ID: 907268044

View in Genome Browser
Species Human (GRCh38)
Location 1:53274729-53274751
Sequence GTGATGTGCAGAGGGACTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268044_907268053 28 Left 907268044 1:53274729-53274751 CCGGCAGTCCCTCTGCACATCAC 0: 1
1: 0
2: 1
3: 27
4: 250
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160
907268044_907268052 27 Left 907268044 1:53274729-53274751 CCGGCAGTCCCTCTGCACATCAC 0: 1
1: 0
2: 1
3: 27
4: 250
Right 907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 155
907268044_907268054 29 Left 907268044 1:53274729-53274751 CCGGCAGTCCCTCTGCACATCAC 0: 1
1: 0
2: 1
3: 27
4: 250
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268044 Original CRISPR GTGATGTGCAGAGGGACTGC CGG (reversed) Intronic
900122561 1:1055065-1055087 GTGTTGGCCGGAGGGACTGCTGG + Exonic
901705775 1:11071899-11071921 GTGCTGTGCAGAGAGATTGGTGG - Intronic
902183145 1:14704842-14704864 GTGTTGTGGTCAGGGACTGCTGG + Intronic
902760613 1:18578455-18578477 GTGCTGAGCAGAGGGACAACAGG + Intergenic
903326882 1:22573903-22573925 GTGATGAGCTGAGGGAATCCAGG - Intronic
905530588 1:38675569-38675591 GTGTAGTGCAGAGGGACACCAGG - Intergenic
905768328 1:40621720-40621742 GTGATCTGGACAGGGACAGCTGG - Exonic
906310990 1:44754371-44754393 GTGATGGCCAGAGGGGCTGCAGG + Intronic
906543073 1:46603140-46603162 GTGATGTGAAGAGGAAATCCAGG - Intronic
907268044 1:53274729-53274751 GTGATGTGCAGAGGGACTGCCGG - Intronic
908984286 1:69998269-69998291 GTGATGGGGAGAAGGACTGGGGG - Intronic
911236434 1:95417320-95417342 ATGATTTGCAGGGTGACTGCAGG - Intergenic
911891556 1:103378175-103378197 GTGATGTACAGATGGACTTTTGG - Intergenic
912952919 1:114132972-114132994 GAGTTGTGCAGAAGGAGTGCAGG - Intronic
913498678 1:119450868-119450890 GTGATGTGAAGAGTGAATGTGGG + Intergenic
914247869 1:145899263-145899285 GTGTGGTTCAGAGGGACTGTAGG - Exonic
916488255 1:165278590-165278612 GTGAGGTTCAGAAAGACTGCAGG - Intronic
916555258 1:165889399-165889421 ATGATGTGCTGAGGGGCTACAGG - Intronic
917057853 1:171003761-171003783 GTAGTGTGGAGAGGGACTGGTGG + Intronic
917109408 1:171529967-171529989 GTTATGAGGAGAGGGATTGCTGG - Intronic
917488879 1:175480265-175480287 GTGATGAGCAGAGGGAGGGCTGG + Intronic
918010242 1:180580214-180580236 TTGATGGGCAGAGGGGCTGAGGG - Intergenic
918210523 1:182347227-182347249 CTTATGTGAAGAGGAACTGCTGG - Intergenic
919753186 1:201050961-201050983 GTGAGATGCTGAGGGCCTGCGGG - Intronic
922505809 1:226124864-226124886 GTGAAATGCAGAGGGAGGGCTGG - Intergenic
923924125 1:238604440-238604462 GTGATGTTCAGAGGAAGAGCTGG + Intergenic
1063372533 10:5531212-5531234 GGCATCTGCAGAGGGAGTGCTGG + Intergenic
1063379301 10:5574449-5574471 GAGAGGTGCAGAGAGGCTGCGGG + Intergenic
1064158851 10:12926028-12926050 GGTAGGAGCAGAGGGACTGCTGG + Intronic
1064316711 10:14264213-14264235 GTGATGTGCCCAGGGATTTCAGG - Intronic
1065407169 10:25382044-25382066 GTGATGTGAACTGTGACTGCGGG + Intronic
1066454451 10:35560964-35560986 AAGATGAGCAGAGGCACTGCCGG + Intronic
