ID: 907268046

View in Genome Browser
Species Human (GRCh38)
Location 1:53274738-53274760
Sequence GGAAAGTGTGTGATGTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268046_907268054 20 Left 907268046 1:53274738-53274760 CCTCTGCACATCACACACTTTCC 0: 1
1: 0
2: 3
3: 29
4: 311
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224
907268046_907268052 18 Left 907268046 1:53274738-53274760 CCTCTGCACATCACACACTTTCC 0: 1
1: 0
2: 3
3: 29
4: 311
Right 907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 155
907268046_907268053 19 Left 907268046 1:53274738-53274760 CCTCTGCACATCACACACTTTCC 0: 1
1: 0
2: 3
3: 29
4: 311
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268046 Original CRISPR GGAAAGTGTGTGATGTGCAG AGG (reversed) Intronic
900964929 1:5951295-5951317 GAAAAGGGTGTGACGTGAAGAGG + Intronic
901603225 1:10438661-10438683 GGAGAGTCTGTGATATGCAGTGG + Intronic
901757163 1:11448414-11448436 GGCTGGTGTGTGGTGTGCAGAGG + Intergenic
902281639 1:15379003-15379025 GGAAAGGGTCTGAAGTGAAGGGG + Intronic
902633179 1:17718031-17718053 GGAAAGTGGGGGAGGTGCTGGGG + Intergenic
902679559 1:18033542-18033564 ATAAAGTGTGTGGGGTGCAGGGG + Intergenic
902700068 1:18166369-18166391 GGAAAGGGTGTGATGGGCTTTGG + Intronic
903320041 1:22537590-22537612 GCGAAGTGTGTGATGGGAAGTGG - Intergenic
904013566 1:27404068-27404090 GGAAAGTGCATTGTGTGCAGAGG - Intergenic
904307445 1:29599247-29599269 GGCAAGTGAGTGATGATCAGAGG + Intergenic
904798421 1:33075045-33075067 GGAAAGTGTATATAGTGCAGAGG + Intronic
905265706 1:36753130-36753152 GGAAAGTGAGTGGAGTTCAGGGG - Intergenic
905363341 1:37435108-37435130 GGCAAGTATGTAATGTTCAGGGG - Intergenic
905622119 1:39457440-39457462 GGTAAGTGTGGGATGGGGAGTGG - Intronic
905931479 1:41790973-41790995 GGAAAGGGTGAATTGTGCAGAGG - Intronic
906436680 1:45802696-45802718 GCACAGTGTGTGGTATGCAGTGG + Intronic
907268046 1:53274738-53274760 GGAAAGTGTGTGATGTGCAGAGG - Intronic
907864993 1:58390866-58390888 GGAAAGTGTCTGGCATGCAGTGG + Intronic
910108746 1:83659431-83659453 GAAAAGTGGGTGATGTTAAGAGG + Intergenic
910190055 1:84585897-84585919 GGAATGTGTGCCTTGTGCAGTGG - Intergenic
910226583 1:84942246-84942268 GGTCAGTGTCTGTTGTGCAGAGG - Intronic
910469037 1:87531091-87531113 GTAATGTGAGTGATGGGCAGTGG - Intergenic
912638647 1:111322460-111322482 GAAAAGTGTGTTTTGGGCAGAGG + Intergenic
913708643 1:121455604-121455626 GGAAAATGTGTGTTAGGCAGTGG + Intergenic
914955735 1:152160510-152160532 GGTAAGTCTGTGTTGAGCAGAGG + Intergenic
915353015 1:155238225-155238247 GCCAAGTGGGTGATGTCCAGGGG + Exonic
915614018 1:157021134-157021156 GGAAAGAGAGTGATGTGATGGGG + Intronic
916012915 1:160722980-160723002 GGATTGTGTGTGATGTAAAGAGG + Intergenic
918047173 1:180948594-180948616 GAGAAGTGTCTGATGTGCTGTGG - Exonic
918111438 1:181458323-181458345 GGAAACTGTGGGAAATGCAGAGG - Intronic
919412115 1:197258565-197258587 GGAAAGAGAGTGATGAACAGTGG - Intergenic
920757974 1:208753345-208753367 GGGAAGTGTGTTTTGTGCAGAGG + Intergenic
921521820 1:216165952-216165974 GGAAAGTGTGGGATGGGGTGAGG - Intronic
922199510 1:223390022-223390044 GGAGAGTGTGTGCAGTGAAGTGG - Intergenic
