ID: 907268045

View in Genome Browser
Species Human (GRCh38)
Location 1:53274737-53274759
Sequence GAAAGTGTGTGATGTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 307}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268045_907268052 19 Left 907268045 1:53274737-53274759 CCCTCTGCACATCACACACTTTC 0: 1
1: 0
2: 0
3: 25
4: 307
Right 907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 155
907268045_907268053 20 Left 907268045 1:53274737-53274759 CCCTCTGCACATCACACACTTTC 0: 1
1: 0
2: 0
3: 25
4: 307
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160
907268045_907268054 21 Left 907268045 1:53274737-53274759 CCCTCTGCACATCACACACTTTC 0: 1
1: 0
2: 0
3: 25
4: 307
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268045 Original CRISPR GAAAGTGTGTGATGTGCAGA GGG (reversed) Intronic
900541757 1:3206383-3206405 GAAAGCGTGTCTGGTGCAGAAGG + Intronic
900802248 1:4744687-4744709 GACTGTGTGTTATGTGCACATGG - Intronic
900898120 1:5498062-5498084 GCAGGTGTGTGTTGTGCATATGG + Intergenic
901395338 1:8977006-8977028 GAGAGTGTGGCATGTGCTGATGG + Intergenic
901633559 1:10659297-10659319 GAAAGCCTGTCATGGGCAGATGG + Intronic
901757164 1:11448415-11448437 GCTGGTGTGTGGTGTGCAGAGGG + Intergenic
902611397 1:17599629-17599651 GAAGGTGGGTGATGGGCTGATGG - Intronic
904307446 1:29599248-29599270 GCAAGTGAGTGATGATCAGAGGG + Intergenic
904396301 1:30224698-30224720 GCAAGTGAGTGATGACCAGAAGG - Intergenic
905530589 1:38675577-38675599 GAAGGTGAGTGTAGTGCAGAGGG - Intergenic
905801545 1:40847258-40847280 GACAGAGAGTGGTGTGCAGAAGG + Intergenic
905871044 1:41404759-41404781 GAAAGGCTGTGGTGTGCTGAGGG - Intergenic
907029117 1:51153300-51153322 GAAAATGGGTCATTTGCAGATGG - Intergenic
907268045 1:53274737-53274759 GAAAGTGTGTGATGTGCAGAGGG - Intronic
908046134 1:60171143-60171165 GAAAGTAAGTAATGTGCAAAGGG - Intergenic
909699108 1:78500612-78500634 GAGAGTGTGTGAAGTGGAGAAGG - Intronic
910370002 1:86505347-86505369 GAATATGTGTGATGTAAAGAGGG - Intergenic
911637187 1:100248548-100248570 GAAAGTGGGAAAAGTGCAGAGGG + Intronic
911743006 1:101407967-101407989 AAAAGGGTGAGATGTGCAAAGGG - Intergenic
912638648 1:111322461-111322483 AAAAGTGTGTTTTGGGCAGAGGG + Intergenic
914955736 1:152160511-152160533 GTAAGTCTGTGTTGAGCAGAGGG + Intergenic
915823893 1:159055584-159055606 GAAAGTGCGTGAAGAGCAGTCGG - Intergenic
916012916 1:160722981-160723003 GATTGTGTGTGATGTAAAGAGGG + Intergenic
916776967 1:167976823-167976845 GAAAATGTGTGATGGGAAGAAGG - Intronic
918111437 1:181458322-181458344 GAAACTGTGGGAAATGCAGAGGG - Intronic
919753752 1:201053902-201053924 GAGATTGTGAGATGTGCAGCAGG - Intronic
920174255 1:204090212-204090234 GAATGTGTGTGTTGGGCAGTCGG + Intronic
920757975 1:208753346-208753368 GGAAGTGTGTTTTGTGCAGAGGG + Intergenic
921521819 1:216165951-216165973 GAAAGTGTGGGATGGGGTGAGGG - Intronic
922893007 1:229076063-229076085 GAAATTCTGTGGTGTGTAGAGGG + Intergenic
1063005973 10:1971019-1971041 GACACTGTGCGATGTGCAGAAGG - Intergenic
1063754421 10:8990693-8990715 GAATGTCTTTGATGTGCACATGG + Intergenic