1068474276 10:57506281-57506303 GTGAGGTGGAGAAGGCCTGCAGG - Intergenic
1069737259 10:70665010-70665032 AAAATGTGCAGAGGGAATGCTGG + Intergenic
1072756415 10:98024150-98024172 GTGACCTGAGGAGGGACTGCAGG - Intronic
1072766069 10:98096178-98096200 GTGACGTGCCCAGGGACTCCAGG - Intergenic
1073121095 10:101123031-101123053 GTAAAGTGCACAGGTACTGCAGG - Intronic
1073650650 10:105354588-105354610 GTGATGGAGAGAGGGACTCCTGG + Intergenic
1074704851 10:116121538-116121560 GTTCTGTGCAGAGGCACTGTCGG + Intronic
1075511290 10:123074671-123074693 GGGATGGGCAGGGGGACAGCAGG - Intergenic
1075823528 10:125334305-125334327 CTGGTGTGCAGAGGGCATGCAGG + Intergenic
1076752299 10:132549619-132549641 GTGATGAGCATGGGGAGTGCAGG + Intronic
1076830591 10:132992398-132992420 GTGGGATGCAGAGGGGCTGCTGG + Intergenic
1077068598 11:656687-656709 GTGTGGTGCACAGGGACTGCTGG - Intronic
1077386757 11:2272882-2272904 GTGATCTGAAGAGGGCTTGCAGG - Intergenic
1077432669 11:2523688-2523710 GTGAAGGGCAGAGGAGCTGCAGG + Intronic
1077674365 11:4183592-4183614 GTGAACTGCAGTGGGACTGGGGG + Intergenic
1079689642 11:23404558-23404580 GTGAAGGTCAGAGGGGCTGCGGG - Intergenic
1080625668 11:34028541-34028563 GAGCTATGCAGAGGGAATGCAGG + Intergenic
1084028508 11:66467238-66467260 GTGTTGTGCGGAGGGGCCGCCGG + Intronic
1085861756 11:80243748-80243770 TTGCTGTGCAAAGAGACTGCTGG + Intergenic
1085930530 11:81077348-81077370 GTTGTCTGCAGTGGGACTGCTGG - Intergenic
1087006650 11:93478337-93478359 ATGATGAGCAGAGGGAGTGCTGG + Intergenic
1088848669 11:113688225-113688247 GTGGTGTGCAGTGAGACTGGAGG + Exonic
1090657310 11:128855943-128855965 GTGAGCTGCAGAGGAAATGCAGG + Intronic
1090757342 11:129803969-129803991 GTAGTGTGGAGAGGGACTGGTGG - Intergenic
1091037853 11:132249496-132249518 GTGATGCCCAGAAGGACTGGCGG + Intronic
1091622035 12:2096330-2096352 GTCATGTGCTGAGGGCTTGCCGG + Intronic
1092178805 12:6430373-6430395 GTGATTGGCAGAGGCAATGCAGG + Intergenic
1094831164 12:34300970-34300992 GGGACCTGCACAGGGACTGCTGG - Intergenic
1096237497 12:49939742-49939764 GGGCTGGGCAGAGGGCCTGCTGG - Intergenic
1097158931 12:57031976-57031998 GTGGTGTGCCCAGGGAATGCAGG - Intronic
1097899526 12:64858862-64858884 GAGGTGTGCAGAGGGGCTGGGGG + Intronic
1098310197 12:69140737-69140759 GTGATGTGCAGTGGCCCTGAGGG + Intergenic
1102430727 12:112881089-112881111 GTGCTGTGCAGAGGGATGACGGG + Intronic
1103851853 12:123938549-123938571 GTGAGGTGACCAGGGACTGCAGG - Intronic
1104778849 12:131406840-131406862 TTGATGAGCACAGGGACTCCTGG - Intergenic
1107445728 13:40469041-40469063 GTGATGTGCAGATGATCTGGTGG - Intergenic
1107529724 13:41271677-41271699 GTGATGTGCAGCGGCCCTACTGG - Intergenic
1110604054 13:77410449-77410471 GTGATGTGAAGAGGGTCTTTTGG - Intergenic
1112035330 13:95492184-95492206 GTCATGTGGAAAGGGACTGGTGG + Intronic
1112439885 13:99417683-99417705 GGGCTGGGCAGCGGGACTGCAGG + Intergenic
1112972185 13:105273903-105273925 CTGAAGAGCAGATGGACTGCAGG - Intergenic