922893006 1:229076062-229076084 GGAAATTCTGTGGTGTGTAGAGG + Intergenic
923046307 1:230358186-230358208 GGAAAGCGTGGGGTCTGCAGGGG - Intronic
1063368148 10:5503956-5503978 GGGAGGTGTGTGGTGTGTAGGGG - Intergenic
1063368158 10:5503996-5504018 GGGAGGTGTGTGGTGTGTAGGGG - Intergenic
1063368163 10:5504016-5504038 GGGAGGTGTGTGGTGTGTAGGGG - Intergenic
1063368168 10:5504036-5504058 GGAAGGTGCGCGGTGTGCAGGGG - Intergenic
1063368174 10:5504060-5504082 GGAAGGTGTGTGGTGTGTAGGGG - Intergenic
1063368190 10:5504124-5504146 GGAAGGTGTGTGGTGTGTAGGGG - Intergenic
1063845057 10:10118548-10118570 GGAAAGCCTATGATGTGCTGTGG - Intergenic
1067090644 10:43264463-43264485 AGCAAGGGTGTGATGTGCGGAGG - Intronic
1069728353 10:70595613-70595635 AGAGAGAGTGAGATGTGCAGAGG + Intergenic
1069848785 10:71391513-71391535 GCAAGGAGTGTGCTGTGCAGAGG - Intergenic
1070154965 10:73827687-73827709 GGCAACTGTGTGGTGGGCAGAGG - Intronic
1070767239 10:79063827-79063849 GGAGAGTTTGTGATGTGCTCAGG + Intergenic
1071400267 10:85261821-85261843 GGAAGGTGGGTGATATGCAATGG + Intergenic
1071423012 10:85520234-85520256 GGAAAGTGTCAGGTGTGAAGTGG - Intergenic
1071713774 10:88074751-88074773 GGCATGTGTGTGATGGGGAGGGG + Intergenic
1073422596 10:103436581-103436603 GGCATGTGTGTGCCGTGCAGTGG - Intronic
1073624181 10:105079458-105079480 AGAAAGTTTGTGATGTGAATTGG + Intronic
1073944156 10:108730911-108730933 GGCACCTGTGAGATGTGCAGAGG + Intergenic
1074106006 10:110390147-110390169 AGAAAGAGTGTGATGTGAATGGG + Intergenic
1074298264 10:112210815-112210837 AGACACTGTGTGCTGTGCAGAGG + Intronic
1074499951 10:114014251-114014273 GGAAATTGTGTGATGGGAAAGGG - Intergenic
1076377183 10:129999007-129999029 GGATAGTGGGTGATGGGGAGTGG + Intergenic
1076851169 10:133093881-133093903 TCAAAGTGGGTCATGTGCAGTGG - Intronic
1076875121 10:133212032-133212054 TGGATGTGTGTGATGTGCACAGG - Intronic
1078141630 11:8697420-8697442 AGAAAGGGTTTGGTGTGCAGAGG + Intronic
1078366330 11:10709452-10709474 GCAAAGTGTGTGGTGTTCAGTGG - Intergenic
1079270656 11:18982823-18982845 GGCACCTGTGAGATGTGCAGAGG + Intergenic
1080145202 11:28974137-28974159 GTAAAGTGTGAAATGTGAAGTGG - Intergenic
1080420097 11:32102136-32102158 GGAAAGTGTGTGGTGGGGGGTGG + Intronic
1081514997 11:43820112-43820134 GGGAGGTGAGTGATGTGCAGTGG + Intronic
1081572034 11:44297808-44297830 AGCAAGTGTGTGGAGTGCAGGGG - Intronic
1081580012 11:44345808-44345830 GTAAAGTGTGGGAGGTGGAGAGG - Intergenic
1082568972 11:54714559-54714581 GGAAAGTGGGTGCAGTGTAGTGG - Intergenic
1082790373 11:57342783-57342805 GGAAGGTGTGAGCTGGGCAGAGG - Intronic
1083724103 11:64619432-64619454 GAGAAGTGTGGGATGTGGAGTGG - Intronic
1084785277 11:71438378-71438400 AGAAAGTGTGTGCTGAGCTGGGG - Intronic
1085840417 11:80005426-80005448 GGCCAGAGTGTGATGTGGAGAGG - Intergenic
1086301565 11:85431779-85431801 GGAGAGTGTGTGCTGTGCTGGGG - Intronic
1089387586 11:118078372-118078394 GGGAAGGGTGTGACCTGCAGGGG + Intronic
1090197260 11:124827297-124827319 GGAAAGGGTGTTCTGGGCAGAGG - Intergenic
1090254546 11:125274274-125274296 TGAAAGTATGTGTGGTGCAGTGG - Intronic
1090806002 11:130202613-130202635 GGGAGGTGTGAGATGTGCAGGGG + Intronic
