ID: 907268043

View in Genome Browser
Species Human (GRCh38)
Location 1:53274728-53274750
Sequence TGATGTGCAGAGGGACTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268043_907268054 30 Left 907268043 1:53274728-53274750 CCCGGCAGTCCCTCTGCACATCA 0: 1
1: 0
2: 1
3: 18
4: 208
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224
907268043_907268052 28 Left 907268043 1:53274728-53274750 CCCGGCAGTCCCTCTGCACATCA 0: 1
1: 0
2: 1
3: 18
4: 208
Right 907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 155
907268043_907268053 29 Left 907268043 1:53274728-53274750 CCCGGCAGTCCCTCTGCACATCA 0: 1
1: 0
2: 1
3: 18
4: 208
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268043 Original CRISPR TGATGTGCAGAGGGACTGCC GGG (reversed) Intronic
900311014 1:2033138-2033160 TGGTGGGCAGAGAGGCTGCCAGG + Intergenic
901020503 1:6252847-6252869 TGAGGTCCAGAGGGGCTGCCTGG - Intronic
901202655 1:7475499-7475521 TGGTGCGCAGAGGGTCTGGCAGG - Intronic
904114354 1:28150652-28150674 TGATGGGCCGAGTTACTGCCTGG + Exonic
904279675 1:29409952-29409974 TTATGTGCAAAGGGGCTGACAGG + Intergenic
906310991 1:44754372-44754394 TGATGGCCAGAGGGGCTGCAGGG + Intronic
907268043 1:53274728-53274750 TGATGTGCAGAGGGACTGCCGGG - Intronic
909284031 1:73791568-73791590 TGAGGTGAGGAGGGACTGACAGG - Intergenic
911236433 1:95417319-95417341 TGATTTGCAGGGTGACTGCAGGG - Intergenic
912856875 1:113177513-113177535 TAATTTGCAGGGGAACTGCCTGG + Intergenic
916357034 1:163923108-163923130 TCATGGGCAGAGGAATTGCCTGG - Intergenic
916555257 1:165889398-165889420 TGATGTGCTGAGGGGCTACAGGG - Intronic
918210522 1:182347226-182347248 TTATGTGAAGAGGAACTGCTGGG - Intergenic
920123011 1:203672826-203672848 TGAGGTTCAGAGGGACACCCAGG - Intronic
921220716 1:212971892-212971914 TGCTGTGCCCAGGGAATGCCAGG + Intronic
921984675 1:221299322-221299344 TGATTTGGAGAGGGACAGGCAGG + Intergenic
1067263388 10:44714544-44714566 TCATGTGCAGAGGGGCTCCGTGG + Intergenic
1067358234 10:45551246-45551268 TTATGTGCACAGGGAGGGCCTGG - Intronic
1068120017 10:52775411-52775433 TGACCTGCAGGAGGACTGCCTGG + Intergenic
1069721154 10:70550088-70550110 TGAAGAGCAGAGGGACTGAGAGG + Intronic
1069737260 10:70665011-70665033 AAATGTGCAGAGGGAATGCTGGG + Intergenic
1073125643 10:101147140-101147162 AGATGTGCAGAGGGAGTTGCAGG - Intergenic
1073255096 10:102145909-102145931 AGATGTGAAGAGGGACAGTCAGG + Intronic
1073688494 10:105781964-105781986 TGATGTGCAAAGGAAGTGCCAGG - Intergenic
1075197237 10:120370618-120370640 GAATGTGCAGAAGTACTGCCTGG - Intergenic
1075745961 10:124727754-124727776 TGATGTGCAGAGAACATGCCTGG + Intronic
1075823529 10:125334306-125334328 TGGTGTGCAGAGGGCATGCAGGG + Intergenic
1076157063 10:128212258-128212280 TGCTGGGCAGAGGGACTAGCTGG - Intergenic
1076754497 10:132562210-132562232 TGATGTGCAGAGGTCATGCCTGG - Intronic
