - Intergenic
1181400405 22:22647401-22647423 ACAGGGGCTCCAGATGGCCCAGG - Intronic
1181648959 22:24248390-24248412 ACAGGGGCTCCAGATGGCCCAGG + Intergenic
1181702385 22:24628499-24628521 ACAGGGGCTCCAGATGGCCCAGG - Intronic
1183346290 22:37310139-37310161 TCATGGGCTCCTGGGGGTTCTGG - Intronic
1184226730 22:43133048-43133070 TCGGGGGCTCCTGAGGGTCCAGG + Exonic
1184270389 22:43378006-43378028 ACATGGGCTTTTCAAGGGCCAGG - Intergenic
1203227473 22_KI270731v1_random:86450-86472 ACAGGGGCTCCAGATGGCCCAGG - Intergenic
1203296372 22_KI270736v1_random:46504-46526 AAATGGGCTCTTGATGGACCTGG + Intergenic
952041452 3:29266648-29266670 ACATGGGCTACTAAAGATCCTGG + Intergenic
953017006 3:39087039-39087061 ACATCAGCTCCTGAAGGACAGGG - Intronic
953266650 3:41396157-41396179 ACATGGGCTCCTGTGAGTTCAGG - Intronic
962409527 3:135129061-135129083 ACAGGGGCTTGTGAAGGTCATGG - Intronic
962891462 3:139676634-139676656 ACATGGGCTCCAGGAGGGCAGGG + Intronic
964015355 3:151938982-151939004 AAAAGGGCTGCTGAAGTTCCAGG + Intergenic
964540426 3:157773555-157773577 CCATGTCCTCCTGAAGGCCCAGG - Intergenic
965576287 3:170221924-170221946 GCTTGGGCATCTGAAGGTCCTGG - Intergenic
967536005 3:190604291-190604313 TAATTGGCTCCTCAAGGTCCCGG - Exonic
968520484 4:1032743-1032765 CCAGGGGCTCCTGGAGGACCCGG - Intergenic
968743158 4:2341383-2341405 GCATGGGCGCCTGCAGGTGCCGG - Intronic
969094407 4:4721009-4721031 ACAGAGGCTCCTGCAGGGCCAGG - Intergenic
970402008 4:15726225-15726247 ACATGAGCTCCAGGAGGTCAGGG + Intronic
972296547 4:37744592-37744614 CCATGGCCTCCTGAAGTGCCAGG - Intergenic
976246409 4:83010523-83010545 GTAGGGGCTCCAGAAGGTCCTGG + Exonic
978450150 4:108823543-108823565 ACATGGGCTCCTAAAGACCATGG + Intronic
981029753 4:140112566-140112588 CCATGGGCAGCTGAAGGTCAGGG + Intronic
983930986 4:173453161-173453183 ACATGGGTTCCTTAAGTGCCAGG - Intergenic
984880588 4:184406769-184406791 ACATGGGCTCCTGAAGGCACAGG - Intronic
988232631 5:28500681-28500703 AGATGGCCTCCTGAATGACCAGG - Intergenic
993004765 5:82418167-82418189 AAGAGGGCTCCTGAAGGTCAGGG - Intergenic
996887911 5:128380799-128380821 ACATGGTCTCTTGGAGGTCCAGG - Intronic
997647433 5:135490587-135490609 ACATCGTCTTCTGAAGGGCCAGG - Intergenic
998296028 5:140969215-140969237 GCTTGGGCTCCCGAAGGCCCTGG - Exonic
1001942500 5:175750646-175750668 GCATGTGCGTCTGAAGGTCCCGG + Intergenic
1002779798 6:357428-357450 ACCTGTGCTCCTGGTGGTCCTGG - Intergenic
1004001136 6:11598418-11598440 CCATGGGTTCCTGAAGGCCAGGG - Intergenic
1010304889 6:74308403-74308425 CCATTGGCTTGTGAAGGTCCAGG - Intergenic
1011230452 6:85155459-85155481 ACAAGTGTTCCTGAAGGCCCTGG - Intergenic
1017237923 6:152136704-152136726 ACAAGCGATCCTGCAGGTCCCGG + Exonic