1092192372 12:6530275-6530297 GGGAAGGCTGTGATGTGTAGGGG - Intronic
1094111326 12:26865948-26865970 GGAAAGAGTGTGGGCTGCAGGGG + Intergenic
1095320339 12:40819212-40819234 GGAAAGGGTGTGTTTTGCTGGGG + Intronic
1096578445 12:52569419-52569441 GGAACATGTGTGGGGTGCAGAGG - Intronic
1097455751 12:59796488-59796510 GGAAGGGGTGTGCTGTGCTGAGG - Intergenic
1097764066 12:63503504-63503526 GGAAAGGGTATGAGGTGAAGGGG - Intergenic
1098201789 12:68064013-68064035 GGAATGGGTGTGCTGTGCTGGGG + Intergenic
1100586926 12:95989062-95989084 GGGAAGTGGGTGGGGTGCAGTGG + Intronic
1102105354 12:110316826-110316848 GCATAGTGTGTGATGCTCAGAGG + Intronic
1103399165 12:120631022-120631044 GGAAAGTGGCTGATGTGCTCTGG + Intergenic
1104869025 12:131981228-131981250 GCAACGTGTGTGACGGGCAGAGG - Intronic
1104878900 12:132055661-132055683 GGTATGTGTGTGAGGTGTAGGGG + Intronic
1106351689 13:28936835-28936857 GGAAAGTGTGCAGTGGGCAGGGG + Intronic
1106544317 13:30717082-30717104 GGACTGTGAGTGATGTGTAGCGG - Intronic
1107189270 13:37560072-37560094 GGCACCTGTGAGATGTGCAGAGG + Intergenic
1108773130 13:53730068-53730090 AGAAAGAGAGTGATGTGAAGTGG - Intergenic
1111200837 13:84933884-84933906 AGAAATTGTGTGATGTGAGGTGG + Intergenic
1111393338 13:87628537-87628559 TTAAAGTGGGTCATGTGCAGTGG - Intergenic
1112039834 13:95535730-95535752 GGAAAGACTGTGATGTGAAAAGG + Intronic
1113610226 13:111639434-111639456 GGAAAGAGTGCAATGCGCAGAGG + Intronic
1113804746 13:113106456-113106478 GGAAAGTGTGTGGGGTGTGGGGG + Intronic
1113876396 13:113597443-113597465 GGAACCTGTGTGATGTGTTGTGG + Intronic
1114543627 14:23482583-23482605 GGAAAGGGTGGGCTGTGAAGGGG + Intronic
1115916653 14:38322277-38322299 TGGAACTGTGTAATGTGCAGAGG - Intergenic
1120290686 14:82566443-82566465 GGAAAGTGTGTGAGGCGGAAGGG - Intergenic
1120933564 14:89872404-89872426 GGAAAGAGTGCCTTGTGCAGGGG + Intronic
1121513839 14:94535845-94535867 AGAAAGGGTGTGATCTTCAGAGG - Intergenic
1121731548 14:96190721-96190743 GCAAAGTGTGTGGTGGGGAGGGG + Intergenic
1124138005 15:27052008-27052030 GTAATGTGAGTGATGGGCAGCGG + Intronic
1124142246 15:27087922-27087944 GGTGTGTGTGTGATGTGCTGTGG + Intronic
1124142253 15:27088082-27088104 TGAGTGTGTGTGATGTGCCGTGG + Intronic
1125036225 15:35127314-35127336 GGAAAGTGTGCGAAGTGCAGAGG + Intergenic
1125483832 15:40098743-40098765 GGAAAGTGGGTGATGGGAGGAGG - Intronic
1125503706 15:40254514-40254536 TGAACATGTGTGATGTGCAGGGG - Intronic
1126992868 15:54403150-54403172 ATAACGTGTGTGATGTGCATGGG - Intronic
1127860442 15:62989477-62989499 GGGCAGTGTGTGCTGTGCTGAGG - Intergenic
1127923496 15:63514658-63514680 GGAAAGTCTTTGATGTTAAGAGG + Intronic
1128733286 15:70035041-70035063 GGGCAGTGTGGCATGTGCAGAGG - Intergenic
1130336377 15:82960383-82960405 GGGAAGTGTGTGTTGAACAGAGG + Intronic
1130918554 15:88324904-88324926 GGAAAATGTGTGATGTACTACGG + Intergenic
1133812872 16:9174801-9174823 GGAAGGTGTGGGATGCTCAGTGG - Intergenic
1134837952 16:17377555-17377577 GGAATGTGTTTGTTGGGCAGGGG - Intronic
1139582723 16:67882928-67882950 GGGAAGTGAGTGAGGTGAAGTGG - Intronic
1143450420 17:7033283-7033305 TGGAAGTGGGTGATGGGCAGAGG - Intergenic