1076839627 10:133039620-133039642 TGCTGAGCAGAGGGGCTTCCTGG + Intergenic
1077200067 11:1302295-1302317 AGCTGGGCAGAGGGACCGCCAGG - Intronic
1077475596 11:2788893-2788915 TGCTGGGCACAGGGACTCCCTGG - Intronic
1079077604 11:17393658-17393680 TGGGGTGCAGAGGGACACCCAGG - Intronic
1081537925 11:44008768-44008790 TGATGTGCTCAGGCAGTGCCTGG - Intergenic
1081760602 11:45574190-45574212 TGATGTGCAAAGCCAGTGCCAGG + Intergenic
1081861350 11:46334805-46334827 GGAAGTGCAGAGGGACTCACAGG + Intronic
1083491611 11:63018278-63018300 TGACTTGGGGAGGGACTGCCTGG - Intergenic
1084028509 11:66467239-66467261 TGTTGTGCGGAGGGGCCGCCGGG + Intronic
1084275159 11:68047612-68047634 TGGTGTGGTGAGGGGCTGCCTGG - Intronic
1087006651 11:93478338-93478360 TGATGAGCAGAGGGAGTGCTGGG + Intergenic
1088821377 11:113460527-113460549 GAATGTTCAGAGGCACTGCCTGG + Intronic
1089760070 11:120716716-120716738 TCCTGTGCAGAGGGAATGTCAGG - Intronic
1091613442 12:2031184-2031206 TGAGGAGGAGAGGGTCTGCCTGG - Intronic
1092822575 12:12366307-12366329 TGATCTGCAGAGGCAGTGGCTGG + Intronic
1096606001 12:52767004-52767026 TGATGTCCAAGGGGAGTGCCAGG - Intergenic
1099103288 12:78470156-78470178 TGATGAGCACAGGGACTATCTGG + Intergenic
1099777386 12:87151190-87151212 TAGTGTGGAGAGGGACTGGCCGG + Intergenic
1104599706 12:130144433-130144455 TCAGGTGCTGAGCGACTGCCGGG + Intergenic
1104622553 12:130329193-130329215 GGATGTGCAGCAGGGCTGCCCGG - Intergenic
1104778848 12:131406839-131406861 TGATGAGCACAGGGACTCCTGGG - Intergenic
1107037442 13:35916368-35916390 AGAGGGTCAGAGGGACTGCCTGG - Intronic
1107610651 13:42109398-42109420 AGAGGTGCAGAGGTACGGCCTGG - Intronic
1107695898 13:42999569-42999591 TGAGTTAGAGAGGGACTGCCTGG + Intergenic
1109055557 13:57543730-57543752 TGATTTACAGGGTGACTGCCAGG - Intergenic
1109099186 13:58158516-58158538 TTATGTGGAGATGGAGTGCCTGG + Intergenic
1112371169 13:98794979-98795001 TGATGTGCAGCCGGAAAGCCTGG + Intronic
1112597626 13:100823047-100823069 TGATGGGCAGAGGCAGGGCCTGG - Intergenic
1116167130 14:41349214-41349236 TGATTTTCAGCGGTACTGCCTGG - Intergenic
1118736028 14:68702588-68702610 TGAAGTGCAGAAGGAAGGCCAGG + Intronic
1119472356 14:74907985-74908007 TGAGGAGCAGAGGGTCTGTCTGG + Intronic
1121393131 14:93593722-93593744 GGAGGAGAAGAGGGACTGCCAGG - Exonic
1121520920 14:94585708-94585730 CCAGGTGCAGAGGGCCTGCCTGG - Intronic
1121904619 14:97728315-97728337 TGATGGGCAGAGGGTCGTCCAGG + Intergenic
1122025798 14:98874875-98874897 GGAAGAGAAGAGGGACTGCCTGG - Intergenic
1123115454 14:105892299-105892321 TGGGGTGCAGGGGGGCTGCCAGG - Intergenic
1124503292 15:30249438-30249460 TGATGTGCATGGGGCCTGCAAGG - Intergenic
1124740263 15:32289201-32289223 TGATGTGCATGGGGCCTGCAAGG + Intergenic
1127544336 15:59976284-59976306 TAATGGGCAGAGTGACTGGCAGG + Intergenic