1064315692 10:14253970-14253992 GAAAGTGTATCGTCTGCAGAGGG - Intronic
1064316053 10:14257684-14257706 GAAAGGCTGTCATGTGAAGATGG + Intronic
1065505068 10:26422129-26422151 CAAAGTGTGTGATATTCATATGG - Intergenic
1065894772 10:30153759-30153781 GACAGTGTCTGATTTGCATAGGG + Intergenic
1066442474 10:35451451-35451473 GAAAGTTGGTGATGAACAGAAGG + Intronic
1067090643 10:43264462-43264484 GCAAGGGTGTGATGTGCGGAGGG - Intronic
1070839634 10:79475185-79475207 GAAGGGGTGTGATCTGAAGAGGG + Intergenic
1071290656 10:84186395-84186417 GTGTGTGTGTGGTGTGCAGAGGG + Intergenic
1071854397 10:89608904-89608926 GAAAGAGTGTGTTAGGCAGATGG - Intronic
1072029076 10:91499712-91499734 GAAAGTGTGTGCTGGGTAGCTGG - Intronic
1072029155 10:91500637-91500659 GATAGTGGGGGATGTGGAGAGGG + Intronic
1072275884 10:93822729-93822751 GAAAGAGTGTTATTTGCATAAGG + Intergenic
1072780881 10:98250946-98250968 GTATGTGTGTGGTGTGCAAAAGG - Intronic
1073320168 10:102611244-102611266 GAAAGTCTGTTATGGGAAGATGG + Intronic
1073393929 10:103202652-103202674 GAAAGGCTGTGGTGGGCAGATGG + Intergenic
1073624182 10:105079459-105079481 GAAAGTTTGTGATGTGAATTGGG + Intronic
1073842614 10:107515190-107515212 GCAAGTGTGTGATGCTCAAAGGG + Intergenic
1074123132 10:110508128-110508150 GAAATTGTGTGGTGAACAGAGGG - Intronic
1074298265 10:112210816-112210838 GACACTGTGTGCTGTGCAGAGGG + Intronic
1074689333 10:115990343-115990365 GAAATTGTGTGATATCCACACGG + Intergenic
1074756281 10:116626863-116626885 GAAAATGTTTGAAGTGGAGAAGG + Exonic
1074944612 10:118269477-118269499 CACAGTGCCTGATGTGCAGAAGG + Intergenic
1077275416 11:1704394-1704416 GACAGTGTGGTATGGGCAGAGGG + Intergenic
1077893782 11:6438657-6438679 GAGAGTGTGTAATGTGCAAAAGG - Intronic
1078081608 11:8208264-8208286 GAATGGGTGTCATGAGCAGAGGG - Intergenic
1080290510 11:30665692-30665714 GAAAATTTGTGAAGTACAGAAGG + Intergenic
1080761691 11:35256425-35256447 GAAAATGTGTCATGAGCAGCTGG + Exonic
1081407889 11:42718966-42718988 GAAAGCCTTTGCTGTGCAGAAGG - Intergenic
1081703065 11:45164063-45164085 GAAACTGAGTGAGGTTCAGAGGG - Intronic
1082790372 11:57342782-57342804 GAAGGTGTGAGCTGGGCAGAGGG - Intronic
1083146114 11:60760114-60760136 GAATATGTGTGATGTAAAGAGGG - Intronic
1084319608 11:68366074-68366096 GAACGTGTGTGATTTCCCGAAGG - Intronic
1085877754 11:80429240-80429262 CAAAGTGTGTATTGTGCAGTAGG - Intergenic
1086301564 11:85431778-85431800 GAGAGTGTGTGCTGTGCTGGGGG - Intronic
1086690131 11:89780401-89780423 CAAGGGGTGTGATGGGCAGAGGG + Intergenic
1086698531 11:89872571-89872593 CAAGGGGTGTGATGGGCAGAGGG - Intronic
1086707635 11:89971925-89971947 CAAGGGGTGTGATGGGCAGAGGG + Intronic
1086715723 11:90059556-90059578 CAAGGGGTGTGATGGGCAGAGGG - Intergenic
1087469847 11:98558669-98558691 GGTAGTATGTAATGTGCAGATGG + Intergenic
1089066040 11:115662711-115662733 GAAAGTGAGTGAGATGGAGAAGG - Intergenic
1089176306 11:116551335-116551357 GAGAGTGTGTGATGTTGTGATGG + Intergenic
1089298933 11:117486361-117486383 GAAAGTGGCTGATGTGAAAATGG + Intronic