1144645611 17:16971729-16971751 GGAAAATGGGGGCTGTGCAGGGG + Intronic
1145019443 17:19417980-19418002 GGGAAGTGTGTGGTGGGCAGAGG + Intergenic
1147457550 17:40547650-40547672 GGCAAGTGTGTGAGGGGCTGAGG - Intergenic
1148909464 17:50932960-50932982 GGGAAGTCTGTGGTGTGCTGTGG - Intergenic
1149377890 17:56064260-56064282 GGAAGGGGTGTGCTGTGCTGGGG + Intergenic
1149536846 17:57439851-57439873 GGATAGTGTGTGAGGGCCAGAGG + Intronic
1150557621 17:66268486-66268508 GAAAAGTATGTGCTGTGAAGTGG - Intergenic
1151282514 17:73087584-73087606 GGTGAGTGTGGGTTGTGCAGAGG + Intronic
1151508952 17:74546673-74546695 GGACAGTTTGTCATGAGCAGCGG + Intergenic
1152877380 17:82794654-82794676 AGAAAGTGTGCAGTGTGCAGTGG - Intronic
1153564085 18:6401820-6401842 GGCAAGTGTGCGGTGTGCAAGGG + Intronic
1153642250 18:7167217-7167239 GAAAAGTGAGTGACATGCAGGGG - Intergenic
1153913636 18:9725810-9725832 GGAATGTATGAGATGTGCAGAGG + Intronic
1153959743 18:10130691-10130713 GGAAAGGGGGTGATATGAAGGGG + Intergenic
1156739754 18:40309886-40309908 GGATAGTCTGTGATCTGAAGTGG - Intergenic
1157120973 18:44910874-44910896 GAAAAGGGTGTGAGGGGCAGGGG - Intronic
1158808583 18:61004753-61004775 GGAAAATGTGAGATGAGCAGAGG - Intergenic
1159542386 18:69794739-69794761 GGAATGTGAGTGATGGGGAGCGG - Intronic
1160055195 18:75472285-75472307 AGAAAGTGCGTGGTGAGCAGGGG + Intergenic
1160594130 18:79962564-79962586 GGAAAGTGGCTGCTGTGCTGTGG - Intergenic
1161016642 19:1986750-1986772 GGAGAGTGTGTGCTGTGCCCCGG + Intronic
1163491064 19:17617467-17617489 GGAAAATCTGTGATGTCCTGGGG - Intronic
1164435223 19:28222938-28222960 GGGCAGTGTGTGCTGTGCACAGG - Intergenic
1164670097 19:30067538-30067560 CGAAAGTGTGTTGTGGGCAGTGG + Intergenic
1164794500 19:31015070-31015092 GAAAAGTGTGTGATGGCCGGTGG + Intergenic
1164819753 19:31239103-31239125 GGGAAGTGTGAAATGTGAAGAGG - Intergenic
1165963882 19:39558363-39558385 AGAAAGTGTGTGATGGAAAGAGG + Intergenic
1166413252 19:42571481-42571503 GGCAAGGGTGTGATATGAAGAGG - Intergenic
1166424431 19:42663125-42663147 GGACAGTGAGTGATATGCAATGG + Intronic
1167726587 19:51217344-51217366 CGAAAGAGTGAGATGTTCAGAGG - Intergenic
1167836299 19:52074439-52074461 GAAAAGTGTGGCATGAGCAGTGG + Intronic
925504009 2:4540146-4540168 GGAAAGTGTATGATGCGCTAAGG + Intergenic
926989636 2:18663896-18663918 GACACGTGTGTAATGTGCAGAGG + Intergenic
928229261 2:29482248-29482270 GGACAGTGTGCCATGAGCAGGGG + Intronic
930482401 2:51965445-51965467 GGAGTTTGTGTGTTGTGCAGTGG - Intergenic
931138027 2:59426511-59426533 GGAAAGGGTGTGAGGTTCACAGG - Intergenic
931712033 2:64996472-64996494 TGAAAGTGGGTGATGTGCAGAGG + Intronic
933794473 2:85908449-85908471 GGAAAGTGGAAAATGTGCAGGGG + Intergenic
935576830 2:104719695-104719717 GGCAAGAGAGGGATGTGCAGGGG - Intergenic
935696932 2:105778225-105778247 GGCCAGTCTGTAATGTGCAGAGG - Intronic
936093381 2:109514914-109514936 GGGAAGTGTGTGAGGGGCATGGG - Intergenic
937981247 2:127617143-127617165 GGTACCTGTGAGATGTGCAGAGG - Intronic
938133233 2:128734875-128734897 GGAAAGGGAGTGATATGCTGTGG - Intergenic
938229275 2:129644302-129644324 GGAAAGTGTCTTATGTTCTGTGG + Intergenic