1128940996 15:71787547-71787569 TGATGTGCATATGAATTGCCTGG + Intergenic
1129129834 15:73483851-73483873 TGCTGGGCTGAGGGAATGCCAGG - Intronic
1129460357 15:75697295-75697317 TGATGTGCCCAGGGACAGCCAGG - Intronic
1130819561 15:87480043-87480065 TGACGTGCAGAGGAATTGGCAGG - Intergenic
1131029554 15:89175034-89175056 TTCAGTCCAGAGGGACTGCCAGG - Intronic
1131263088 15:90899518-90899540 TGGTGTGCTTAGGGACTGCTTGG + Intergenic
1132714222 16:1282737-1282759 CGATGTGCAGGGAGAGTGCCCGG + Intergenic
1133191150 16:4134420-4134442 GGCTTTGCAGTGGGACTGCCTGG + Intergenic
1133232284 16:4372398-4372420 TGCTGTGCAGAAGGGCTGCCCGG + Intronic
1134201287 16:12201587-12201609 TACTGTGCAGAGGAATTGCCTGG + Intronic
1134824479 16:17273525-17273547 TGATGTGCAGACGAATTGCTTGG - Intronic
1135166114 16:20140580-20140602 TGAGGTGCAGAAGGCCTGACAGG - Intergenic
1137574586 16:49590533-49590555 GGATGTGCAGAGGCTCTCCCTGG - Intronic
1138260134 16:55613506-55613528 TAATGTGCAAATGGAATGCCAGG - Intergenic
1142266584 16:89066772-89066794 CGGTGTCCAGAGGGCCTGCCCGG - Intergenic
1145269339 17:21396415-21396437 TGCTGTGCACAGGTCCTGCCAGG + Intronic
1146403379 17:32517938-32517960 TGCTGTCCAGAGGGAGAGCCGGG - Intronic
1147896914 17:43757190-43757212 TGATCTGCAGAGGAAGTGCCTGG - Intronic
1149472741 17:56932148-56932170 TGCTCTGCAGAGGGACTGATGGG - Intergenic
1149727021 17:58906386-58906408 TGGAGTGCAGTGGCACTGCCAGG + Intronic
1151705145 17:75763459-75763481 TGATGGTAAGAGGGGCTGCCTGG + Intronic
1151756814 17:76079952-76079974 TGGTGTCCAGAGAGACTCCCAGG - Exonic
1152149744 17:78591509-78591531 TGATGAGCGGACGGACGGCCCGG - Intergenic
1152181067 17:78822176-78822198 AGCTCTGCAGAGAGACTGCCAGG - Intronic
1152662753 17:81550557-81550579 GGATGTGCACTGTGACTGCCTGG - Exonic
1152873275 17:82770647-82770669 GTCTGTGGAGAGGGACTGCCAGG + Intronic
1153045026 18:848125-848147 TAATGGCCAGAGGGACTGCTAGG + Intergenic
1154092570 18:11378991-11379013 AAATGTGCAGCGGGAGTGCCAGG + Intergenic
1156601184 18:38609060-38609082 GGATGTGCAGATGGGCTCCCTGG + Intergenic
1158527594 18:58229020-58229042 TCACGTGCACAGGGATTGCCTGG - Intronic
1158539204 18:58337430-58337452 TGATGTGCAGAGGAACAGAGGGG - Intronic
1159497199 18:69221915-69221937 TGATGAGCAGAGGTACTGGAGGG - Intergenic
1160153968 18:76418891-76418913 TGAAGGGCAGAGGGTCTGCAGGG + Intronic
1161057539 19:2198255-2198277 GGATGTTCAGAGGGTCTGTCAGG + Intronic
1162799202 19:13101705-13101727 TGAGGTGCAGAGGGTCAGCCTGG - Intronic
1162856495 19:13472508-13472530 TGATGAGCAAAGGGACTCACAGG - Intronic
1165063018 19:33214055-33214077 GGATGGGCAGAGGGGATGCCTGG - Intronic
1165101621 19:33441737-33441759 TGAAGTGGAAAGAGACTGCCTGG - Intronic
1167641706 19:50686204-50686226 TGGTGTGGGGAGGAACTGCCAGG - Intronic
1167724374 19:51200547-51200569 GGATGTGCAAAGAGACTCCCAGG - Intergenic