1089467114 11:118692492-118692514 AAAAGTTTCTGATGTACAGATGG - Intergenic
1090197259 11:124827296-124827318 GAAAGGGTGTTCTGGGCAGAGGG - Intergenic
1090387865 11:126366984-126367006 TAGAGTGTGTCATCTGCAGAGGG + Intronic
1091238217 11:134035617-134035639 GAAACTGTGTGATGTAGGGAAGG - Intergenic
1093259695 12:16920025-16920047 GAAAATATGTGAAGTGAAGAAGG + Intergenic
1093738324 12:22651149-22651171 GGCAGTGTTTGATTTGCAGAGGG + Intronic
1096578444 12:52569418-52569440 GAACATGTGTGGGGTGCAGAGGG - Intronic
1101957338 12:109222936-109222958 CACAGTGTGTGCTCTGCAGATGG - Intronic
1102105355 12:110316827-110316849 CATAGTGTGTGATGCTCAGAGGG + Intronic
1102596736 12:113998633-113998655 AAAAGTGTTAGATTTGCAGAAGG + Intergenic
1104246920 12:127052252-127052274 ACAAGTATGTGATGAGCAGATGG - Intergenic
1104324682 12:127785137-127785159 GAAAAGGGGTGCTGTGCAGATGG + Intergenic
1105301680 13:19141093-19141115 GAAGGTGTGGTAGGTGCAGAGGG - Intergenic
1107991284 13:45820881-45820903 GAGAGTATGTTACGTGCAGAGGG - Intronic
1108773129 13:53730067-53730089 GAAAGAGAGTGATGTGAAGTGGG - Intergenic
1109446890 13:62451199-62451221 GAAAGTGTGTAATTTGAAGAAGG + Intergenic
1110696413 13:78496523-78496545 ACAAATGTGTGATGTGAAGAAGG + Intergenic
1112039835 13:95535731-95535753 GAAAGACTGTGATGTGAAAAGGG + Intronic
1112699284 13:101986706-101986728 GAGATTTTGTGATGTGCACATGG - Intronic
1113462194 13:110490271-110490293 GAACCTCAGTGATGTGCAGAAGG - Intronic
1113610227 13:111639435-111639457 GAAAGAGTGCAATGCGCAGAGGG + Intronic
1114428988 14:22644459-22644481 GACAGTGTGGGAGGTGCAGCTGG - Intergenic
1114690652 14:24576718-24576740 GAAAGGGTGTGGTGTGGTGAGGG + Intergenic
1118654967 14:67937258-67937280 GAAGGTGTGTCATGTGCTGTAGG - Intronic
1124065242 15:26336556-26336578 GAAGTTGTGTGATGAGCACATGG - Intergenic
1124105779 15:26736728-26736750 CACATTGTGTGATGTGCAAATGG - Intronic
1125483831 15:40098742-40098764 GAAAGTGGGTGATGGGAGGAGGG - Intronic
1125503705 15:40254513-40254535 GAACATGTGTGATGTGCAGGGGG - Intronic
1126154226 15:45550215-45550237 GAGAGTGGGTGTTGTGGAGACGG + Intergenic
1126246870 15:46517788-46517810 GAATCTGTGTGATTTGGAGAGGG + Intergenic
1126262454 15:46710201-46710223 GAACTAGTATGATGTGCAGAGGG + Intergenic
1126426226 15:48529462-48529484 GAAAGAGTGTGGAGGGCAGATGG + Intronic
1126992867 15:54403149-54403171 TAACGTGTGTGATGTGCATGGGG - Intronic
1133456333 16:5945678-5945700 GAAGGGCTGTGCTGTGCAGAAGG - Intergenic
1133714749 16:8436769-8436791 GAAAGGCTGTGATGTGAAAAAGG - Intergenic
1134868113 16:17627049-17627071 GAAAGTGTTTAATGTTCACAGGG - Intergenic
1136998207 16:35206107-35206129 GAAATTATCTGATGTGAAGATGG + Intergenic
1137012857 16:35340853-35340875 GAAAGGGTGAGCTGTTCAGAGGG - Intergenic
1137275959 16:46933649-46933671 AAAAGTGGGTGATGCGTAGAAGG + Intergenic
1137438450 16:48477917-48477939 CAAAGTGTAAGATGTGAAGAGGG + Intergenic
1138607530 16:58098522-58098544 GAAAGAGTCTGACGAGCAGAGGG - Intergenic
1138770386 16:59655831-59655853 GATAGTGTGTGATTGGAAGAAGG - Intergenic
1139353450 16:66352514-66352536 GAATGTGTGTAATGTAAAGAGGG - Intergenic