938246008 2:129778566-129778588 TGCAAGTGTGTGCTCTGCAGGGG + Intergenic
939383375 2:141465277-141465299 AAAAAGTGTGGGATATGCAGTGG + Intronic
939924832 2:148160006-148160028 TGAAAGTGTGTGATGCACACTGG + Intronic
941248032 2:163125183-163125205 TGACAGTGTGTGAAGTGCTGGGG + Intergenic
941547327 2:166868310-166868332 GTAATGTGAGTGATGGGCAGTGG - Intergenic
942540432 2:177009668-177009690 GGAAGCTGTGTGTTGTGCAATGG + Intergenic
942585700 2:177474466-177474488 GGAATGTGTGTCTTGTGCAGGGG - Intronic
944881932 2:204022063-204022085 AGGAAGAGTCTGATGTGCAGTGG + Intergenic
945933491 2:215880140-215880162 GGAATGTGAGTGATGGGGAGCGG + Intergenic
947319172 2:228897360-228897382 GGATAGTGTGTGCCGTGAAGAGG - Intronic
947401517 2:229735815-229735837 GGATAGTGTGTAATCTGCTGGGG - Intergenic
1169472088 20:5895273-5895295 GGAAAGAATGTCATGTGAAGAGG - Intergenic
1169653325 20:7893952-7893974 GGAAAGAGTGAGATGTGCTCAGG - Intronic
1169804979 20:9550139-9550161 GGCCTGTGTGGGATGTGCAGGGG + Intronic
1171112804 20:22499993-22500015 AGAAAGTGGGTGGTGTGCATAGG + Intergenic
1173356947 20:42302432-42302454 GGAAAGTGTATGTTTTGCAAAGG - Intronic
1175444844 20:59013020-59013042 GGTAAGTGTGTGATGCACTGGGG + Intergenic
1175506667 20:59490881-59490903 GGGAAGTCTGGGATGCGCAGAGG - Intergenic
1178304975 21:31483937-31483959 TGAAAGTGTGAGTTCTGCAGGGG - Intronic
1178460064 21:32794888-32794910 GGAAAGCATGTCATGTTCAGGGG - Intronic
1179484155 21:41699027-41699049 AGAAATTGTGTGATGTGGTGAGG - Intergenic
1180646359 22:17342347-17342369 GGAAAGTGTGTATTGTTCAGAGG + Intergenic
1181176925 22:21043223-21043245 GGAAGGTGAGGGCTGTGCAGAGG + Intergenic
1181427654 22:22854966-22854988 AGAAAGTGTGTGGTGTGGGGAGG - Intronic
1181544110 22:23591305-23591327 TGTAAGTGTGTGACCTGCAGCGG - Intergenic
1181682908 22:24508158-24508180 GGAAGCTGTGTGATGTGATGGGG - Intronic
1181975560 22:26726886-26726908 GGAAAGGGTGTGCTGGGCTGAGG + Intergenic
1183040613 22:35175049-35175071 GGAAAGGGTGTGATGTGAGAAGG - Intergenic
1183046368 22:35223724-35223746 GGAAAGGGACTGAAGTGCAGAGG - Intergenic
1183381686 22:37493377-37493399 AGAGAGTGTGAGGTGTGCAGTGG - Intronic
1184641125 22:45870823-45870845 GGGAAGTGAGAGACGTGCAGGGG + Intergenic
1184644405 22:45888471-45888493 GGCATGTGTGTGAGGGGCAGGGG - Intergenic
950540479 3:13609436-13609458 GGAAAGTGAGTGAGGCTCAGAGG - Intronic
950842187 3:15978285-15978307 GGTAAATGTGTGATATCCAGTGG - Intergenic
950852860 3:16079533-16079555 GGAAAGTATGAGATGTGGAGTGG - Intergenic
951577266 3:24126711-24126733 TGAAAGGGTTTGATGTGTAGTGG + Intronic
951770618 3:26252303-26252325 GGAAAGTGTGGGATGAACACTGG + Intergenic
953032918 3:39189746-39189768 GGAAAGTGTCTCATGTCCAGTGG - Intronic
955028788 3:55196508-55196530 GGCAAGTGTGTGCTGCACAGTGG - Intergenic
955631203 3:60977535-60977557 GAAAAGTGTGTGCTGAGCAGTGG + Intronic
955902650 3:63773911-63773933 GGAAAGTGTATAATCTCCAGAGG + Intergenic
958774318 3:98463000-98463022 GTAAGGTCTGTGATGTTCAGAGG + Intergenic
959912274 3:111776958-111776980 GGAAAGTGTGTACGGTGAAGGGG + Intronic
961391694 3:126555997-126556019 GGACAGGGTGTGGTGTGGAGGGG - Intronic