926971620 2:18472730-18472752 TGATGTGGAGAGGTAATGGCTGG + Intergenic
927789261 2:25997658-25997680 TGATTTCAAGAGGGAATGCCAGG - Intergenic
928164583 2:28961158-28961180 TGATGTGCAGAGGGCCTCAGAGG - Intronic
928840273 2:35597849-35597871 TGATGTTCAGCCGGACTGCCTGG + Intergenic
930229472 2:48828191-48828213 TGATGAGCAGAGGGAGTGGGCGG - Intergenic
933568882 2:83983856-83983878 AGATGTTGAGAGGGACTGCTTGG - Intergenic
934566626 2:95345254-95345276 TGAGGGGCACAGGGACAGCCAGG - Intronic
935657617 2:105438452-105438474 TGCTGTGCAGGCGGACTGCCTGG + Intronic
936038508 2:109130455-109130477 GGGTGTGCAGAGGGAGTGTCTGG - Intronic
937092324 2:119214679-119214701 TGCTGTGAAGAGGGACTGTGTGG + Intergenic
937477870 2:122230945-122230967 TGATGTGCCGAAGAATTGCCTGG - Intergenic
938972146 2:136442387-136442409 TGACGAGCAGAGGCACAGCCTGG + Intergenic
940926291 2:159367026-159367048 TGATGTGCAGAGGAACAGTAGGG + Intronic
941623287 2:167803001-167803023 TGATGTGCAGATGGATTGTGAGG + Intergenic
941732435 2:168933507-168933529 TCATGCACAGAGGGTCTGCCTGG + Intronic
945121605 2:206463024-206463046 TGATGAGCAGAGGAATTGCAGGG + Intronic
947162510 2:227228428-227228450 GGCTGGGCAGAGGGACTGGCAGG + Intronic
947254050 2:228142224-228142246 TGTTGTGCCCAGGGACTGCTGGG + Intronic
948707694 2:239805195-239805217 TGATGCGCAGTGGGACGCCCAGG + Intergenic
948739386 2:240033068-240033090 TGATGAGCATAGGGACTCCAGGG + Intergenic
1168843925 20:929169-929191 TGATGGGAAGAGGGACTGGGGGG - Intergenic
1169533406 20:6509789-6509811 TGATGGGAAGAGGGATTTCCTGG + Intergenic
1170714903 20:18823105-18823127 TGCTGTGTTGAGGGACTGCGTGG + Intronic
1170729316 20:18959265-18959287 TGATGTGTCGAAGGCCTGCCTGG + Intergenic
1172287971 20:33754512-33754534 TGATGTTCTGAGGGGCTGCGAGG + Intronic
1172869337 20:38126121-38126143 TGATGTGCCGAGAGACAGCTAGG + Intronic
1174658969 20:52194087-52194109 TGATCTGCAGTGGGACTGGCAGG - Intronic
1175158226 20:56988551-56988573 TGATCTGCAGAGGGACAGTGTGG - Intergenic
1175163820 20:57029125-57029147 TAAAGGGCAGAGGGACTGACAGG - Intergenic
1175203475 20:57293203-57293225 TGATGTACAAAGGGAATGCCTGG + Intergenic
1175231014 20:57473310-57473332 TGAAGAGCTGAGGGGCTGCCCGG - Intergenic
1178035955 21:28582529-28582551 AGTTCTGCAGAGGGTCTGCCAGG + Intergenic
1181086571 22:20442258-20442280 CGATGTGGAGAAGGACTGCTGGG - Exonic
1181748716 22:24974061-24974083 TCATTTGCTGAGGGCCTGCCAGG - Intronic
1182481280 22:30610591-30610613 TGATGGGCAGAGTGGTTGCCTGG + Intronic
1183441564 22:37825704-37825726 GAATGGGCAGAGGGACTGCCAGG - Intergenic
1183469663 22:37998644-37998666 GGATGTGCAGAGGACCGGCCAGG + Intronic
1183520545 22:38294074-38294096 TGAGGCCCAGAGGGACTGGCAGG + Intronic
1184452819 22:44592959-44592981 GGATGGGCAGAGGGACAGCACGG - Intergenic
1185061966 22:48611819-48611841 GGATGGGCAGAGGCAGTGCCTGG + Intronic