1139353453 16:66352543-66352565 GAATGTGTGTAATGTAAAGAGGG - Intergenic
1139514459 16:67445107-67445129 GAAAGTGTGTTCTGGGAAGAGGG + Intronic
1141080670 16:81048737-81048759 GAAAGGCTTTAATGTGCAGATGG - Intergenic
1141505984 16:84479040-84479062 GAATGTGTGTGAGGAACAGATGG - Exonic
1143305194 17:5941059-5941081 GAAAGTTTGTAAAGGGCAGAGGG + Intronic
1144140291 17:12341328-12341350 GCAGATGTGTGATGTGCAGGTGG - Intergenic
1149408003 17:56374640-56374662 GACAGTGAGTGATGTGCTGCTGG - Exonic
1149536847 17:57439852-57439874 GATAGTGTGTGAGGGCCAGAGGG + Intronic
1149908399 17:60547821-60547843 GAAAGTGTGAGATAAGTAGAAGG - Intergenic
1151291367 17:73152765-73152787 GAAAGTGTCAGAAGTGGAGAAGG + Intergenic
1152474856 17:80511423-80511445 GATTGAGTGTGATGTGCATATGG - Intergenic
1154033985 18:10780611-10780633 TAAAGTGTGTGAGATGGAGAGGG - Intronic
1155353157 18:24926068-24926090 GCAAGTTTGGGATATGCAGAAGG + Intergenic
1155934978 18:31744406-31744428 GACAGTGTCTGATTTGCACAGGG + Intergenic
1156077276 18:33295088-33295110 GAAAGTGTGATATTGGCAGAGGG + Intronic
1157140188 18:45098029-45098051 GAAAGTGGGTGATTTGCAGTTGG - Intergenic
1157187459 18:45552727-45552749 ACAGGTGTGTGATGGGCAGAGGG + Intronic
1159860716 18:73646048-73646070 GGATGTGTGATATGTGCAGAGGG - Intergenic
1160123659 18:76151611-76151633 GAATGTGGGTGCTGAGCAGAAGG - Intergenic
1160767764 19:816033-816055 GTGGGTGTGTGATGTGTAGATGG - Intronic
1164783335 19:30910768-30910790 GAAAGTGTGAGGTGTGGAGCAGG - Intergenic
1164816607 19:31209002-31209024 TGAGGTGTGTGATGAGCAGAAGG + Intergenic
1166413251 19:42571480-42571502 GCAAGGGTGTGATATGAAGAGGG - Intergenic
1166709445 19:44927294-44927316 GAAAGTGGGTGATGGGGCGATGG + Intergenic
1167832651 19:52038645-52038667 GCAAGAGTATGATGTGCACAAGG - Intronic
1168416389 19:56171824-56171846 GAAACTGTGGGATGTGGTGATGG + Intergenic
925200031 2:1959675-1959697 GGAGGTGTGTGAGGGGCAGAGGG - Intronic
925504010 2:4540147-4540169 GAAAGTGTATGATGCGCTAAGGG + Intergenic
926172530 2:10561333-10561355 GGAAAGGGGTGATGTGCAGAGGG + Intergenic
926361223 2:12089409-12089431 CAAAGTGGGTGATGAGGAGATGG + Intergenic
926553188 2:14325328-14325350 TAAGGTGTGTGATGGGCAGGAGG + Intergenic
927055739 2:19364098-19364120 CAAAGTGAGTGATGGGCAGCAGG - Intergenic
927187448 2:20492021-20492043 GAAGCCATGTGATGTGCAGAAGG + Intergenic
928235160 2:29532963-29532985 GAAACTGGGTTATCTGCAGAAGG - Intronic
928986606 2:37188506-37188528 GAAAGTTTCTGAGGTGCACATGG + Exonic
930434340 2:51321336-51321358 GAAAGGGTGTCAAGTGCAAAGGG + Intergenic
934036544 2:88093095-88093117 GAAAGAGTTTGAAGTGCACATGG - Intronic
935696931 2:105778224-105778246 GCCAGTCTGTAATGTGCAGAGGG - Intronic
935857198 2:107288073-107288095 GAGAGTGTGTGATTTGCTGAAGG - Intergenic
936771891 2:115923728-115923750 GAAAGGGTGGGAGGTGGAGAGGG - Intergenic
937248240 2:120507748-120507770 GATAGTGTGAGATTGGCAGATGG - Intergenic
938079295 2:128360980-128361002 GAAGGTGTGTGATTTGCCCAAGG - Intergenic
938246009 2:129778567-129778589 GCAAGTGTGTGCTCTGCAGGGGG + Intergenic