963812460 3:149792003-149792025 GGAATGTGTGGGTTGTGCATAGG - Intronic
964982845 3:162707703-162707725 TGAAAGTGTCTAATGTGAAGAGG - Intergenic
966351362 3:179035506-179035528 GGAGTGTGTGTGGTGTGGAGAGG - Intronic
968527823 4:1073106-1073128 GGAGAGTGTGTCATTTCCAGAGG - Exonic
969352590 4:6606329-6606351 GGAAAGTGGGGCAGGTGCAGGGG + Intronic
969560357 4:7942818-7942840 AGAAAGTGTGTGATGGGGAGGGG - Intergenic
969887444 4:10228227-10228249 GGAAAGTATGTGCTGTGTTGAGG + Intergenic
969992289 4:11276976-11276998 GGAAAGTGTGGGATTTGGATTGG - Intergenic
971902357 4:32678171-32678193 GGAAAGAGAGTGAAGTGAAGGGG - Intergenic
973648103 4:52970159-52970181 GGAAAGTGGGTGCTGGACAGTGG + Intronic
975104608 4:70553662-70553684 GGCACCTGTGAGATGTGCAGAGG - Intergenic
977011858 4:91645608-91645630 GAAAAGTGAGTGAAGTGGAGTGG - Intergenic
977415438 4:96726903-96726925 GGAAAGTCTGTGCTATGGAGAGG + Intergenic
978122904 4:105102788-105102810 AGAAAATGTGAGATTTGCAGGGG - Intergenic
978230943 4:106398116-106398138 AGTATGTGTGTGATGTGAAGAGG + Intergenic
979103112 4:116648286-116648308 GGTCATTTTGTGATGTGCAGTGG - Intergenic
980711208 4:136570733-136570755 GTGAGGTGTGTGATGTGCAAGGG + Intergenic
981034660 4:140156911-140156933 TGAAACTGTGTGATGGCCAGAGG + Intergenic
982498763 4:156127932-156127954 GGAAACTGAGTGAAGTGTAGAGG + Intergenic
983653528 4:170056821-170056843 GGAAAGCATCTTATGTGCAGGGG + Intergenic
984065485 4:175043071-175043093 TGAAACTGGGTAATGTGCAGAGG + Intergenic
984606914 4:181796368-181796390 GAAAAGTTTGTGATGTTCAGTGG + Intergenic
985484470 5:140759-140781 GGAGATTGTGGGATGTGTAGGGG - Intronic
985484540 5:140953-140975 GGAAGGGGTGGGGTGTGCAGGGG - Intronic
987692429 5:21283875-21283897 GGCACCTGTGAGATGTGCAGAGG - Intergenic
987932376 5:24418395-24418417 GGAGAATGTTTTATGTGCAGTGG + Intergenic
988933419 5:36059562-36059584 GGCACCTGTGAGATGTGCAGAGG + Intronic
988990116 5:36662320-36662342 GCAAAGTGTGTGTTGGGCAGTGG - Intronic
989215193 5:38898035-38898057 TGAAAGTGATTGATGTGCTGAGG + Intronic
990261032 5:54022583-54022605 GAAAAATGTGTGATGAGCAGAGG - Intronic
990672609 5:58149925-58149947 GGAATCTGTGTGAACTGCAGAGG + Intergenic
990940686 5:61200350-61200372 GGAGAGGGTGTGCTGTGCTGGGG + Intergenic
990974639 5:61548714-61548736 GGAAAGGGTGTGATTTGAGGTGG + Intergenic
991209416 5:64087314-64087336 GGAAAGTGGGTGAAGGACAGTGG + Intergenic
991747929 5:69766175-69766197 GGCACCTGTGAGATGTGCAGAGG + Intergenic
991799505 5:70346023-70346045 GGCACCTGTGAGATGTGCAGAGG + Intergenic
991829092 5:70664015-70664037 GGCACCTGTGAGATGTGCAGAGG - Intergenic
991891864 5:71345452-71345474 GGCACCTGTGAGATGTGCAGAGG + Intergenic
993698872 5:91094740-91094762 GGAAAAAGTGTGATGAGAAGAGG + Intronic
994344189 5:98665010-98665032 TGAAAGGGTGTGCTGTGCTGGGG - Intergenic
994480000 5:100322616-100322638 GTAAAGTGAGTGATGGGGAGTGG - Intergenic
994843122 5:104951571-104951593 GGAAGGTGTGTCCTGTGCTGGGG + Intergenic
995458800 5:112380773-112380795 TGTATGTGTGTGATGTGCAGAGG - Intronic
1001956250 5:175850023-175850045 GGAATGTGTGGTCTGTGCAGCGG + Intronic
1002538052 5:179888997-179889019 GGACAGTGTGAGCTGGGCAGTGG + Intronic