949854272 3:8446027-8446049 TGGTGTGCATAGGAAGTGCCTGG + Intergenic
950548898 3:13654874-13654896 CTGTGTGCAGAGGGAGTGCCAGG - Intergenic
950714911 3:14841189-14841211 TGCTCTGCAGAGGGGCTGCCTGG + Intronic
952884904 3:38006311-38006333 TGATGGGCAGGGGAAGTGCCAGG + Intronic
953569837 3:44062698-44062720 TAATGTGCAGAGCGAGTGCTTGG - Intergenic
953885437 3:46712266-46712288 TGAGGGGCAGTGGGAGTGCCAGG + Exonic
955406314 3:58627717-58627739 TGAGGAGGAGAGTGACTGCCGGG - Intergenic
955591150 3:60537241-60537263 TGAAGTGCAGAGGGAGTGAAGGG - Intronic
955955523 3:64285600-64285622 TAATGTGCATAGGAACTCCCTGG + Intronic
957938431 3:86973796-86973818 TGATGTACATAGGGTCTGCTTGG - Intronic
959889203 3:111534838-111534860 TGAAGTGCTGAGTGACTGCAAGG + Intronic
960047254 3:113210755-113210777 TGATCTGCAGCAGGACTCCCTGG - Intergenic
961187986 3:124932654-124932676 TGATGTGCCGGGATACTGCCTGG - Intronic
967770053 3:193324887-193324909 TGAGGTCCAGAGGGTCTCCCTGG + Exonic
967782889 3:193459104-193459126 TGAGGTCCAGAGGGTCTCCCTGG + Exonic
967969461 3:194988298-194988320 TGTTGTGGACAGGGAGTGCCAGG + Intergenic
968230048 3:197000187-197000209 TGATGTGCACATTAACTGCCTGG - Intronic
968454367 4:689454-689476 TGCTGGGCAGAGTGACTTCCAGG - Intergenic
969016757 4:4108420-4108442 TGGTGGGCAGAGAGATTGCCTGG + Intergenic
973617256 4:52691504-52691526 TAATGGGCATAGAGACTGCCAGG + Intergenic
976660798 4:87538180-87538202 TGCTGTGAACATGGACTGCCAGG + Intergenic
985825817 5:2190819-2190841 AGAGGTGCAGATGGACAGCCGGG - Intergenic
985979730 5:3452426-3452448 TGATGTGTAGAGGGTGAGCCGGG - Intergenic
987084150 5:14453639-14453661 TGCTGTGTAGTGGGAGTGCCAGG + Intronic
989158804 5:38370541-38370563 TGCCGTGCAGAAGGACAGCCTGG + Intronic
990791694 5:59487957-59487979 TGATGTGCAGAGGGGAAGGCAGG - Intronic
993803886 5:92379477-92379499 TGAACTGCAGAGGGACTGGGGGG + Intergenic
994856079 5:105121112-105121134 TAATGTGCAGAGGAATTACCTGG - Intergenic
995188826 5:109299070-109299092 TGATGTGCAGAGGTGGTGCTGGG - Intergenic
998446693 5:142204359-142204381 TGATGTCCAGTTGGAATGCCAGG + Intergenic
1002850760 6:994911-994933 AGATGGGCAGAGGGACAGGCTGG + Intergenic
1003143552 6:3491470-3491492 TGATCTGCAGAGTCACTGGCAGG + Intergenic
1003236592 6:4300676-4300698 TGATCAGCACAGTGACTGCCTGG - Intergenic
1003839853 6:10108465-10108487 TGATTTGCAGCAGGAATGCCAGG - Intronic
1004697166 6:18044312-18044334 TAATGTGAAAAGGGACGGCCTGG - Intergenic
1004891909 6:20109147-20109169 TGGTGTGCAGAAGGACTCCCTGG - Intronic
1005814446 6:29539274-29539296 AGATGTGCAGAGGCCCTTCCAGG - Intergenic
1008385338 6:50882962-50882984 TCCTGTGCAGAGGGACTGTTTGG + Intergenic
1010339968 6:74738152-74738174 TCATTTGGAGAAGGACTGCCTGG + Intergenic
1010779984 6:79934106-79934128 GGAGCTGCAGAGGAACTGCCAGG + Intronic