938586516 2:132695800-132695822 AAAATTGTGTGATGTGTAAACGG - Intronic
938770649 2:134498289-134498311 GACAGTGTGGGATGAGGAGAAGG - Intronic
939194290 2:138953594-138953616 GCATGTGTGTAATGTGGAGAAGG + Intergenic
939365511 2:141225313-141225335 GAAAGTGTTTACTGTGCAGCTGG + Intronic
939401561 2:141701295-141701317 GAAAGTGAGTGATGTGTTCAGGG - Intronic
939728313 2:145751416-145751438 GAAAATGTGTGATCTACAGGAGG - Intergenic
941623286 2:167802992-167803014 AAAAATGATTGATGTGCAGATGG + Intergenic
942585699 2:177474465-177474487 GAATGTGTGTCTTGTGCAGGGGG - Intronic
944503950 2:200390608-200390630 GAATGTGTTTGATGAGCAGGTGG + Intronic
946887638 2:224239598-224239620 GAAAGTATGTGAGGAGTAGATGG - Intergenic
1168832182 20:852157-852179 GAGAGTGTGTTGTCTGCAGAGGG + Intronic
1169472087 20:5895272-5895294 GAAAGAATGTCATGTGAAGAGGG - Intergenic
1169653324 20:7893951-7893973 GAAAGAGTGAGATGTGCTCAGGG - Intronic
1170067181 20:12325495-12325517 GACAGTGTGTAATGTTCAAAAGG + Intergenic
1170342309 20:15342852-15342874 GAATCTGTGTGAAGAGCAGAGGG + Intronic
1171112805 20:22499994-22500016 GAAAGTGGGTGGTGTGCATAGGG + Intergenic
1172435253 20:34924491-34924513 GTAAGAGTGTTTTGTGCAGAGGG + Intronic
1173647069 20:44639977-44639999 GAGGGTGTGTGGTATGCAGAAGG + Intronic
1174611602 20:51802087-51802109 AAAAGTGTGAAATGTGCAAAAGG + Intronic
1175506666 20:59490880-59490902 GGAAGTCTGGGATGCGCAGAGGG - Intergenic
1176991216 21:15498502-15498524 GAAATTGGTTGATGTGAAGAAGG - Intergenic
1177064849 21:16417636-16417658 GATAGTGGGTGATTTGTAGATGG + Intergenic
1178510789 21:33203216-33203238 GTATGTGTGTGGTGTGCATATGG - Intergenic
1179918390 21:44493280-44493302 GAAAGGGTGAAATGAGCAGAGGG - Intergenic
1181176926 22:21043224-21043246 GAAGGTGAGGGCTGTGCAGAGGG + Intergenic
1181544109 22:23591304-23591326 GTAAGTGTGTGACCTGCAGCGGG - Intergenic
1181975561 22:26726887-26726909 GAAAGGGTGTGCTGGGCTGAGGG + Intergenic
1182899766 22:33888100-33888122 GAAAGAGAATGAAGTGCAGAGGG - Intronic
1182924462 22:34109294-34109316 GAAAGGGGGTGATAAGCAGAAGG - Intergenic
1183040612 22:35175048-35175070 GAAAGGGTGTGATGTGAGAAGGG - Intergenic
1183754086 22:39742838-39742860 GAAACTGAGTGATGGGCACATGG + Intergenic
1184071989 22:42152328-42152350 GCCAGTGGGTGATGGGCAGAGGG - Intergenic
1184876693 22:47280668-47280690 GAAACAGTGGGATGTGCGGATGG + Intergenic
1184900870 22:47445691-47445713 GAAAGTGTGGGATGTGCAAGCGG - Intergenic
949617013 3:5764970-5764992 GAAAGTTTGTGATGTCTATATGG + Intergenic
955257652 3:57350135-57350157 GAAAGTGTGGGGGGTGGAGAGGG + Intronic
955393304 3:58536691-58536713 GAAAGGGTGTTCTGGGCAGATGG - Intronic
955532399 3:59887698-59887720 GAAAGTGTAGGATGTGCTGCTGG - Intronic
955631204 3:60977536-60977558 AAAAGTGTGTGCTGAGCAGTGGG + Intronic
955902651 3:63773912-63773934 GAAAGTGTATAATCTCCAGAGGG + Intergenic
955981554 3:64532502-64532524 GAAACACTGTGCTGTGCAGATGG - Intronic
956039625 3:65132338-65132360 TAAAATGTGTGATTTGCAGATGG + Intergenic
956343068 3:68248123-68248145 GAAAGTCAGTTATGTACAGAAGG - Intronic