1003461554 6:6333496-6333518 AGAAAGTGTATGATGTGGATAGG + Intergenic
1004674888 6:17832048-17832070 GGACAGTGAGTGAGGTGTAGGGG + Intronic
1005757748 6:28940474-28940496 TGAAAGAGGGTGAAGTGCAGGGG - Intergenic
1006716308 6:36122963-36122985 GGGAAGCGGGTGGTGTGCAGTGG + Intergenic
1012767374 6:103386063-103386085 TGAAACTGTGTAATGGGCAGAGG + Intergenic
1013567438 6:111381259-111381281 AGAAAATGTGTGTTGTGAAGAGG - Intronic
1013606890 6:111758935-111758957 GGAGAGTGTGTGAGGGGCAGTGG - Intronic
1013674056 6:112437242-112437264 GGATAGAGTGTGAAGTGCACTGG - Intergenic
1014135777 6:117887845-117887867 GGAATGTGTGGGAAGTGCACGGG - Intergenic
1014160171 6:118158384-118158406 GGAAAGTGTGGTGTGTGCAAGGG + Intronic
1014541002 6:122676308-122676330 GTAATGTGAGTGATGTGGAGTGG + Intronic
1015250619 6:131123981-131124003 GGACAGTGTGTGCTGAGGAGTGG - Intergenic
1016712864 6:147193307-147193329 GGTATGTGTGTGATGGCCAGGGG + Intergenic
1016735693 6:147477556-147477578 GCAAAGTGTGTGAGGTGGTGGGG + Intergenic
1017266146 6:152448923-152448945 GGCAACTTTGTGATGTGCAAGGG + Intronic
1018825228 6:167403887-167403909 GGAAAAGGTGGAATGTGCAGTGG + Intergenic
1019258114 7:64478-64500 GGACAGTGAGTGATGGGAAGGGG + Intergenic
1019788041 7:2991914-2991936 GGAAAGGGTGGGATGGGGAGAGG - Intronic
1020089472 7:5330612-5330634 GGTAAGTGTGTGAAGTGAAGGGG + Intronic
1021926873 7:25542287-25542309 GGAAAGAGTGTTCTGGGCAGAGG - Intergenic
1022972563 7:35530947-35530969 GGGTAGGGTGTGATGTGGAGAGG - Intergenic
1022990298 7:35700412-35700434 GGAAAGTGTGTGCATTACAGTGG - Intergenic
1024980200 7:55151934-55151956 GGAAAGTGTGCTGTGTTCAGAGG - Intronic
1027174861 7:75896877-75896899 TGAAAATGTGTGAAATGCAGGGG - Intergenic
1027894033 7:84017676-84017698 AGAAAATGTGTGGTGAGCAGAGG - Intronic
1028220154 7:88187942-88187964 GGAAAGTGTGGGACAAGCAGAGG - Intronic
1028646850 7:93108217-93108239 GCAAAGTTTGTGATGTCCGGGGG + Intronic
1028873942 7:95799506-95799528 GGGAAGTGGGTAAGGTGCAGGGG + Intronic
1029864145 7:103607400-103607422 GCAAAGTCTCTGATCTGCAGCGG + Intronic
1031006274 7:116475982-116476004 GGAAAGTGTGTGAGGGGGTGAGG + Intronic
1032366577 7:131305768-131305790 GGAAAGGCTGTGATGTGCCAGGG - Intronic
1032627817 7:133611654-133611676 GGAAGGTGTGTTCTGGGCAGAGG - Intronic
1034012089 7:147540247-147540269 GGTAAGAGTGTGATGTTCTGGGG - Intronic
1035084657 7:156247724-156247746 GGAGAGTGTGTGATAGGGAGGGG - Intergenic
1035190507 7:157163430-157163452 GGAAACTGGGTGATGTGGACAGG - Intronic
1037976851 8:23219968-23219990 GGAAAGTGTGTGCAGCTCAGAGG - Intronic
1038135719 8:24783492-24783514 GGAAAGTGTGTGGTGAGCTTCGG + Intergenic
1039193405 8:35002669-35002691 GTACAGTGTGTGATGTGACGTGG + Intergenic
1039658247 8:39433634-39433656 GGAAAGAGTGTGCTGTGCTGGGG - Intergenic
1039951824 8:42178983-42179005 GTAAATGTTGTGATGTGCAGCGG + Exonic
1040841867 8:51792946-51792968 GGATAGGGTGTGCTGTGCTGGGG - Intronic
1041710004 8:60885889-60885911 AGAAAGTGTGTGGTGTGTGGGGG - Intergenic
1042293320 8:67192683-67192705 GCACAGGGTGTGAGGTGCAGGGG + Intronic
1042649614 8:71024715-71024737 GGAAAGTGAGAGATGTCCAGTGG - Intergenic
1042985460 8:74578233-74578255 GGTAAGCGTGTGAAGTGCAGTGG + Intergenic