1013928980 6:115506689-115506711 TGATGTACAGATGATCTGCCTGG + Intergenic
1016561204 6:145396868-145396890 TGATGTTCAAAGGGAATCCCAGG - Intergenic
1017599005 6:156060662-156060684 TGAGGTGCAGCAGGACTGCCAGG + Intergenic
1018780383 6:167058397-167058419 TGATGTGAAGGGGGAGTGGCGGG - Intergenic
1021051260 7:15988173-15988195 TGATGTGCAGATGGAATGTGTGG - Intergenic
1021521760 7:21545711-21545733 TAATGTGCATAAGAACTGCCTGG + Intronic
1023849733 7:44143996-44144018 ATGTGTGCAGAGGGAGTGCCAGG - Intergenic
1024598476 7:50959977-50959999 TGCTGTGCAGCGTGACAGCCAGG + Intergenic
1024629670 7:51236678-51236700 TGAGCTGCAGAGGGACAGCTGGG - Intronic
1026950624 7:74344121-74344143 GCAGGTGCAGAGGGAATGCCAGG - Intronic
1029861189 7:103574102-103574124 TGGTGTCCAGAGGGACCGTCCGG + Exonic
1032684231 7:134214895-134214917 TGATTTGCAGAGGAACAGACTGG + Intronic
1033200376 7:139363080-139363102 GGCTGGGCAGGGGGACTGCCAGG + Intronic
1033249508 7:139746726-139746748 GGATGTGCAGATGGAATTCCTGG - Intronic
1033557340 7:142500198-142500220 GGATGAGCACAGGGACAGCCTGG - Intergenic
1034989335 7:155538281-155538303 TGGTGTGCAGATGGACTGCAGGG - Intergenic
1037290565 8:17345429-17345451 TGAGGAGCAGAGTGACAGCCAGG - Intronic
1041756705 8:61321668-61321690 TGATGTGAAGAGGGTCACCCTGG - Intronic
1042712193 8:71730553-71730575 TGAGGTTCAGAGTGACTTCCAGG - Intergenic
1044444529 8:92258993-92259015 TAATTTGCAGAGGGGCTTCCTGG - Intergenic
1045354807 8:101375962-101375984 AGATGTGGAGATGGTCTGCCAGG - Intergenic
1047389042 8:124435057-124435079 TCATGAGCAGAGGGACTGCCTGG - Intergenic
1048288166 8:133158552-133158574 TGATTTGCCAAGGGACTGCAAGG - Intergenic
1049163434 8:141112030-141112052 GAATGTGCAGAGGGGCTGGCAGG + Intergenic
1050469747 9:5974703-5974725 AGATGTGCAGAGGATCTCCCTGG + Intronic
1051235233 9:14992612-14992634 TGATGTGCATAGGAATTACCAGG + Intergenic
1055059082 9:72050235-72050257 TGAGGTGCAGAGAGGCTGACGGG + Intergenic
1057214511 9:93220539-93220561 TGATGGGCAGAGAGACTAACTGG + Intronic
1057254055 9:93529057-93529079 GTATCTGCAGAGGGACTGCAGGG + Intronic
1057421384 9:94915770-94915792 AGATTTGCAGAGGGCCTGACTGG + Intronic
1060455603 9:123792604-123792626 TGAGGTGCAGAGGCAATTCCCGG - Exonic
1061329011 9:129880654-129880676 TGACTGGCAGAGGCACTGCCAGG - Exonic
1061715010 9:132513568-132513590 TCATGTGCAGAGTGACTTCCAGG - Intronic
1062426943 9:136510490-136510512 GGATGTGCTGAGGGATGGCCAGG - Intronic
1186776530 X:12870528-12870550 TGGGGTGCAGAGGTACTGGCTGG - Intronic
1186874536 X:13804080-13804102 TAATGTGCATAGGAACTACCTGG + Intronic
1187135263 X:16541970-16541992 TGGGGTTCAGAGGGACAGCCAGG - Intergenic
1188470668 X:30535144-30535166 TTATGAGCAGAGGCACTGACTGG + Intergenic
1190453419 X:50603105-50603127 TGATGATCAGAAGGCCTGCCAGG - Intronic
1200967449 Y:9110183-9110205 CCATGTGCAAAGGGACAGCCAGG - Intergenic