956396705 3:68833720-68833742 GAAAGTGTTTGTTGTGGATAGGG - Intronic
959813730 3:110650783-110650805 GAAAATGTGTTGTGTGCTGAGGG + Intergenic
960146996 3:114214078-114214100 CAATGTGAGTGCTGTGCAGATGG - Intergenic
961004361 3:123395065-123395087 GGCCTTGTGTGATGTGCAGAAGG + Intronic
961631427 3:128301764-128301786 GAAAGAGACTGGTGTGCAGAAGG + Intronic
962254600 3:133861746-133861768 GAAAGTGTGGGATGGAAAGAGGG + Intronic
966351361 3:179035505-179035527 GAGTGTGTGTGGTGTGGAGAGGG - Intronic
966687498 3:182711890-182711912 GAAACTGTGTGTTGGGGAGATGG - Intergenic
968021442 3:195394184-195394206 GAATGTGTGTGAGGTGCTGGAGG - Intronic
968416789 4:444277-444299 GAACGTGTGTAAAGTGCAGAAGG - Exonic
970382934 4:15526108-15526130 TGAAGTCTGGGATGTGCAGAGGG - Intronic
971761041 4:30765731-30765753 GAGAGTGTGAGCTGTGCAGGTGG + Intronic
973329746 4:48901021-48901043 GAATGGTTGTGATGGGCAGAGGG - Intronic
974532529 4:63128273-63128295 GAAGTTGTGTGGTGTGAAGATGG - Intergenic
975490197 4:74979739-74979761 TAAACTTTTTGATGTGCAGATGG - Intronic
975491494 4:74994115-74994137 GAATTCGTGTGATGTGTAGAAGG + Intronic
975498855 4:75062870-75062892 GAAAGGATGTCTTGTGCAGATGG - Intergenic
977005548 4:91565070-91565092 GTGTGTGTGTGATGTGAAGAAGG + Intronic
977947310 4:102928529-102928551 GGAGCTGTGTAATGTGCAGAGGG - Intronic
978230944 4:106398117-106398139 GTATGTGTGTGATGTGAAGAGGG + Intergenic
979601888 4:122594375-122594397 GAAAGTGTGACATGCGGAGAGGG - Intergenic
979833436 4:125330156-125330178 GAAAGGGTGTTCTATGCAGAAGG - Intronic
979835219 4:125358618-125358640 TAAAGTGAGTGATGGGAAGATGG + Intronic
981034661 4:140156912-140156934 GAAACTGTGTGATGGCCAGAGGG + Intergenic
981748059 4:148069583-148069605 GCAAGTGTGTGGTGTGTATAGGG + Intronic
984474427 4:180217613-180217635 GACAGTGGCTGATGAGCAGATGG - Intergenic
984606915 4:181796369-181796391 AAAAGTTTGTGATGTTCAGTGGG + Intergenic
984743127 4:183186777-183186799 GAAAGTCTGTCATGTGGAGGAGG + Intronic
987192735 5:15495769-15495791 GTATGTGTGTGAAGTGCAAACGG + Intergenic
987201808 5:15584661-15584683 GAAATTGGGTAATGGGCAGAGGG - Intronic
987255987 5:16151507-16151529 GAAAGTGTGGGATGTGGCAAGGG - Intronic
988661691 5:33277240-33277262 GGAAGTGGGTGATGGGAAGAAGG - Intergenic
988775581 5:34475469-34475491 GACAGTGTGTGATTTACATAGGG - Intergenic
988990115 5:36662319-36662341 CAAAGTGTGTGTTGGGCAGTGGG - Intronic
990649605 5:57883331-57883353 GAAAGTCTGGGATATGAAGAAGG + Intergenic
990698709 5:58452053-58452075 GAAAGTAGATGAGGTGCAGAAGG - Intergenic
991622661 5:68561549-68561571 GGCAGTGTCTGATTTGCAGAGGG - Intergenic
991971698 5:72147695-72147717 GAAGGTGAGTGGTGTGCTGATGG + Intronic
993190327 5:84672233-84672255 GAAACTGTGTGAGGTGCTGCTGG + Intergenic
993698873 5:91094741-91094763 GAAAAAGTGTGATGAGAAGAGGG + Intronic
994344188 5:98665009-98665031 GAAAGGGTGTGCTGTGCTGGGGG - Intergenic
995596990 5:113757854-113757876 GAAAGTCAGTGAGGTTCAGAAGG + Intergenic
995841178 5:116444810-116444832 GCACGTGTGTGCTGTGCACATGG + Exonic
997522303 5:134530773-134530795 GAAAATGTGTGAGGTTAAGACGG + Intronic