1044356098 8:91224716-91224738 GGAGAGGGTGTGTTGTGCTGGGG + Intronic
1048182221 8:132206025-132206047 GGAAAGTGTGAGAGGTCGAGGGG - Intronic
1048456593 8:134584158-134584180 GGAAAGTGTGTGGTGTGTTAGGG - Intronic
1049337665 8:142095060-142095082 GGCATGTGTGTGCTGAGCAGGGG + Intergenic
1049945054 9:586355-586377 GGATAGGCTGTGATCTGCAGAGG + Intronic
1050184946 9:2963384-2963406 GAAAGCTGTGTGAAGTGCAGAGG + Intergenic
1050365468 9:4869672-4869694 GGAAAATGGGTAATGTGCAAGGG - Intronic
1051659889 9:19416286-19416308 GCACAGTGTGTGATGCACAGTGG + Intronic
1051715529 9:19979051-19979073 GGTAGGTGTGTGAAGAGCAGAGG + Intergenic
1052119587 9:24695206-24695228 GGAAAATGTGTGATTTCCTGTGG - Intergenic
1052977066 9:34419203-34419225 AGAAGGTGTGTGGTGGGCAGTGG + Intronic
1053177973 9:35943119-35943141 GGTCAGTGTGACATGTGCAGGGG + Intergenic
1055241683 9:74193847-74193869 GGAGAGTTTGTGCTGAGCAGAGG + Intergenic
1055701460 9:78949338-78949360 TGAAACTGGGTGATGGGCAGAGG + Intergenic
1058287138 9:103192212-103192234 GTAATGTGAGTGATGTGGAGCGG - Intergenic
1059055275 9:110972657-110972679 GGATAGTGGGTCAGGTGCAGTGG + Intronic
1060368644 9:123046428-123046450 GGAGACTGTGTAATGTGTAGTGG + Intronic
1062614156 9:137388467-137388489 GGAAACTGTGGGCTGTGGAGTGG + Intronic
1062714941 9:138004686-138004708 TGTATGTGTGTGATGTGTAGTGG + Intronic
1185794457 X:2953047-2953069 GGAAAGTGGGTGAGGTGCTGTGG - Intronic
1185814526 X:3142767-3142789 AGAAAGTGTGTGCTGCACAGGGG + Intergenic
1185934417 X:4239565-4239587 AGGAAGTGTGTCATGTACAGGGG + Intergenic
1185934420 X:4239594-4239616 GGAAAGTGTGTCCTGCACAGAGG + Intergenic
1187310163 X:18134098-18134120 GGAGGGTGTGTGATGGGCAGAGG - Intergenic
1189555096 X:42135027-42135049 AGAAAGTCTGAGATGTGTAGGGG + Intergenic
1190502669 X:51095295-51095317 TCAAATTGTGGGATGTGCAGAGG - Intergenic
1191590120 X:62873616-62873638 GGTAGGTGTGTGTGGTGCAGGGG - Intergenic
1192077444 X:68014650-68014672 GTTAAGTGTGTGGTGTGTAGAGG - Intergenic
1196003083 X:110807261-110807283 TAAAAGTATGTGATGTGGAGTGG + Intergenic
1198849214 X:140947691-140947713 GGAATTTGTGTGTTGGGCAGGGG + Intergenic
1198874926 X:141214258-141214280 TTAAAATGTGTGATGAGCAGGGG - Intergenic
1199929611 X:152505404-152505426 GGAAAGATTATGCTGTGCAGTGG + Intergenic
1201266936 Y:12216127-12216149 AGAAAGTGTGTCATGCACAGGGG - Intergenic
1201310724 Y:12596353-12596375 GGAAAGTGGGTGCTGGGGAGAGG + Intergenic
1201715997 Y:17044357-17044379 GGAAAGTGTGTGCTACACAGGGG + Intergenic
1201716004 Y:17044414-17044436 AGGAAGTGTGTCATGTACAGAGG + Intergenic
1201718337 Y:17071377-17071399 AGAAAGTGTGTGCTGGACAGGGG + Intergenic
1201718942 Y:17076448-17076470 AGAAAGTGTGTTATGCACAGGGG - Intergenic
1201719044 Y:17077335-17077357 AGAAAGTGTGTGCTGCACAGGGG - Intergenic
1201719304 Y:17079265-17079287 AGAAAGTGTGTGTTATGTAGGGG + Intergenic
1201719417 Y:17080392-17080414 AGAAAGTGTGTGCTGGACAGGGG + Intergenic
1201719632 Y:17082465-17082487 AGGAAGTGTGTGGTGTACAGAGG - Intergenic
1201719727 Y:17083358-17083380 GGAAAGTGTGTGCTTTGCAGGGG - Intergenic
1201719763 Y:17083696-17083718 AGAAAGTGTGTGTTGCTCAGGGG - Intergenic