1115743574 14:36412682-36412704 GTGATGTACAGATGGAGTTCTGG - Intergenic
1115870910 14:37801634-37801656 GTGATGTGGTGAGGAACTGTGGG + Intronic
1117771597 14:59139336-59139358 GTGTTGGGCAGAAGGGCTGCTGG - Intergenic
1118141389 14:63087141-63087163 GTAATGTTTTGAGGGACTGCCGG - Intronic
1121126033 14:91407269-91407291 GGGGTCTGCTGAGGGACTGCTGG - Intronic
1122803375 14:104244278-104244300 GTTATGTGCAGGGAGACAGCTGG + Intergenic
1124460253 15:29883334-29883356 GTGAAATGCACAGGGAATGCAGG + Intronic
1125506890 15:40272352-40272374 GGGCTGTGCGGAGGGACTTCTGG - Exonic
1127728006 15:61769848-61769870 CTGATGTGCAGAGGGATTCAGGG - Intergenic
1129530542 15:76261012-76261034 GTGATGTTGAAGGGGACTGCAGG + Intronic
1129816683 15:78561595-78561617 GTAATGAGCAGAGGGAGTACAGG + Intergenic
1130942975 15:88526514-88526536 GTGATTTGTAAAGGGACTCCAGG + Intronic
1131878568 15:96837996-96838018 GTGAAGAGCAGAGGGACTGATGG - Intergenic
1133218246 16:4306577-4306599 GTGAGGTGCAGAAGGCCTGGGGG - Intergenic
1133340128 16:5030624-5030646 GGGATGTGCAGAGGGGAGGCAGG - Intronic
1133477911 16:6141164-6141186 GTGATGGGCTAAGGTACTGCAGG - Intronic
1133597719 16:7309326-7309348 GTGTTGTGGACATGGACTGCAGG + Intronic
1134201703 16:12204768-12204790 GTGATGTGCTCAGGGATTCCTGG + Intronic
1135988843 16:27204628-27204650 GTGATTTGCAGAGGGTCTCAGGG - Intronic
1137737857 16:50738335-50738357 GGGGAGTGCAGAGGGATTGCAGG + Intergenic
1143005659 17:3831687-3831709 GGGATGTGGAGAGGTACTGTGGG - Intronic
1144172188 17:12668879-12668901 TTGATGTGCAGTGGGACCGGCGG + Intronic
1146403380 17:32517939-32517961 GTGCTGTCCAGAGGGAGAGCCGG - Intronic
1147446769 17:40479527-40479549 GTGATGTGCTGAGTGACTCCAGG - Intronic
1147463162 17:40588956-40588978 GTAGTGTGGAGAGGGACTGGCGG + Intergenic
1147992425 17:44343164-44343186 GTGATGTTTAGTGGGATTGCTGG + Intergenic
1149472742 17:56932149-56932171 CTGCTCTGCAGAGGGACTGATGG - Intergenic
1151434795 17:74088405-74088427 GCTGTGTGCAGAGGGACAGCGGG - Intergenic
1151866264 17:76805360-76805382 GTGGAGTGCAGTGGGACTACAGG + Intergenic
1153069457 18:1089068-1089090 GTAGTGTGGAGAGGGACTGCTGG + Intergenic
1154005539 18:10524484-10524506 GTAATGTGCAGTGGGAGTCCAGG + Intergenic
1156392562 18:36664582-36664604 GTGCTGTGCTGTGGGACTGTGGG + Intronic
1156607526 18:38684564-38684586 CTGATGTGCAGAGAAAATGCAGG + Intergenic
1158299316 18:56033894-56033916 TTGCTGTGCAAAGGGACTGGTGG - Intergenic
1158539205 18:58337431-58337453 GTGATGTGCAGAGGAACAGAGGG - Intronic
1159339148 18:67112277-67112299 GTGATGTGGAGGGGGAGGGCGGG - Intergenic
1159497200 18:69221916-69221938 GTGATGAGCAGAGGTACTGGAGG - Intergenic
1160153967 18:76418890-76418912 CTGAAGGGCAGAGGGTCTGCAGG + Intronic