997714734 5:136033766-136033788 CAACGTGTGTGCTGTGCAGAAGG + Exonic
999105437 5:149066844-149066866 GAAAGTGTTTCAAGAGCAGAAGG + Intergenic
1000428984 5:161128072-161128094 TAAAGTGTGTGTTGTGGGGAGGG - Intergenic
1000551590 5:162672436-162672458 GAATGTGTGTGTTTTTCAGAAGG - Intergenic
1001304590 5:170562455-170562477 GAAAGTGCTTGATGTGTAGCAGG + Intronic
1002477675 5:179477776-179477798 GAAACTGTGTGAAGTGTAAATGG - Intergenic
1002849584 6:982013-982035 TAGAGTGTGTGATATGCTGATGG + Intergenic
1003056304 6:2824029-2824051 GAACGTGTAGGATGTGAAGAGGG - Intergenic
1003439951 6:6131150-6131172 GAAAGAGTGTGAGGGGCTGAAGG - Intergenic
1005140111 6:22622335-22622357 GATAGTGTGTGTTGTCCAGTTGG + Intergenic
1006129033 6:31857791-31857813 GCAAGTGTGTGAAATGCAGATGG - Intronic
1007252416 6:40504997-40505019 TAGAGTGTGTGATGTGATGATGG + Intronic
1007401270 6:41603959-41603981 GAAGGTGTGTGCTGTGCATGAGG - Intergenic
1008181066 6:48329926-48329948 GAAAGTGAGTGAGAGGCAGAAGG + Intergenic
1008649323 6:53547312-53547334 AAAAGTGTATGGTGTGCAGCAGG - Intronic
1008793455 6:55269231-55269253 GAAAATGTTTTATGTGCAAATGG - Intronic
1009163342 6:60309895-60309917 GACAGTGTCTGATTTGCATATGG + Intergenic
1010826303 6:80480606-80480628 GAATGTGTGGGATGTGAAGTAGG - Intergenic
1010973304 6:82286041-82286063 GAAGGTGTGGAATGGGCAGAAGG + Intergenic
1011755468 6:90494338-90494360 GAGAGTGTGAGGTGGGCAGAGGG - Intergenic
1013395339 6:109731465-109731487 TAAAGTGTGTCATGTGTAGTTGG + Intronic
1013606889 6:111758934-111758956 GAGAGTGTGTGAGGGGCAGTGGG - Intronic
1013711239 6:112902084-112902106 GAAAATGTTTGAAGTGCTGAAGG + Intergenic
1015159481 6:130136436-130136458 GGAAGAGTGTTCTGTGCAGAAGG - Intronic
1015612500 6:135039660-135039682 GAACAAGTTTGATGTGCAGAAGG - Exonic
1017247796 6:152245859-152245881 GAAAGTGTGTTCTCTGGAGAAGG + Intronic
1018417728 6:163615765-163615787 GACAGTGTGTGTTCTACAGAGGG + Intergenic
1019266906 7:122486-122508 AAAAGTGTGTGATTTGAAGCAGG + Intergenic
1019377264 7:699471-699493 GACAGTGTGTGATGGACTGAGGG - Intronic
1019788040 7:2991913-2991935 GAAAGGGTGGGATGGGGAGAGGG - Intronic
1020557094 7:9683834-9683856 GAAAATGTGTGACATGTAGAGGG + Intergenic
1020639353 7:10736085-10736107 GAAAGTGGGTGATGTATTGAGGG - Intergenic
1020924633 7:14310210-14310232 TAAAGAGTGTGTTGTGGAGAAGG + Intronic
1021926872 7:25542286-25542308 GAAAGAGTGTTCTGGGCAGAGGG - Intergenic
1022972562 7:35530946-35530968 GGTAGGGTGTGATGTGGAGAGGG - Intergenic
1023145659 7:37148125-37148147 AAAATTGTGTGATGAGAAGAAGG - Intronic
1023710725 7:42989675-42989697 GAGAGTGTCTGATCTGAAGATGG - Intergenic
1024646842 7:51378025-51378047 GAAAGTGAGTGATATGGATATGG - Intergenic
1028220153 7:88187941-88187963 GAAAGTGTGGGACAAGCAGAGGG - Intronic
1029598690 7:101551144-101551166 GTAAGTGTGGGCTGTGCAGATGG + Intronic
1030597432 7:111556886-111556908 GCAAGTGTGAGATGTCTAGAAGG - Intronic
1031006275 7:116475983-116476005 GAAAGTGTGTGAGGGGGTGAGGG + Intronic
1031256290 7:119453571-119453593 GAACATGTGTGCTGTGAAGATGG + Intergenic