1019257068 7:59316-59338 ACATGGGCTCCTGCACTCCCAGG - Intergenic
1019376042 7:692719-692741 ACATTGCCTCCTGAAGGTTGGGG + Intronic
1019575121 7:1734001-1734023 TCAGGGGCTCCTGGAGGTCAGGG + Intronic
1020929640 7:14376685-14376707 ACATGTGCTACTGAAGGGGCTGG - Intronic
1024973229 7:55089762-55089784 ACATGGGCTCCGGCAGGTTAGGG - Intronic
1028588409 7:92473131-92473153 AGAAGGCATCCTGAAGGTCCAGG + Intronic
1032858169 7:135854229-135854251 TCCTGAGCTCCTGAAGGGCCAGG + Intergenic
1033509987 7:142050939-142050961 GCATGGGTCCCTGAAGGACCAGG + Intronic
1034380752 7:150690196-150690218 ACATTGGCTCCTGTGAGTCCAGG + Intronic
1034676972 7:152898890-152898912 AGATGGGATCCTAAAGGCCCAGG - Intergenic
1035930720 8:3777228-3777250 ACATGAGCTCCTTAAGGGCAGGG + Intronic
1036827072 8:11986025-11986047 ACTAGGGATCCTGAAAGTCCAGG + Intergenic
1036850245 8:12195337-12195359 ACCTGAGCCCCTGAAGGGCCTGG - Intergenic
1036871607 8:12437610-12437632 ACCTGAGCCCCTGAAGGGCCTGG - Intergenic
1048764750 8:137831799-137831821 ACCTGTGCTCCAGCAGGTCCTGG + Intergenic
1048846555 8:138607934-138607956 ACAGGGGTTCCTGAAGGGCCAGG + Exonic
1049016123 8:139921404-139921426 TCATGGGCTTCTGAAGCTCCTGG - Intronic
1049249605 8:141581134-141581156 CCATCAGCTCCTGAAGGGCCTGG - Intergenic
1049818197 8:144618272-144618294 ACATGGGGTCCTGAAAGGGCAGG + Intergenic
1049849410 8:144822803-144822825 CCATGTGCTGCTGAAGGGCCTGG + Intergenic
1055327292 9:75144120-75144142 ACATGAAGTCCTGAAGGTCCTGG + Intronic
1056068593 9:82962580-82962602 ACATGTGCTCCTTAAGTTCAAGG - Intergenic
1056731917 9:89173212-89173234 ACCTGGCCTGGTGAAGGTCCTGG - Intronic
1060060728 9:120457155-120457177 AAATGGGCTCATAAAGGTTCAGG + Intronic
1062027379 9:134346812-134346834 ACAAGGGCTCCTCAAGCCCCTGG - Intronic
1062052119 9:134453009-134453031 AGTAGGGCTCATGAAGGTCCAGG + Intergenic
1062631307 9:137464312-137464334 GCATGGGCTCCTGAGGGTGGGGG + Intronic
1186056136 X:5651653-5651675 ACTTGGGCTCCTAAAGTGCCGGG - Intergenic
1189744566 X:44156964-44156986 CCATGGGCTGCTGATGGGCCAGG + Intronic
1189909595 X:45796665-45796687 ACCTGGGCTCCTGGAGGGCCTGG - Intergenic
1190739714 X:53280920-53280942 ACATGGGCTTTTGAATGGCCAGG - Intronic
1192152530 X:68721058-68721080 AGATGGGCTCAGGCAGGTCCCGG - Exonic
1192312414 X:70027901-70027923 CCCTGGGGTCCTGGAGGTCCTGG - Exonic
1195792436 X:108602978-108603000 CCAGGTGCTCCTGGAGGTCCTGG - Exonic
1197706256 X:129636767-129636789 TCATGGCCTCATGAAGCTCCAGG + Intergenic
1198534917 X:137575683-137575705 ATTTGGGCTCCTGAAGGTGTGGG + Intronic
1199693577 X:150327849-150327871 ACGTGAGCACCTGAAGGTTCAGG - Intergenic
1201271027 Y:12253841-12253863 CCTTGGCCTCCTGAAGTTCCGGG + Intergenic
1201585122 Y:15551938-15551960 ACATGGGCTGCTGAATGATCTGG - Intergenic