1160472033 18:79145040-79145062 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472046 18:79145133-79145155 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472051 18:79145178-79145200 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472065 18:79145274-79145296 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472073 18:79145322-79145344 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472081 18:79145370-79145392 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472088 18:79145418-79145440 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472095 18:79145466-79145488 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472103 18:79145514-79145536 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472118 18:79145610-79145632 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472126 18:79145658-79145680 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472134 18:79145706-79145728 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472158 18:79145850-79145872 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472175 18:79145946-79145968 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472189 18:79146042-79146064 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472206 18:79146138-79146160 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472215 18:79146186-79146208 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472224 18:79146234-79146256 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472240 18:79146330-79146352 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472283 18:79146570-79146592 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1160472291 18:79146618-79146640 GCGGTGTGCAGAGTGACTGAAGG + Intronic
1161849670 19:6731855-6731877 GCCATGAGCAGAGGGCCTGCAGG + Intronic
1163255459 19:16153343-16153365 GTGGGGGGCAGAGGGACTACTGG - Intronic
1164320144 19:24137280-24137302 GTAGTGTGCAGAGGGACTGGTGG + Intergenic
1166318013 19:41999350-41999372 GGGATGTGGAGAGGGGCTGGGGG - Intronic
1166647210 19:44541028-44541050 GTGGTGCTCACAGGGACTGCTGG - Intergenic
1167955215 19:53058533-53058555 GGGGTCTGCAGAGGGACCGCGGG + Intergenic
1168353514 19:55689144-55689166 GTGACACGCAGAGGGACGGCGGG - Intronic
1202633340 1_KI270706v1_random:20022-20044 GTTACGTGCTGAGGGACTGTGGG - Intergenic
1202652539 1_KI270707v1_random:20069-20091 GTTACGTGCTGAGGGACTGTGGG + Intergenic
926172533 2:10561341-10561363 GTGATGTGCAGAGGGAAATGGGG + Intergenic
927762452 2:25771505-25771527 GTGATGGGCAGCCTGACTGCGGG + Exonic
929212158 2:39369001-39369023 GTTATGTGCAGAGGGAAGGAAGG - Intronic
932453780 2:71833091-71833113 GTGATGAGCAGATGGACAGGTGG - Intergenic
932606186 2:73167156-73167178 GTGCTGTGCAGTGGGGGTGCAGG + Intergenic
932944468 2:76211331-76211353 GTGATGGGCAGAAGAACTACTGG - Intergenic
933926242 2:87093295-87093317 GTGCTGTGCAGTGGGGGTGCAGG - Intergenic
934534474 2:95121733-95121755 GTGCTGTGTAGCGGGACGGCAGG - Exonic
934955622 2:98615588-98615610 GAGATGAGCAGAGGGGCTGGTGG - Intronic
935341766 2:102065269-102065291 GTGTGGTGCAGAGGGCCTGGAGG + Intronic
936373657 2:111923088-111923110 GTGACGTGCAGAGGTCCTGAAGG - Intronic
940926290 2:159367025-159367047 CTGATGTGCAGAGGAACAGTAGG + Intronic