1032302540 7:130701265-130701287 GAAACTGTTTAATGTGCAAAAGG - Intergenic
1035190506 7:157163429-157163451 GAAACTGGGTGATGTGGACAGGG - Intronic
1036964717 8:13283905-13283927 CAAAGAGTGAGATCTGCAGAGGG + Intronic
1037821454 8:22137161-22137183 GAGAGTGTGGGATGAGAAGAGGG - Intergenic
1037976850 8:23219967-23219989 GAAAGTGTGTGCAGCTCAGAGGG - Intronic
1038596619 8:28891326-28891348 GAGATGGTGTGATGTGGAGATGG + Intronic
1039658246 8:39433633-39433655 GAAAGAGTGTGCTGTGCTGGGGG - Intergenic
1041932630 8:63303959-63303981 GAAAGCTTGTGAAGTTCAGAAGG + Intergenic
1042208595 8:66354092-66354114 GAAACTGGGTGATATCCAGATGG - Intergenic
1043294749 8:78648667-78648689 GAATATGTGTGATGTAAAGAGGG - Intergenic
1045699028 8:104845056-104845078 GAATTTGTTTCATGTGCAGATGG + Intronic
1046782723 8:118232687-118232709 GTATGTGTGTGGTGTGCTGAGGG + Intronic
1047618147 8:126580285-126580307 GCAAGTGTTTGCTGGGCAGAAGG - Intergenic
1048829783 8:138464846-138464868 GACACTGTCTGTTGTGCAGAGGG - Intronic
1049440222 8:142606214-142606236 TAAAGTCTGTGAGGTCCAGAGGG - Intergenic
1049855170 8:144857203-144857225 GAAGGAGTGTGATTTGCAGATGG + Intergenic
1049945055 9:586356-586378 GATAGGCTGTGATCTGCAGAGGG + Intronic
1050555403 9:6785292-6785314 GAAAGAGTGCCATGTGAAGATGG - Intronic
1050737518 9:8780900-8780922 GCAAATCTGTGATGTGCAGAAGG - Intronic
1050829909 9:9997983-9998005 GAAGGTGTCTGATTTGCATATGG - Intronic
1052774690 9:32721699-32721721 GAAAGTGTGGCATGGGCAGAAGG - Intergenic
1052881218 9:33601901-33601923 GCAAGAATGTGATGTGAAGAGGG + Intergenic
1052977067 9:34419204-34419226 GAAGGTGTGTGGTGGGCAGTGGG + Intronic
1059502788 9:114769558-114769580 GCATGTGTGTGGTGTGCAGTTGG + Intergenic
1059585404 9:115600797-115600819 GAGAGTGTGAAATGTGGAGAAGG + Intergenic
1185752692 X:2626884-2626906 GCAAGTGTGGCATGTGCAAAGGG + Intergenic
1185794456 X:2953046-2953068 GAAAGTGGGTGAGGTGCTGTGGG - Intronic
1186550637 X:10501388-10501410 GAAGGTATGTGCTGAGCAGATGG - Intronic
1187035419 X:15533676-15533698 AAAAGTGTTTTATGTGGAGAAGG + Intronic
1187429712 X:19211093-19211115 GAGAGGAGGTGATGTGCAGAAGG + Intergenic
1187991786 X:24881994-24882016 GAAGGTGTGTGATTGGGAGATGG + Intronic
1190832018 X:54067264-54067286 CTAAGTGTGTGCTGTGCAGTAGG + Intergenic
1190879089 X:54479943-54479965 TCAAGTGTGAAATGTGCAGAAGG + Intronic
1191614099 X:63149430-63149452 GAAAGTATTTTATGTGCAGATGG - Intergenic
1191622197 X:63229497-63229519 GAAAGTATTTTATGTGCAGATGG + Intergenic
1192159764 X:68775686-68775708 GGAAGGGTGTGTTGTGTAGAAGG + Intergenic
1192244866 X:69363665-69363687 GAAAGGCTGTCATGAGCAGAGGG + Intergenic
1192507807 X:71700152-71700174 GAATATGTGTGATGTAAAGAGGG - Intergenic
1192518889 X:71781400-71781422 GAATATGTGTGATGTAAAGAGGG + Intergenic
1195405522 X:104508972-104508994 GAAAGCATGTGATGTGCTTAAGG + Intergenic
1195716692 X:107825636-107825658 AAATGTGTGTGAAATGCAGAAGG - Intergenic
1199256543 X:145724552-145724574 GAAACTTTGTTATATGCAGATGG - Intergenic
1201310725 Y:12596354-12596376 GAAAGTGGGTGCTGGGGAGAGGG + Intergenic