941294069 2:163714238-163714260 GTTATGTGGTGAGGGAATGCTGG - Intronic
942088611 2:172465917-172465939 GTGATGTGTTGAGGTTCTGCAGG + Intronic
944528847 2:200648607-200648629 GTAATGTGGAGAGGGATTGGCGG + Intronic
945121604 2:206463023-206463045 GTGATGAGCAGAGGAATTGCAGG + Intronic
946054826 2:216891588-216891610 GTGAAATGAAGAGGTACTGCAGG - Intergenic
946381464 2:219351746-219351768 GGGCTGTGCAGGGGGACGGCTGG + Intergenic
946989434 2:225311594-225311616 GTCATTTGCAGAAGGAATGCAGG + Intergenic
947254049 2:228142223-228142245 CTGTTGTGCCCAGGGACTGCTGG + Intronic
947713143 2:232327064-232327086 GGGATGTGGAGAGCGCCTGCAGG + Intronic
947720215 2:232365533-232365555 GGGATGTGGAGAGCGCCTGCAGG + Intergenic
947730974 2:232431503-232431525 GTGACATGGACAGGGACTGCAGG + Intergenic
947732833 2:232440520-232440542 GGGATGTGGAGAGCGCCTGCAGG + Intergenic
948346299 2:237301476-237301498 GTGATGGGCAGAGGGACAGTGGG + Intergenic
948739385 2:240033067-240033089 CTGATGAGCATAGGGACTCCAGG + Intergenic
1168843926 20:929170-929192 ATGATGGGAAGAGGGACTGGGGG - Intergenic
1169898330 20:10527914-10527936 GAAATGTGCAGAGGGACAGCTGG + Intronic
1170023885 20:11867491-11867513 GTTATGTGCAAAGGGATTGGTGG - Intergenic
1172642126 20:36446876-36446898 GCGGTGGGGAGAGGGACTGCAGG - Exonic
1173473243 20:43339505-43339527 GGTAGGTGCTGAGGGACTGCAGG - Intergenic
1174761268 20:53209435-53209457 GTGCAGTGCAGAGGGACTCATGG + Intronic
1174824704 20:53758790-53758812 GTGATGTGGATCGGGACTGCTGG + Intergenic
1176599612 21:8779585-8779607 GTTACGTGCTGAGGGACTGTGGG - Intergenic
1177612932 21:23476313-23476335 GTCAAGTGCAGAGGGATTGCAGG - Intergenic
1178584518 21:33860940-33860962 CTGATGTGTACAGGGGCTGCTGG + Intronic
1178879147 21:36434751-36434773 GTGATATGCCGAGAGGCTGCAGG - Intergenic
1179899042 21:44379466-44379488 GTGCTGTGAAAAGGGTCTGCTGG + Intronic
1179997900 21:44982298-44982320 GTGGTGTTAAGAGGGACAGCGGG + Intergenic
1179997916 21:44982353-44982375 GTGGTGTTCAGGGGGACAGCGGG + Intergenic
1180072710 21:45444369-45444391 GGGATGTGCAGAGTGAATGAAGG + Intronic
1180367370 22:11953268-11953290 GTTACGTGCTGAGGGACTGTGGG + Intergenic
1180418821 22:12795276-12795298 GTTACGTGCTGAGGGACTGTGGG + Intergenic
1181086572 22:20442259-20442281 ACGATGTGGAGAAGGACTGCTGG - Exonic
1183048336 22:35240272-35240294 GTAGTGTGGAGAGGGACTGGTGG + Intergenic
1183543594 22:38443811-38443833 GTGATGTGGAGATGGACTGCGGG - Intronic
1184816855 22:46878757-46878779 TTCCTGTGCACAGGGACTGCAGG + Intronic
953249403 3:41230693-41230715 GGGATGTTAAGTGGGACTGCAGG + Intronic
953610783 3:44445712-44445734 GAGAAGAGCAGAGGGAGTGCTGG - Exonic
954141636 3:48609789-48609811 CTGATGTGCGCAGGGACTGGCGG - Exonic
955591151 3:60537242-60537264 GTGAAGTGCAGAGGGAGTGAAGG - Intronic
957038124 3:75313639-75313661 GTGATGTGAAAAGGGCCTCCAGG + Intergenic
957094658 3:75767629-75767651 GTTACGTGCTGAGGGACTGTGGG + Intronic
960723753 3:120649723-120649745 GTGATGTGCAGTGGCGCTACAGG + Intronic
961433910 3:126903170-126903192 GTGGAGTGCAGAGGGAAGGCTGG - Intronic
961971767 3:130975961-130975983 GTGATGGGGAGAGGGTCTGCTGG + Intronic
964628453 3:158782163-158782185 ATGATGTTCAAATGGACTGCAGG - Intronic
965517600 3:169638383-169638405 GTCATGTGTAGGAGGACTGCTGG - Intronic
967427302 3:189341614-189341636 GTAATGTGCAGAGGGATTTTGGG + Intergenic
968794558 4:2693983-2694005 GTGAAATGCCGAGGGAATGCAGG + Intronic
968872267 4:3248023-3248045 GTGGTCAGCAGAGGGACAGCAGG - Exonic
969327645 4:6453066-6453088 ATGATGAGCAGTGGGACTGCGGG - Intronic
969997798 4:11332265-11332287 GTGATGTTCAGAGGTGCTGAGGG - Intergenic
970421713 4:15911163-15911185 GTGAATTGCAGATTGACTGCTGG - Intergenic
970658595 4:18260057-18260079 GTAGTGTGGAGAGGGACTGGTGG + Intergenic
972635368 4:40879123-40879145 GTGCTGCTCCGAGGGACTGCAGG + Intronic
974950998 4:68582736-68582758 GTATTGTGGAGAGGGACTGGTGG - Intronic
975065920 4:70063656-70063678 GTGATGTGCAGCAGCCCTGCGGG - Intergenic
975517287 4:75260460-75260482 GTAGTGTGCAGAGGGACCACGGG - Intergenic
977718181 4:100207853-100207875 GTGGTGTTCTGAGGGACTGGAGG + Intergenic
978864709 4:113494297-113494319 GTGATATACAGATGGACTTCTGG + Intronic
982189908 4:152843437-152843459 GTAATGTGGAGAGGGACTGGTGG + Intronic
982798651 4:159674484-159674506 GTGAAGTGCAGAAGGTCTGAGGG + Intergenic
984665742 4:182427051-182427073 TTTATGTGCTGAGGGACTTCTGG + Intronic
985682977 5:1266109-1266131 GAGCTGTGCACAGGGCCTGCAGG - Intronic
985979731 5:3452427-3452449 GTGATGTGTAGAGGGTGAGCCGG - Intergenic
986220341 5:5763359-5763381 GTCATATGAAGAGGGACTCCTGG - Intergenic
990266657 5:54084132-54084154 GTGAAGGGCAGGGGCACTGCAGG + Intronic
992091663 5:73323006-73323028 GTATTGAGCAGAGGGACTGTAGG + Intergenic
992481963 5:77160045-77160067 GTGATTTGAAGAGGGAATGCAGG + Intergenic
993794597 5:92250267-92250289 GTAATGAGAAGAGGGACAGCTGG - Intergenic
993803885 5:92379476-92379498 ATGAACTGCAGAGGGACTGGGGG + Intergenic
995188827 5:109299071-109299093 TTGATGTGCAGAGGTGGTGCTGG - Intergenic
995249181 5:109970414-109970436 GAGATGGGCAGAGGGACAGTTGG - Intergenic
996577995 5:124997895-124997917 GTAATGTCCAGATGGAATGCAGG + Intergenic
996777065 5:127143879-127143901 GCGCTGTGCAGCGGGACAGCGGG - Intergenic
1002318573 5:178361631-178361653 GTGCTGTGCAGAGGTTCTGGTGG - Intronic
1003047184 6:2744631-2744653 AGGATGTGCAGAGGGACAGTGGG - Intronic
1004485499 6:16062673-16062695 GTGCTGTGGAGAGGGATTGCTGG - Intergenic
1005423023 6:25672506-25672528 GAGATGTGAGGAGGGACTGAGGG + Intronic
1006297191 6:33174945-33174967 GTGGTGGGCAAAGGGCCTGCAGG - Intronic
1006854897 6:37125908-37125930 GTGGTGTGGAGACGGACGGCAGG - Intergenic
1006918521 6:37612516-37612538 TTGATGTGGAGAGGGTCTCCTGG - Intergenic
1014078331 6:117263381-117263403 GTGTTGTGCAGGGGGAATGGGGG - Intergenic
1018067116 6:160131956-160131978 GTGAACTGGAGAGGGTCTGCGGG + Intronic
1024629671 7:51236679-51236701 GTGAGCTGCAGAGGGACAGCTGG - Intronic
1025108001 7:56188951-56188973 GTGATGTGCTGAGAGCCTGAAGG - Intergenic
1026592132 7:71706169-71706191 GTCATGTGCATAGGTTCTGCTGG - Intronic
1030936025 7:115585520-115585542 GTAGTGTGGAGAGGGACTGGTGG - Intergenic
1031372107 7:120981085-120981107 GTGAGGTGGAGGGGGACTGAGGG - Intergenic
1033430892 7:141288653-141288675 GTCCTTTGCAGACGGACTGCTGG + Intronic
1034303048 7:150032956-150032978 CTGATGTGCAAAAGGTCTGCTGG + Intergenic
1034989336 7:155538282-155538304 ATGGTGTGCAGATGGACTGCAGG - Intergenic
1035050636 7:155996943-155996965 GTGAGGAGCAGAGGGTCTGGGGG + Intergenic
1035052213 7:156005449-156005471 GGGATGTGCAGCGGGCTTGCTGG - Intergenic
1040071296 8:43190894-43190916 GTGATGTGGGGAGTGACTGGCGG - Intronic
1040293514 8:46137500-46137522 GTGAGAAGCAGAGAGACTGCAGG - Intergenic
1040809951 8:51440851-51440873 ATGAGGTGCAGAGGGCCAGCAGG + Intronic
1043697276 8:83236211-83236233 CTGATGTTAAGTGGGACTGCTGG + Intergenic
1045468184 8:102488353-102488375 GGAATGAGCAGAGGGACTGGAGG + Intergenic
1048091440 8:131245166-131245188 ATGGGGTGCAGAAGGACTGCTGG - Intergenic
1048901242 8:139039866-139039888 GTTATCTGCAGAGGCTCTGCTGG - Intergenic
1049209915 8:141381174-141381196 GGGAAGTGCAGAGGGACTGTGGG - Intergenic
1050147418 9:2583793-2583815 GTAATATGGAGAGGGACTGGCGG - Intergenic
1050361718 9:4836803-4836825 GCCATGTGCAGAGAGAGTGCTGG + Intronic
1054860842 9:69951449-69951471 GTGATGTGGAAAGGGACAGGAGG - Intergenic
1056046599 9:82724442-82724464 GTGATGTGCAGAAGGACATGAGG + Intergenic
1056322698 9:85451915-85451937 GTAGTGTGGAGAGGGACTGGCGG + Intergenic
1057254054 9:93529056-93529078 CGTATCTGCAGAGGGACTGCAGG + Intronic
1057467673 9:95330498-95330520 GTGATGTGCAGTGGCCCTACAGG - Intergenic
1057531698 9:95853246-95853268 GTGATGTGCAGAGTGCCTCAGGG - Intergenic
1058085007 9:100739588-100739610 GTAGTGTGGAGAGGGACTGATGG + Intergenic
1058308374 9:103471193-103471215 GTAATGTGAAGAGGGACTGGTGG + Intergenic
1059849177 9:118318063-118318085 GTGATGATCAGAGGGACTATGGG - Intergenic
1061374733 9:130217236-130217258 GTGCTGGGCACTGGGACTGCAGG + Intronic
1203482695 Un_GL000224v1:21249-21271 GTTACGTGCTGAGGGACTGTGGG - Intergenic
1185433441 X:23037-23059 GTGATGTGCAGCTGCACTACCGG + Intergenic
1185442647 X:235105-235127 GTGATGTGCAGCTGCACTACCGG + Intergenic
1189080938 X:37972077-37972099 GAGATGTGCAGCGGCCCTGCAGG - Intronic
1191151790 X:57227667-57227689 GTAGTGTGGAGAGGGACTGGTGG + Intergenic
1192246837 X:69379699-69379721 GGGATTTGGAGAGGGACAGCTGG + Intergenic
1192970244 X:76221104-76221126 GTGGTATGGAGAGGGACTGGTGG + Intergenic
1194926888 X:99836371-99836393 GTAGTGTGGAGAGGGACTGGTGG + Intergenic
1195241942 X:102960676-102960698 CTGAGGAGCAGATGGACTGCAGG - Intergenic
1196218933 X:113088534-113088556 GTAGTGTGAAGAGGGACTGGTGG - Intergenic
1196847786 X:119910340-119910362 GTAATGTGGAGAGGGAGTACAGG - Intronic
1200208297 X:154333281-154333303 GGGAGGTGCAGAGGGACTGGGGG + Intergenic
1201885614 Y:18878793-18878815 GTTATGTGCTGAGGGACTACAGG + Intergenic